ExifII*Q(12i8-'-'Adobe Photoshop CS5.1 Windows2017:02:22 08:27:580221Q(HH ~Photoshop 3.08BIMZ%GZ%G 8BIM%:Sr9D) 8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTDocuColor 242-252-260 PS8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMOQ 9781782210818QnullboundsObjcRct1Top longLeftlongBtomlongQRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongQRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM!YAdobe PhotoshopAdobe Photoshop CS5.18BIM maniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlongD{%FrGAdoub@>FStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslongD{%LCntlong8BIMRoll8BIMmfri8BIM(http://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$۬M,XKxv}n`Rda;a;{y!GR"T>׎+Jf+ݻ{ 2PecnW!jSO&J'C(%P4bR1ckh2ԙe&+&G, lx6*)ۃÇ˭:tHݩjsG3.vF?KpMc}K71fq*iqYi+%&KU-h!Z[;}6EH-*>D֘g=8bGʍs8%^Jg: Al! IR~{2y0\MWlf8QjvZj71"EGq4tݫt1;]j -O)ykc5NH"GXq=r}몝i4+RxS5R(LRW4QU8S"f!buvpt}PN3SCCj}NQORSD~efM>O-7>, P҄j}:]Əu蒖X֞if||ÉZ9a)?iqi.O6z QM[LqoDz۝hw~4f} KkqI\|fE v;k %(c`GǏa^=.;YG_Xxi6+N\$="VVrsz3)zU(2T [K( 4Xdƨ_hݷ$ŧ#_Zh(jSA]R}rD)#{&6K\ Vp4f#,`Б r(%T+[`H3) N,s-7a/jzU?ǯ{?)<)~?#=Ya^rH?jYP/@{05>Mz"{{+׽~oa͇OtתO^7ǻO[{5#k\I{u R>`ui]@~νJuUO_HPbq^S{ǂ x"S+{r 9ou*T~oZ𤦥z }_B8'8{m(鑁C׽1N{wJӧL׽lG}EN=ONA{߀A6oT_~Gԏȸ_wUPuZāɷ{lu|~u+PMOkhE+N:O?׽TQ,=ǫA׽Vܞ.9vg4s.힢`!nEڕl~};i'_}A_V{IK ~, EW˭\(`H& Cɸ?m(o˯{m@Z7?IQo⣯{%U݉?Жu!`uSj{vQk\x_ڕ;^թ\v # 58-~HG7.E忧D*iV{A`  j+RO{ʪc]b, ůn[Ѿֱ67oTr_7 ?Ff_ߘ"z{ V`ֽIc{vUkh+ya{Cty ?WSTe* 5WG^ff+fnTu:\} `K]Iڊ/䞼yQ n@~}Wϧ?zVaa]W׽E'H"կvs}}R9ȶ=E5 HaȽҡM7PH[1 <~=(4eZo{N(>SKiu5z6ӡ,[ZܐGfxzyt'XyO@G{ƍ$pl"$S׽ PzM 6 ӫTFHcv K=PunF@,C ܛu]J i>}{ܠ77cjxu~a8F:3FA6(}A݄PGUIH\@-{et_> umst`5\1oꙮ:(6>ֿ1׽s^WP nq^rÁryRtʓl D}5n%? ulzEM{ZϿPdc+{bHPit(1׽]"-{?6Ԁֱ׽ɍX}<ϻl>+:U׽{GǐlA@-E?>*i$ lAV֚VQ׽ by͔O{ ҝie${bZ5eU\}´>8F/N[>ͨ6[ctw(1lz9+fkVk0{Md{ڵuKGבoے~ç_gZ2P]{&RA \}>i&:ƶ. Xu?~Dbe'w^`_WׅXnA'ǷhlPNt)A?F@,ŴN3bOO~u^l >֨Xׯ{A,tēŴ]G=4S^U6 V#<y?m<:zC2 %׽],t&B{^䤄> {귿u{ܸO7Q?[ HՁbo8} ۽ڳë׽M9EA.窫EԛOT{>=$׽ }-ono_}ln={/0@E?֙Xbh4ܟ_zhT W y?Amt!Q҈{%9gOְ@4.1+M﫛8#SS[={M>ҤX}CN.LJڔ}SpG}>R|'{-klH[_I$QQ#qM u/|/> s_n2@|O˯{rt g j\t@G@O<U^)T@oET'^sɷ6Ur];_zp^:vPymcu]765+Lt^)1Mw>4^HV9r܏<A |bܐI[}@nѝzK{~/rq"z^JYdxCWH˯{7XH}}?׽"ֱ7-o ?Ow:dLꏧIï{æ[K_vҾxͯ{~Zx@n׽#oX #P?_z@`W^ c@ rH_mʿqh1׽M"pǟ?MNJrjRQEm>AE:AZureb ( s ]Tm[6`MbߏV4rIܡ ~5]}tj4] })Vaz T1Oj䏧#~}n{[aW*>h"թ׽up<%OFBuM>{?M?MV߿h(}i_zួK|QյX. ]E>;հ <8LMH#3{G<ْpZPx5]c HSwMMTU暏%=-e,C-dz(ؙ5B}j^OgNF9U]bqF:zfDqO^ӊi ByMtn3TT %<,&1Qm j(k&=EzWT& ;%( ;I&n0%g2YLVwjK$3kᎦ "ť증Bl /TRe kEpsPѤM֗˸Z 5n@Ju⩨XkbgH% 2cd66Sk Z>ȷin}jRcr VX)"ͩ ?,"mOq?ڦX^ېPAL\|fzWtspn)L Y$2#c@?$fIE \}6{+sFY*eꩥIK1qps7沓mx DPi ҭJրt!>nUxT[7]mld~M1R?Iy6b!._-1v~Ӑ*z<6FS)ҽe]!s']@kl$))äsNhK \ -Ikg s5k@g˩6c槧͍ۙ =^6(]˸'Ih=QUN]vJc.bM.̦98i*4HS궓y4I(Tv?G!E؁o1d?migdz׽#G?Rl?<{qxui?={܏W?KH6ܑjAZ>]{ l~K o{區O{}}FIBzj%l X) =:{Kv@xoz {kֵ#'Ӱ㤟^. > {Ҕ=zFM~޽W >97힒q., 6 {Ïoe1N}_VHN)׽ ]Mtߛzp<NZ{ ^F@v{ n [soŇoi 􉔣i={߂/?_o׵#oM=?_.^[tۏvV,4{ߵY.'}C IovFWZ: -0">yLWEbg׭q_>톮n,$>[XuQMoï{`&/עZ^4}- 6Xqoŝ#I^jI\.A߉׽bK }Gnm#hlt^9:O9s;l-kտ[TN.kxS7^& }x GO^;}M 9-oMWmC/_:GUu| {/qm>IzF\~,oNNlJKoo_aVOW{ی1  uSBz:zX,t@?G?P=?:k7[s>y8,u>E[pE@>O:u#v㎽LlystzeM9{~-~9MMOU{Wsdi4׽.0'ak'[=UV׽*: t>nR.>Q_mz[ ֿP^ 5LoX^Y?eU/׽j+ jJwU^T)ckG{e׷-|[/?ߴÇ^,[P.'RՑR=: _oh+C.B9}mr}__iFQ?.c={ab- -˭{V/Q<2s׏;sma`lK=o>׽UҾ_`A[ou~WuBW^.Q厭L@A#ϵcE]:~n?QJW˪ ^́o׷{Ό\+IF +׽@ƕr/|^CqI#'xY ^C?/? 87v^C@3Yq E$i~,:ђMz=luy~~}_o[ur,9ůb?~)NSGO8*Û}{]h a{ѽ_["HzԒJp ؟z.Tǯ{#u 7kvԾ;?~޽+O$V׫ Huzqio`?>(˪uxjE ڔ@?~K+8bޞlFbz9jk$dQ{{mksv,:*ᇠ ,/*v*f.+Zy5hh@:z~ lv^ 婎e**ˑ=*e#FB (({ۻm͔CE],㩶\# ˑ]y]2<8"KtګQ4YM32ץ2P%:KYYo%ٌ)}-@?P>L87emz:᪞)+֯%GAGkTPsDD#ZOR)/$hccueBF?럯~ܖzl-+RֽӤjq{nIxBJ`~zm 5RKg Ŕ#C!).?'١m44Yx<% +騞I%Я!&P9omjFi[b @=N$c"$GBOM fŶ]B$b&JhMT bUY{='{y6;/x칫jR7ȬSQT4 ex抔' Kg,WGR@ Gϥ;ѶkyȨ89?_cw&M)ӿW(`dm1rMgac`Ëz=|n񝪨%uT4RCK$ TH꼍@=egF6YYb$1(}Imy7?FmU%KH""oZ߁m'^?y3(OOpG }}]C]{67'{gJSO^|?/{IK5Q\csmo&>=첌t! q׽ˎ.nl_n {܋UIc':vUkIuk&n{0T rܰDlԯgN0KB:8ߟvn9J׽@?P{VI^xyuy l>H\~׽'Uu}ies~x m5u<|Ϊx{Zuh{`'P I]Aן{zzJM?ٿܟHV*^X, z?.٣^#9${V={sTۓ@G^"1׽\_ſ&[*u}Ē{}{Wu_ ~^ķaȸxmSC׽5'n?Kh=hS˯{nsabہ׫hGKKcÐ3i^4[^{rF[}W!Ӈf:O+d([ Gg{ Nz^@= c{WoRF^.Ckѯ^׽OۃpWe/N$G>?޽?׈4׽7Rk്йc^(x}ةHWONNE(^, $mEe?U׽ەvkH|:Z̶@%zACyW?4A{*yI$^y_Θ8{^ݛMc~.O<lJ+z?^n ʐAo_G^S^NE\e>R\j{lGnk*t U-zO,qJx-Z^8r$cp4{V3Ձ ntp ­MGGvusO&NI[Pn?~}{߭:ymI{DBc~>o]Հ׽Ck\؏ vAC.-{kXnmZẀ>5Д[XpG>쯨PuX!g^eo6?{0pUxc׽Ǐu`^D>" қǯ{ OO du+׽̊A76Ë[u`{ onw@z;rao z/~]\(9'={ܤM6>}?Ǐ{ܠ@Z@}޽ERuPC׽d'ʘA鯧OS׽幺ߒ/R£<}?׽@Ÿ-f {}-ҢԊ@`Q7S}}3סJ%q!H[l=-N׽ˍ}V{ 0EZ~} PzkK>(G}mf:V?d׽RHM7>]>'ӯ{kKb NlɩW_Z5: ,y]$1h =i0ll@vq܎5Lઽï{ #O,n-n=Sur&:l!X&}?~NƂ>X[HZŭ/8N5(kpH[1_ۑ4IaQP/[8u|1O7Ox)⿰׭3׽io ckDdQW_i4X ooHT S\zu(ux]!:Mbo'ts׽7[^^ToR._ޖӫ˪#{Քd~~޼I$׽EC]?.{$#OǷ=T%ҟ׽pbӎ[88Ua:n'?{x1+Xon?ދ׆99ٯbn~H&ֿbS_N5xui)Is7$ɿ?}x7_ux@ ~ZB4hqZ{`Qзb[}Ph VGW޼NVܠ2U'ͅU$~.UB'_^8S)U.y^߯Nj{%5i"m#U>uyЋ_Amʵz~A+Daכ^c`Տ U[qtO^\Zn@sȷo{ꃯ{ͭ\m2^Aaf{, :'M:Eʋb^$|k [߼%TH^ڃ׺5 y^zuﰬ\ֿ[ֺ+qkǓoA{+ov ?cz7Z*?$u=11X?k?ןni4uxM?B8)WNq׽ƒW_6_=hU׽N,} X7loP{Z ymS5#X_+֫|+^Ǖd?{)NO^ yRXxxրPur-HGի׽f ~?珧!^<0Ek׽,$ 7?}I`Cu*X:/zTo]KYBLcYkqX̣t4x bhcm ʱ>{n w VP5=uMY_SұٵHܕ0O xLd U}&YF8=WJ\uleRE5&Jp#J<9/22t{{tYX)h/ uVM3Jlʺl= ri$۰m@ՅWL~|Zqh\>]%u)%:S) E} #?ȥ{FtAQ[_exx* "'7 jޘ?>D t|f'nT22"S =,z QI ݝ5(#p:oI09lNs9)aESUirUPR]ZW/H>{=\PE4T8@GM>:nDy $Lrc"M*Shjl^pl\EJUhI8<4L3Q([3~;u)QXZT(i^}@zhmF[S Q>uVhĢ[z‘'_{+L9z*چYS#]r*>]wK0RE|<@Mi`nǗCOC4+%>XdcHS&'VF:j4cP\ }iQtiA-ow/׽ Xk}}P->b1A׽4Ǔ{~nQ=^?-nHjWu(ڇ^,} ^r9ǏV1׽0$i ovu}׽_<Ao^D'^"76k'g(1׽'Hs_w}{` /aZIDTzx?nW~lxoAU^c.}<Ox?omf {e@A`{J~u'^T@~:Dpybߟzz :o^,ߩQFB{ poc{ }*_"į?[uǺS z2A! }q{_x_zKAZW{_@~G=׽u1 ) 8vGxA׽.āpǤ {v/u`1׽`Tk~,>#k KN[i={ ~-o _QYitp*>q"o~ӗ?>}{j#7lȽ:^׽e7.?U VX{~zuB4={s&>QcT5ۑf*~OmXe=m^֗oWǛ[kqfTփ˯{"ȽTh5 5uyV05/ja{QG^!6zM}몖'^̨]@{9'_}?^z"l?1\pc{T6:?Uߦu|IV WFMY)$g{UO{isϻu{7-NG}:  lG Zu(D#um?c{.#{Gfӭi^"*"2l/r,:8Cr<F8 ׽jeQckks#z:0rW?}+^MMO^x]qMo>ﲖ86ߏT={%߃s[CJ/U9-z+{Av+1׽mr=WۙS̟}?Ԟ?T:U$( ß[ ktRC8nPA$|E '^Sus#'BH^G-%#݌11o?׽Tj&yOWPc={VDpZÖ>=buSq:PmMX~G6N}ӫur @3_Q) }N={ %,Ђ= zXn:h:^#Xn/ۋ[=x(&^2ֱ\# jzsΝ{ے~Ojzs׽I>HZU7qɱzBX{7WWeYT,H^4-.=6Ӫ x!W4SpwJ|={qhX+0'8?{ꦀz7:E7 ?[{vkRtr}FNW={UR47<څHڙuVjW^:!IE@H?M'z^SfUΟ=׹:={EP67ynl3Dg^Jy%8Ծ PN=\Uc[qſo~T>qܯqon"׽C1O y[?өNxcFy~BA?W#iMhSIy"Ӌ{[*F=:,N{ Q]V{ܔ`o '-cOupGI9~=X@(?N8ZǏ c|4s?<{r?uX Mk=o{ʪ[כuӯS{W [mZ%RQa@Oj^*[[}=ޅ+NPmD<~_T֚uW{t(^q AS$àzZP.?PR~6_z+݃^$5;/*-q?zsB(jGn͸Mɵ=GH7zO˦z@@R{[/{SIHG.׽RPOڸFbJc׽Oݎ:onsSF`ׯ{Z_/"@~?/_~ν5ݴo?_5׽GLFB}KW E-],y YZ U.# *J":* Ǿ`M]]'Lj8pRzMՉV=oSTӥFJV9)喖'KWk %=[{ioʜonns*lOCGVY5^@rU 6}\ $:6J28y?2hE~Q 5y* +7?YT@d=4MHΐ n7+C_quCRqI OKS%hZ6H ϰ܈4^#Fr+QJӇF(çJ*L4R1#CfEHI=6n> ?tUPdbQLhDpI )y6F,lڀf+"INiad$qMN:LIXZm@ 'e.53T& !ֵ# jZx(,sHtTmðWO8X҂]=VaP'NI Ʋ\$ _8Zk#mrlU\8y'#J(H?!RYt*ӃS[KPSE~H`Zj$!<Mܘ G*ʉ>}reQ=,H2_ӣ[g+ee12cgw[VmZwRa*Bԩ@s5郬4(En8Ӥa&]Dž*OZ د}nmBo@V;+!+Rǐ̤Q>=α#0eRsKeO}~RHka24,Ãn}b85*1t z*zM&d B%jjJ9tx\Ԫ~g#edrM IrvW)rUX[G5XH߽(icFҷ*Y=75٤bѣVP]Hj0`ƃd( ˢ55Xm}e /9Ȳ1LوA(1<>ݸ=[GOl RZgEQ!`S륈դX,[M!yPY)Ɵi9uG:$I )"ih5G->:q BO%*tS}./kEDs{I>3=4kO+s4Ty꧎4+%B+}@iƀ[1Vj g)1OKmGڦ?okZm*Vt8P0Xc .>_(Y0c&U*ZznʆOj'O2YQR[^y;i[jZF~\>P6=i%|j|гҵk]Vvؒ&f#,rxaw[^l cau= ^FE{C){6N+'}{0 ǂxwt TIv~#& u`Wc#$jBO }zzQkߏaX;ormD4nMÃHI,̬e269Pn OtMeVt4fDRp 'ls͖FbY PN}{ݔ?A1>`vvr6嵿'xP~Xbkw | r<e}˹7w1ZW"Oyp|#[o;2o;7=ĝ5{\LZz\JXm_׽z%Fi,Mڷmʧ wt?W^?sa6Io^F=~?_Q{y_N\Zz<I/l7F20M5~V 5rׇ˘@ _$u}^{ikǟ_vrn=Ty Iz_o˴A8O{n=9kdνx]IӴ3zE}~WG-\1jԼk_|aoaڃ͎ \>.\?W[[${ -M@o@Vg\yep֞1Ekd޽,]anf}t߯wWjs ?aIo^l]lGqm3{Xts\}߶>\?OM]${$ŵ,y,>>_ӿs?aM[z Tڂm,Ս'Y:y]^_)|Ls M[zg`oH]˓+x:\yep֮~[5,{yJ.mgן~q廿*Q/1Z{';/p_6Wwep֞r9${mP'Wxl ;G}~'.uŸLnƧ ig^ww?ڽg?/yZo^|odνQkfhjkLT**#oX}-kies:dpZU"6p]<:h(E*h: scuQw.1#FZ (X*uuwQooQQ|BKOeTupl9Z$GozG^,%6_s =:ܠrWԶ hk"{,XR&t89<p>C#&iJc?Fn_v]vow)uuxyjdSUIcS@bXX^<3]ڮZq5-nk]h_ Cjo!Ƿ~sr,1NI1iDLE]J p^n[YX9$gA 8w:X<./7h`?NYnu[yo{ql{97ȉ8]k  ?k{PM_mm`yql{)@xn0<(~OKڐ ͛_kC{ejo6î?훯{?X9,_}OjĚsֿ<4 ^:~F)!O\k1blGOo4<+_k_\me*o/xu&˟׺ (On\Okm8ss ͷs7^8+,${w ?7on'gڲ*[w-m~B]Ga{u~Ool?m[~Sy{eE@s.-}~ԡn?ж?דj ݴ퓯{rcwsn p^> qZooڍ9^/6W}FQs?ocڀh;gWsr59?헯{,|SǺMMp_Zsrۿ<׽?'tCn[ouyGu>0.ۇݟzgbwͯCzn9ퟯ{?7}O6g7G6 a jx}8mm)w~*,OM{~8-wOmd~t1FowS_Cn9ퟯ{+77T؋@?y_5}=p_M_y헯{M=Oaɾwu_>_geom'^O {{f'^X}/nD{=+-pgZoE9Oyb~wOSIouO _k4wOkmks|=?YSkOE|ewbsQr?n{9 ?}ojNZtӍ=-?5|ewN?şl{I({gN]?ͻs\7^ɿg~=Pna{o[?kmZ3n'k\1߮MԠ={iըX:i6N1XÝ,[/^޿cC6mn?~d{ߏOR8݄OmAlw_kmU~s6K?{;Aϖfnd۹f)<&.a2U38@Ԩ 8{9?fbI-n~ex a ˔rʠ,}e)`K[:M{g~{ vTaoM/l={߇i=c{g?:Z?`ig^-Qw5Bݗ:ܽvk/pֿ wſ۟o׽W{ܓ+\l#]pyixrدHc0,{?.'pE屑˗Yku[z_ӛ^,-sMLCZ;4K/m?[ 9:yr˿+0ީA,{ߑ0?e-.665>~<Ÿջ,oϥuqDG7=峹3gs˗?SkoC[{4Q;Gyl~A;/pMe)S/ޏ`ig^(N٭ōVඛryݿ>]_[s Ϙ-_׽l .꿧r/G- n\??mdνRط-kkOZ[)e{$S;M;0BvNiߛ/.\?ܿ{e{uSI#h}v>xͯm9\ o%yݳElw~W8]Wz?w_$~?ʋ{ۻm[rV<LZzo,{ʇ{v#ۀ\]FއߟG-ݟXzo-o׽*{fZ܏F{7wW.տ4 md޽T{nٌ9 ~\v?2֏} o%}CơG]vrj=_]I7n7?ـ[lͿ$_-/.]g7|omo׽ C6R؞c'>}X嫳ZzYo^S3e>~USw?W_s+Z$z?}6 pU0HczJsp?aΖ|g5狦Y.!S‰ "%mT+O&'^s}vb[ycw%H d`5)샨 pGX:O'O%m0Z.:P^]1>td:[O eb׽&Q{5<'kSOVV)Ib/ͿM_ݺ^_Vě}. !{Su\{ P"ʼne]G}GI!Tׯ{@~qpֹ'>9^8Dx67 a͛mUJ^^E[WyWպrp;G|u{ f`S>*tK_ž&Js|N{P zjNQw˿Rsa6ψ1W⩱XN2M J SUU UCW鈐co>L,5$rmŅMi7de+F xTa2$>0Tg-yj-pצP2k 6FU"ԸpQӢTI,Ki}LYssUeY<4.o'&5*5455o -)x`F/#CQ q}瞊GOԩsIWV*j)hf7Hݝucf/EI3cVjlimv_*0<`7$ d3͸|#ݩ(,|}<^Mmz7^u8eI>*ʃM fFTScP)Z_excxlWe喋PĢY2DkIXXX=4#[|ҕ8 ֹ7 z^ǒǚZ ܜFSL:XZ6OK- m{U5xsSiYrlv1eOVD5jblWw[(q BH ΞYBx;x5VB:QK*ix{.K)<~nòYF\^Jꪩ1Rm禭)icT)eJË^Ik*M+Z&'Rs+6@,@Q&O˩ty:X"%4O=],XcYH ͩYؑqk1usI)%Vn8+le hA ,28qӣk- edӜyjAMb'3t|m~}釩)53Wb_Mddʙ*`į@C)BHcJHJ+-Ei<~=ʉZW9+- Zdur#*iy`5J%? xt~'gm]JJ]|;#Q-SZzVUTf[6k o; {XL*A>NMiQ9UTpMPPf%LH]t1uw TMҢn셂*vيBDRV"Nڽw+G1Dlt>2'tB63}gHMpdQRTQ%._tz"cf/F.T4b a}m<^ ck9.Nks}=m^RkqkGke7\R]BBROυz{GS ~]'tɓܹ꺚ꌕ?<ԵU}SPYKfw ltlac*찳*%h֪GZB >>Ͽ)sPq&9K={ܨVOl/`xGzb~#wgqowUoOB(^W<\B( > ;O#6Z Ip/W7{mǡ$Wzon- ﱅQ_h2q,1†{`}=qqK4Zf2F "P5 t1Ϝ(Yu|"v㒱<*H(A@k׿ӟu/7Ώ4I`ԻGb@ux41Zn>s:WǍO7}g?:E{At5kg׽cbsM Py7ܟ{dV _2I{_-f>?)rT&$jm pE{WcV鎞_%So4>^98m?$OU;6KŎih( 7_$`y=7k%v]QF?Ư[_ǽr))fkm?)Lݚ)%@uڛ!i[I^:IH>dlA?*?՗%s d~,2>VUvJ9J%flØʵa}lߟϴ}v]1Hmg,G^Q?&uG#Bֽ<{'zlXRWz4iZ:+gO㥫ߥq&m F,+2c}ne}}c 8}rՃՏK޲ ֎br*ͨ{)ոdAEHα%Nsݕ1ڼl?K5.Q [AqwާH3-gXKkd xp|DNɔ6SmK4ˎ\G7gOQ?W[ޚg']m?ퟬ|EK$ّF$iv΄Y~żZey/z d-׽o+3~VnɒH $H8 $_ڛwLt/wk3RHP?ڿ\D];{_I lhǨs#GJ8 iڙ5qlS296O7K=5S#jK<پzRȿBo[Og`AÊMKZmd/r.TaϺ7jXm_K-7׬~22eN5Aguuv̮ةꯒcrt^UHWCBi̮F(e.;؛>oܟ>tR{7cqv?~L,_%C&O"{[,1i!K6g_w劏riڻZpcУ.IJX`(c?Y}Sw'% iŬh]ii &L! T5y kE,,~|\tG.oнnOM-dQ#5jQ! ?'촠mj&+굸Uր[[CǏ)!RƞyJHZ *@|N@1,n,EǽnnU>/S+zoumEONfUbL(QA}#KyRggS0>)iQ"ځ*E:owTvж<~]k~8͓|9Zr'_nG (꼛Ѵ M2G&*d6G1Gl]fn [C sm*0yǗ +Q*ʇT|I6ugjY%$i@唊q%qRU'R?{ת?r᳟"vKܝsozƳ{bi+2 OWH* XOFϨ:-@~ll9 <竛oUo۹mUVME-S)LO"C,0!idzweEֆUӮ3yv+WkCp#_xzc@Kiyg~!|?}uee[3uMX̞SNⶑtTT6C,/jQv/_ǩƓ}=l^^t˼_klhc2UnDab?8l:o ozF?|ٵhÏ|ǹ?my{Ww:ͭ?G^q@^Ow:ͭ?G^Ǿcl? ?hK{G6{|dw3Uy|HllRD0Y0  mPx1 lSLQ$1r*Ř@Q,ثT^n?wkqK#P RHmڃc{֐n5}>mv?={)^l ~t84t)~x&I{ ur{sǯ{$麩"6ވxuM׽E 8&N>0UsݢQ͉<5ozcS1'x玽Za~.7O{Q:"ZW{Oʍak >TN]utn{ن{>8.'a{1yipm2%dhjU%L Fc,uϼz{>,̦#g/P(٬Su6<{g- cnN|h dj6):S9uRogʿP~7mî=_rf zz~և݁l?޽uϔ&_7<>߻ad[z]OW&Sއ S{ʿZ{vlC7msdK>߻ad[zsȒ}?7߿<|Ws]L{5ߔd;ʇj]L{wGre}?7ݏ?w>׻&o׽9uyvL~P]o u[noyp-Y,mQ+*D ;P,X_lCn9V𮵀|#}:vvxanh?/3Jobp A#O}PZju3Kycܴt e6-ϻMm.MQ4G|Vzzo~OS:՟;7]^۫"@9nEjTSʾuqb9ԟvd!]s}z/ ǥn`q_oh]_Ekl2SZZi3T^ԖF1h$.ߧO@@WW/aWZ]}Y6>͏WDR"_=o;Fc~cElpcZ89X}H1{uZ دZ(=CqsȜ{ϻ?cd|~T.}6L޿:ʇj]{L{w?.ɔpݿ<_. &o׽w?r*o{>׺ad[î=]Loϴ*׻ M׽\Ou7$owտc,?왿o^w?OI>߻ad[~S.[<~{?/U\~7n?poI}h=o֮߻ad["՝yWo=h2MV)*~Jckq_ukGw~fھlmf-wč &*F25O5s{ً{ۨ÷*m-'ckF};z:߻HGI̡M$ Z{5ţk}nZP>>Tn?榆k CD%Ÿ8rɺmgp$cĖ:3ˡ^2u GJO?sgܱu\]eh_K{G6{C|V@~Ww:ͭ?G^8{dWwܿw{m{ oz?f֟{{7?S1O/F_;xkO׽c5iחo+޿^;w{m{ oz?f֟{8I/{F_;?xkO׽w0<~{ ї-O?u}Ï|<C뱺+~ucFgw_ޑxkO׽?~~_=^eh_K{G6{߿cO{Ww:ͭ?G^q"[׿j/G^[ޏ<ٵh?~~8;H|Ww:ͭ?G^q@^Ww:ͭ?G^w7񖗏?^/{F_;_y[?gÐ|j}/G[[ޟ<ٵhÏ|Z}cgwֿmiZ:cٌ^ehK{G6{߿cُzZcgwmiZ:Ǿc}^q>_;46{߿ǾcZi>?U/{F_;xkO׽s5iH{c:ͭ?G^qַYǍ׿O}=ch_K{G6{qߘ@~W:ͭ?G^c1mןG_/{F_;xkO׽ ?b?^ehK{G6{q@^m~{2u%Z֎qZOu^ehK{G6{_1GZOہ+_>gw׿VmiZ:>cOj}/G^[ޟ<ٵh?i>ū_?w{mk ozf֟{55[C%]~ ə,uSS#.$fP8#A?xG6=j4 jkgyo f T' Lp[KO:H Tzu\\ڭ{3Ejc/䤦IwTe4:}< ieS6QL枸?*W]+{G9 W?/HS! #eqiS\(-q_umҝQ @{uK GG o#I>${U+Oמoo~..{ۂlOn`X>}{ؓ`.dl\Iԇ~=ޏț~?i/B.Hfq׽܇OSd6X;NVV 2?=!s7PZu|niѮz]غxIxĩ,T<-'zQ"s UrkZG8ذktKZ-=^2ZzR1'[uD/ǎXߞ}kiVQ=zP%G+OGOۛp |{p%,Ѽm%( /1W Nŀk'`M&7>{r˦O[x>E>-%4K iWZ"5Ė* P~ԇn-BĀd3Wm E~]9{P(9 :,F:'(Ic7>Ҙm5QA9'ׯ{kR!:+JT"_squS/PAuՅ}a`FUPBC2-;B5ϴw CDx׭G#wq?_} ١_Fu4e74'DXRgt:ҾC_uḀ"3X,p /ϴ{')UWI?^#aăck{By#($q'٬{dCc˫ĂAÇM&jg2/Q'*X ߀?CYEY.2wW8NApŬ~\~=>JzziR9a \LBꌑ {6WM??pJ*$:+?E?{!bZy)Ҍ3ʤts~=$k.ji_uC\7^}EQnx6crciM<$2-Q @6-}7gL>=Wōb Z ,KGW7'}VKO~Χ@J>:قA?Og/.s`iWzTGsiu(Jb7GAކ(}yd)qW zVjh}oU5Hr<#Z4å9'Qڮl%Q=4qM$*d[SPU?B `c tՎGbE@6#QÈ:Wfi#XBBl\c@.g1,tbO tgu֫3jQƀ=O{/[ugd+3ypԕ'>fhF)ez_D˵oaob/wo4,1^>.x"ա<+J]o'2/e읧&O&~4jcAv %SQ 5M; ?MnZTRm̍CGM*z;%0뵏WX{ujz,>L?#Ԓo2++h 1JW_>_#uٗof}QTVMޛS!ݛ}*^ZjRY0j-zVi?!dv.# vlVk7֧ 6SG(][Jm%UMFOR;DsE2)q|?"6Hac(96b> >~$J,uYNRK[<;ydHo.0j@ChT`{qS?X\&C<Ʈ V:b}E5l4󪺆 HnRߖnAvEaozurC|hEOc4K:ZHgeyf+qa>:|d͆}IvR؝d裉Bm ZCc,`?x}^l{Yv;4u:ISƟ2ѸgZ4Og[SNڡN Iv*l&He}E UA;Q5,lA]R ?= vݦgm֮va1)SgjjyhKG6V͇ZJޑO?`1[0TkS_\̗uU}6JBREB<8*sM5V0ܢӕ EYj|޸o]}Ua1} _`}mp[ŸzqI?pƟE=vׯ{aF}*Ñ[`u(s׽ⵛe81׷{yuZ{t8R^={o$>kçzX o\\q\}AUu6 l>'ݼļOKd_a[3ˊ+Lj⦚ve'RDfH瑍h}>u]+2S]pgYʞ|찢y~&cǦjvbѬQDKe݈oM'9<}疂 8mh(DM\q6nB[1VE9)^q&=dAj?oL1)K51S!jdo21H Yې,X; Hۥ+kqɳtuԦ)YqG+WNa:ovYъ»ufҶOC~Z`G=4K?-+: .!mAŜ 4:]:O@Snrmܥ.%"AHj%^&I( IῶE6QVe粵 OM- nS qT&Qƫ%EM'K~tWa'n6iHW%8~#%u3F_?[1)F+,vA#du/(Ī#?]qC{q.v{Y] Ia=~:dyi zIo )MQ]PR$LEթ*?r.UsovZ*#VPv7!K>:1%qJY")c\Ha2rHW{x- R%Nh>GV7- FDaŸϩM*&h_nOJ 9NH^o_Yly2Q2psiaLT!S1Zm5&ʾ#˨}^\JڷSt1V#3GuD#}^hFex>b*H ؋@:ܡ$רcy廽F2HGkZ٩ E%ў:l~b4={^ֺ{^{{u׺{^{{u׺{^̯Ï*ĥLt<JJ>>:pl[htX' ~?Ԇ-~\o4e3O u|Z1k$E{ް{1 &ᄒ?^)m?^u\il>Puu|p98aoWKs͍2jD cq/F:$pw-?8t{O̴/Zt:P/;)uvwzmrZ\w_|u|Ro_}!락{߽u~׽ߺ^~{߽uy-Ĩ>Tk׽˦=Ni{T{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺\ s=Q~-e\ƽ}^wOk{T=4^#o{*r.m>X~}r5n-ac8~} <-[SSOZl-U$A[_Oz1pk׽M lo3ֈ ؓ -=R?˭j6_Im{t.z5{20UosߴTn a?=H y^ߏӧ7G_jU25tׯ SӼgt%JD1Ъ/͋ g! @vYԬE(}:zWHQfʯPBіZgMvJ /׸pg=x3 Nɣ<m\@mE H{cFbWPQStɹEcP1 LHIS468hb Ӣ]{_j3%&J WQխm*}DaLQu7FSsǿ_&C"WX҄q=j1%٭O{[z4<[RW<,dhK2.Sqc'}?4J}*߯SI6x+%TmFU^Tk0HZFF$^LC~΁Ϥ6퍳*2erԥVW] ME|L:ʪ?&Ïe;cps_njYwԒtxe5MH> D! a)wo6v\V\yӅD,,=×tWb'jj4y9.B *-QR[عGWwK;蒓'=M:ʉ=iU$2Sj .wH`qK-Z4UG % .mRFXFi?.`2]ݻ_Znҫ}dsp檞UY饬JȪI:|)X)ZG>6ka{k-xjڶ!K[$(K^,Tb 9_^ήiZ1B*zWhn~tzl~ ZM_M42J*JYRdGh@}VU$(Zq:Xb 9=OO)qO!xtX{:``dfj) u&[sbi0SQ4u}zszjY&oh7U`iF W]CHMTPUMNR YӠ7}ihpyʢpItRO,A4a{zon{#zLPPhV{K-흝fv mSAPңUmX jsQ)J ##;ͦMNj\~UD9 ώPA.?q,b9Kf[<+1VOMUV,4{g8[;i2̾[Xi)cK;Og%gZ>+ƉjZqzj(.Gz1;{!Չ2O %-;AON%@QO[' k2xj9(d nF4Ʊ#Gs_SnTwބwv:ZTU~\?뮻ܵ&b%qz&M-CcZ)#s!btgiKf8ZS$KEOQWF83ݙ#B9<ki#E&)ƙmt6j說pwQiCv+~ΖSqz_5EB&%i78|wXUO1ܑiPI&1"]#4s"$X{k{u5G^o qkϺ9|i忭Ź_?jPv^? wIG^#uPiuy썅r@{h~-:O7,l*qSg;C֯x*[Er @'Iϯ*Dm1~n#^s_E-cN7ہoH'j 9G_VhgJV8NA?N-N#=\vQSҴQ1tBg _G}ڗEOJ'mNRKۘʹP>xfU6)Կn} jZJ!W uvt~q=X)F/׽6ٌBG Ûs źF:W [Dunph]aϱ#=@jA 3 e[A6Wľ c+1V'uU:t l_ilI'hK;S3똱@D*P(&-;geSyv_2V$y~]Lf$0U$-f؟- ꠰WF` P%>D`Tr_4v$>0-j~kG5<_anҫIep,}RG?0a?ZQF>I.[ ~ mbcH"=+b\a{g5x}& ~]4d*~ڢ6 krC~?.\Iagh[x-ۂڸ>Sѝ2(O.b))@X#>Mߟ=Kٻ,Cð8=I)28ʼ|yQG1%IbI0gnZnexO";Vn yOEݡv&Z=݇m줖fg(dTDt )jW_vv1g׎&sXBe}mШ }+yuo9y&i!p9(OPA< :CJ9{G[#.kMKYyi*DhX8jU1ȮkI&~1>C 4 MO]SCWЬR#),}KIͱ)4'X'Hω=<ȡ=*+;.2lMŵaj1<>@MR%^X#UGY hd4N G/PACnun i6u~b>"]ᒿoRi 駑*hmuNypyS$A.@~T?)"rx ;?u^蝑歏!ZZ"eaW6Cb29ivcZ pQbG>,C+Ęl9UP!3hM 5՚_E,}Qw/?A?$jvn L!UQM$4iN1`9 h'@4x|Q QÇXM$2h/*2I"q=g?oo)MYJ,Gam ٷ6!|*4e(䩌MSLDVFtd?{=~q¸z@ҚIm 1\PK,nfj ?'kAjٿwG/}߼w&_=[ܔ_s7ISor"ᥖIi'yU3M#Pn.7}SmQvRe;(-ǺF"85gxٮ}}]myct{˙F WHT׳(iC^Y85'_ϡߙTRy쯝2Cnm䧪]eGiydhbcU o$TBHA`Lj6/[E 4qeTf{UM` {5H)Ӭڽ׺{^o͚|zbOPOoT[p ]Q S-zn[\AAeӫ)﭂ E^A RYl}L;݋7=l^|Q Jg~#>]XEbjztusQ9V?<_nO:@GǓ}:yϽҦxtR^7HP@G=z1Q'{尖#RIoMsG)vjd!{Ѻ[uaj3[r66r~neqV-zsOJz{yi*~׽ߺ^~{߽u~׽{{9~vHpԴ;B+~ܹ^бjTf$EJi(1;{rjtť"H<4-x?*_oii w*0R +ƴ}E 1xHX4/Cb>qbsMTڙgTYjj .'s MWAOY ]U-`R$zyVWPAT#]ݣm!dv j]Z9'@BEF/,0XkIVb}c< UnYCQI6w(0gfe8gw t :BDۀ}Jv_96>[g1x449 % ('+4K,TTBs r\YZ:%Y?1(lNVBȑ7agEBX^ze7nn-kuof/c7i)GT(øK {F2ش%WBxU`pFTI'5Kk5)*fw(-?Tݿkor~Ex+54O*MQE2XSu썹Iw9*6; Ea>{E6 ~]w3 ;P(riGC \xԴ`T Dhhb4oϬqsn<߭nzJuWIkKI&M3F$B@E#K>DԀx&d7gŌxP\7O(q! W)}& if:c'd6ykrT]c|xO}8G,rQnQ@),} q}5(w`ьu{,2BX#m+ǢFCF{T{{u׺{^{{u׺{^̷o*i,2Ҿ7R{{޿hy#ݼv%=wUk(kO7YeΩع{O1tİ͸WѦ(`;QV^Aή#Ł?=,2::?=/T^Xp}M?#VO[x~zV&{]][{ tR?޽v^4p6mA8I?x%?1އEW̟Y&l'X={޿C;z{^{{u׺0{q4_}>;u|܀>~Q׽'8LZܯ}r? ?z-íT|| GX_K'^x=_?Qpo{m׍o^pCB<~=N|>-kyu} hƯ-`>^X:5N&ߋOQ:PSÇJF:aYXڹ/?Ϻu?:upS_Mz%[jOQOꎽS׽ r~zzV^R8#lu|}u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{ӟ.l &m>/ǾRM~yT=5W^ַ< o!MGgQ׽IA6s}=֍0^J~6Rb+QA׽TapG$}x4-Z^ {I֦߁ueL^a6 c?7Nrz^={e{k\֩׽Sj?/N4'G st Xkb#Akp?{]{s->ϫbk ʺ58ԥZ FBjTEm h8؞ƨx *+_OOHL(:I|H&Y Y$Q˨\gǾ5uOff>eSv$Y$q9KTuU<)@)Ѝ!)آGcKA|Aab|-crI @JVby oaPͅ%jZX룮*LsHK4|5e/*ܰGm\<+x ]~\U5kU#FVii恼a $4b ?lU /U-D]ZUe~f<7j& QؤygI3Pz?+CCP)sY8QzHXZ$9r`mؙvbv+:LKKB5~7hy8%9D& ۹fnJ,!l8$ҕjyz,fy'ġs<3N'>3n 1gF9h9I*(楪Jf# 0bmc.Y[sQǦ^W_+E]Od*%Hnac  C: (Wœt.:!8E+raf CĘj7 HS ޔ6H#0[vr8AUMbXCgi^&wa{{MmGŔwS:U<^8 vNc9*_tdWG=fo'ILCGP%o)-؛kgwTO_@GЍL.#sf5VuW)JW$z3u4ԏ:Zl}WQ>Sh⢣DV)&aAbႱ}7{keԕtB APЮB5`[DkiQN "xV:V)Yr<J;} y}ү9]M/U;>xӥ'ojZ6B44m䖿e~~_p(k_WXoj7gѿkCzrE WRJJC8ʾ_8x$)PQp?s_|i'~nž{lBPpfkX@5:WNfWzQX1E-?8?}=ӡ<lX qs {^?z#iu}oM<<ʅҺѤKlՏ9ڥ%5'aUCʉ qd~4<>7F:ϏBnqO=L$\xTMuGQ|]CZzs( L .M6UWQ #N2?zr=jWp,IЏ׸[GɍJ'%Vm.6 An-oj~R/ NG-P.I TYH 2)1TV-:3RNA}0.4=rJ-B"ޛؑ Xd*:Ezm,ڿ ܱ }=l,ç"EEצZƩ~֚6 ҖR}}qӚ2ȴC!2 ՆG=z@N#XSN#چ$`HE~A>!]TvG!  vP9jX7QȞ܍*]7A=Dž _>y`5NZy) {.8o,F%sn&??NRձH+)8# anOyְ|Pjx*TfWȚRA?nG)k7R;A9W@eM{%7U,2OXH"C dRo\Ft!~C/j)nIM;+M HT( _m}{pn JqSC,1y4@ <zy o$eΥ&{YvID$V*WՎ ,oܕH2έUE; E[Ʊ4:JOp~˹87ǮG[+_0@K &2=27s{L#o|]t]wwGH"9YXUU ,"=:P>׽ )iMbUf]CSy *5͎@?-gOuN<4VcϲR$ӕuHT ^YGʝBdDz1S'; ۟X'#MO*jdj աMf]WMjty#(?S{ۙ|n*1O?fZqYuOÎ4]YHxԲÍ E#;M+Kq`yxc;s*2;zI+C>(KbF/1W֨è+:q]ͳijVtaSCwLQ?y|d{2~=,WV%Yb oeuc/Ӝ\I$3sC_Op-AV|}WK*$F580c0}D^͏:; :8h1w:*ܽW|M$ ݘܼ" uAOy5em{dUnE eAԀJ|5 ]X9M\;iZ_[R!>n:]obϲ,Q-L2})fmr ` | Y&$62IQ!/,r?@~OB̺OoQi|SkԴ1d)*r>E4 Xe 龠7># ??ue]jA"^ٮ}S>6wjiw^dUՊܛ#;j#}ӖȪjQ)sw/]l3Z6Cqzs ĭ%<M8pG@â]^Ђa"!`3os>W8dfD3nם ^K4XٽPm &k1MRxLB$Hxy5GVrװ̯1Х [PBN#PND RAd :G|Z<~=t_}s旰+mTϸFyTf[PVRQ-{6FECL%fyb_6v.++144KSUY TOJ7u)%A[5φ\8"(?F:+@l_X H*34PJC9@fẌpP$ݘ ̋B1a{,̙J4ҋoG:o{uh.\[X}oj5TmnꗸdDў9k׽9A'Wp,@Pyu|Dcoɸ6Sk?t]MC׽ρ.@W^s`_nI/(}:h\Hqsb@_Zwqǯ{p1nOMOzqf ԦzJ7 K?M=]tI5E1׽Uֽ}pJmifFr.Hkc@oB,)G;?uM+?^6)sjOE,?ůWҶu^Y{߽u~׽ߺ^~{}fRAK=uuuD4t5552U@'ߙ 0U$^uFW$ΞŽ6]uvxuC^/eTmgyFZ)cn:yqdJPTʞp߹z,wtUqQ?SsA!HK?Ӣ{% JlVxf+o'֒}Ai@C$`}(qsL݃ 3td(1[Ys%` ',UԆav-ehj(#\p`UJqB exCЍ_fz20nMm\ne7 .VWdaqeqٽXR HQfbG=f̻Urt4nJ I4Վ.J"(A6m{"q8DùcB:J*A8Gk =^ÈwF6zʙ(Yu&P0TT!AclNۛʶ E.7g1 SU;)jXU*䲻ۍ]7eFb+(GI (xצn&G21$Tq4\u>\QjH/=\UuV&=YCRj XԸVRlw =}`h350S(7,OA갭!WRUڮXrIvՄHʩzé{5H[oYb_ %x|=1_+ppCu:i ioHK*8jQ,Y/EQ qc}mS-RkEA\ti厞d+"B eCԆR`H*R A6AMŽijIS@K#,d6pAƿRGp'.,;roC>]I<4I)g:<#T2D$W1B Ro̻{=?\&{QUAGڌd2NJ.>!2D*6*2EJ&VIU2҉S)Ժ6unmžf7$ZS͉z1p>rbAUm-r~[6"-gGo7pŷI*_NsE/Q$m CRơ;,J?2%-G<_uvR#$nULf*5{obЖ7Xn$C=#2s-).<l8}ϲ [ ,1зNožEcn>mExY?4WacDz+R4ɡ@'B{^B:>z/&Fu`0z!u(O^޺^~{߽u~׽ߺ^~{߽u~׽_|+ڀGC̟g?Aݮ]׽'TEi+1vl? ]:mo~`f?4,~:˥8UX{/}9O}:{B0-uRm?OǺHN3> 6 `,OCahI#={t'-o{ cDMCJoWW<: xpI>Iv_mW2"N^}e{?aD?1\Q6r_\w|Ro8+(I4T^Ipy?w6 5VTj垤 Nj+/틃T]Xj֝F \*D?]\oo=Q9?OC:Dм+1jx(WuFVtX́=WTnȍ%!8˅<2NzZ{䝖Y%A4|;UQUCckcslEлfX2]UdI|45ٚ xRɒU\ s\QM5mk: MA :pJ<>Ύ!Ta31 *ж !ΧS!4Gtu(t1$m5G  u|wO Ua+ yV!,Uo#X) 7.7㟹z(ivtm& 8h oZ0׸gXP0g{_`Ǹk/)mK?LXCKRF%@k~3}9Wdnb=؞26L嗂 ) h$?<׆nƂB||Ǯ Qh"he#s'&obF9t OQ:֥Lz>ɶ{|uv^$YVk{jW Ez4AcJ}mkc%x1a(nϯuiӨQf1A4HK#EKW$1G$R$f5+kL6.G{n DYu’J6>JfErKTQc~HK0vB\̧SGO/#i u%V-Z6@R#)%@'5oMQDY|`d)` KiMi[/%GTI%mz߼ZGާx4"N/$mE dӦ(2G5|"::=8zM k!ZQ]G؍I*(vV]ᜭ80.W "9"5+v6; O{2 n+j`<: Z^Ƃ[S]KJ|0",]U"禊CMJh0$ :V,F$o saFE`c@xYmٺ0*jZ\MWi ]4I鞙Ii3qm[nZwL!(DR0 , b8U`ÏF?ui$n#.*847¡IM,iƽ!x4[mL }Oeu%tQSӚzL"ERԞ-Cڟ'znUnݵw&1Fgqo|:ˆ 55]cޞD{IUPȄ%*Ϸo1ϻy;K&W:5Q<^* 2]] X=Wmk嵜+1e"i0rlWm6o=-b0CPJhecM)AnPXYm~Td~/OG$]Aq)<!wO> ",Agk sK4d_$aF@Rg#,h#FMVpnFTPWY`'M {iV!K78Sf)Q#߱ zpKpkq=FIVaSǴ {Xa}w5̌c!9$5J׬om`j|6j8S,CPiy &`Yo=t&AbS}g6Nm}ɝC5uF$(Kh h9K Km{-G=zm<F׎6$X&Tv]LRiE&{ eൌܡ5ey!)I*A=&vnU;6c'ar(6QNJƲ #Ř)G9}qe{{#*Hh]rYKG D_܂RmH >mVOlV[.[\@ xj52M@MYr@$6/}]ml;) i*nT% h(zm<ۊ7&'ϴj(7B}+i髈$)hc{BlƞmI|7򫦆z4ƻSyaLb?H G1J5ŷlZOԗBEDee*Jwp"teri+HH QȤM 1Q~\J=lŸ}H_'S"(TTo=u=>2v1jpR(W+3H5(Pڻ^ +<4QVE:T(4`Afb- dMS .*5Gj wmڿ-OΛ)%x*㕲HZMYI7^G{ 1ڝ*ʐ[K{36WO#˵$s5?Q*Er'Wko|aޣ!O9GMO[WQ]GOKI$TUT1K%dbUCeϷdD?01M=k%[n]GYj|V"J_POki>0mn\٥R8`I #Bx5 Bu,ZG84'H4Vpe14~XVzxL/<=eHìc÷%|d7oEn$L-.1Oyf #HrKb;]Y!۶=S,PI۩h騊PթCUr"nAW, # Jbt/la)Okc3}w`\0K AWT)>?m|Y>F1MOpe# 4L+YVU36u̳+s)ݐWR0T F+prv @ vS<0H3Ya YÍ ejܭ '֦Q udM@ MRŋlnΜK^ʖ J Sh#D r*l;峏m̲͞;R%ji@k{fw6-ԘÔEHޤ!p)!OYU7n'I#pUIUMRQƆY隍%R\տoS{uuo!dpaMoaYbp4*G"ğ-岔I Q<7so*n<7fkjTQ(`A?o:i*R5#9e $ "]AI?]]zi? N.Xm.`Hg/HF?]P?w^{8zޘ鯗~_˯{oe{Cp@Tl#}՜Ӟ,K6`n-2GU{У&ߑV*(?{%@o W{qPnll6}UHzn(k{UrM(ce6/mc8:͓6 _]eb@eF}b/ 0.M('?][xҙ?ꫪAj|SUMLQb[YqGeq*(d˒61/l{$H@ 4iS4ztR UC!UIrbM٧>19zjU$_vs;O{c*1յY6ɖzb3p,J/Փs#@ PZ1<*@8.{(&aiO\c>V W2]Ode- ՑнDx+u?R"DL honmg{xmzLRi䬥VT4c>]=E5&0+?'Z*(ѰP^X~cB}wGM+ O<ΧH?Gc!0a463(ao\䨩 yHX\e |Ff_D5:{[WUT̤E4I"b5D>Hodh1M:{u|UHIc^ D]hJ]Q@WSH^3a A?gXYJ-+lB D~aIѤEGMgv`ЫqՏj:`!'Hbhjv i`8lK QdczS+{؅k)#OHF*hxP..y׋x?P:C(X} \?hd殦(%O;Y"[o`u }?<6`?j]Z5z4?~}vsx^qXJ*jږUhijk0;T)<v +9!;]qg*ʺI ~Gto!_Uu50G*g[ځn7MlJoJ+\ <ںc# 9|}3aYc[L304?f o?w8Uiuڋjo\ux5)JwV50 [Go>I2HHoU:$*e!61Un\m钌RLp^9}ډ܃{EȭSҩTKk b4ԛa&&V>2*,O]2;CZ>}=A|Rb4j?C:j sȚԮKJǂ>{WhP\Udx&FV֖7OxTǿ{V+8NPQ- MmM??}b)0@Ԟ$uSj+οoTC˩Rr5-Yzj(B(xeEQ&E@kJW_>5W\l87$?ڿ3-ǎ䩖hV/GB,Q%WՍ x}GKO.@U}UuC}G~'%|uW)M]ι7UjZn-m_#UY=MA*le+jZ~chSOFB\L8 tUV" PTLKq<[8[ifQ$㩏G)UVX\?^2٪Z.xhTixTtي'@_-5h}ZM5=Cig ǟ*uwռ!2jvP*f7<[ޑw?>]_q={؇ГWgS)uTԹOYc6ONH$m&:z M-}3f+jc3m?[ai>vR6eu\5+~agr9BT,C1>&#M _5X#UO\T֋̇w6vJWvUWclr;7+z׵iQaFR|O1PRG-Ax`rvM`u ׻c(9ZVQO'@Krh-[Z1762OKPzWUR3luÞ|Խ͜cvcl*CPqRFUa7[1G;Im5>@cݏA<0X:6d?W9׽׽˚>n}=Uj?3 ݞSmzq$m ۝&䟣ReyQ~8'M~?>]{ ^W0t}b:"{q@O\{*s64>|quZÃoNWI:'6wPBztSC׽XÎ׊4={[f:2ycŃG, 7;3TOр>wW-LI6齨.{}ZtOJz{yi*~׽ߺ^~{}{QOY=6|OTl,OO6{/!VFƪF@]{="ڥuY> WxT%=7LYW|RH$ܤr#G#)h+c{)nݡnjy*wMk$͵U[q*1c饌x?)A$Xq6+MosiHGl"oJH- ̀=e pqǎW4K]"G<{G-e6?c|TUq{7,c7Y]pp)2ت5E\]V kD**Bj$r"#E}nPnAyvΪħ%<'9 1ZmrT`0ѫM=}lVZqb& jH*俌`V1bXVU埱멺\.w >o_ݕQ=EdYn:9Y=~c,&&9,v$T"h(_ z[lMFOdkkM55BF*zꚊLj\8·꾪0؈:wﺝj1Fʗ8}'Q:dTOvexPfNڢ!?-´^Ǐ$5BŅkQ\q}EOYZC>ԏU%:8LbIhZK=x,N)vEf~۹*yo'j4H< S̤"d5ZQ4n)Pj H5=.֌Y`'⧠?@vo|٘wܙ^-ik5GIG[hmZ̳3YiQPⰵ,꬞*fu+p{HM uZ*Hd|UuRoR S}u#O%{?u,RQ>>7(ecO-L[Ꮸmwebzjndr6'nm{qdidA/.Govӯ{u׺{^{{u׺{^̯Ï*ĥ[[w:d}[ne3/t׽WNktc{nMGXi,_x3SQeCH\=w?f>勒o~ "ϾOE3#m 9IL}sU16N/:_R׺jZu H67__EjO^>_Ѕ:?@_{ڟ\unh,,m&h:^5pb>@tb{[aM;׷}!}P}ht;9YsԽCEoܛW=xfg7T͟{d{~ڰp QWxZY+{w+e,.^fHFT45TXv-Y:?uˏϮ.Q}UY<:3vڸFnb-Di|x*J^5k#<I>wd\;$ ӹXe+PljSxuծXx`ڠe[fUR?L8Mb]J)^D#'튼/i!yyvwyCALCd(!S<UN AJtl*\n:Q}14ѩᎎ*)!ړK+K;ٷ)۶w#rKQ%$\3JU=Z:MM*|FI..'AQe&u:Z S-vC->Ñhi[ 6 X,vΟ/Ip{Pd(]S4RǓuP,ńd/.lv޴YcPǚ8˽h[?oUeE+SZ౲He3SE;ʑ%KxwnV/S53\ȒeaaqՃll#yFd.]tEF\z2"pSVͻwbl*ֿ3[}C:ED[rd鑭b_C]LHιwtmm}۸:ܔ&?#vΦ(iSֺ<kz;]oج<^,P)IK wI'AmwpC,\GKF]%u7ȅ"dv>RW7PɌu;yYb\m|ᦠHE{qd*>тNܸ[%@w %ۏ~wT^]&!e">c˗6-X[;*oc⬌a @TV$Syob/x"E-t  -\Lܕ.09lF71>>L>gCCFcRIV܊URWL}:MY H ϲRwQV"b)EjVW/Ly$( {a TkZS;G:*pPcv3ؕXոL]>=}uD%$JϧچVۊhhk2}عSbr5KS!ڑ΄$٘zr1w '#K+jqq QaY(Z \ mb4.!t|轭w[3Ytɴ7%~맭mY/M"ZƧs/;;9*gA-6q[{pțPbwuiдK9(|Szـ;$n{p)iKLJRU؈ӟ <{2ƍ,a%+Zz$hGGemLHc'mמGL=DpG$@$X0Ȼ.ͷ3ۘoHoEAFC;0`CVA?555<WX SIn*AX:޿aDZ7n5{1MLxU:SJIG7M* >u5[K`nLUUOK7j 0T5)+*+hbQCsʶP.."C+޲\.:-noې[HC!VT}?+BhHP|ܘݏ,xMC\q[9aUJ_ak)%zhŏI$XRD(',)v'sW/3܋3U5&<#jŪiܴ{pyRG"aE!<4bhN^;nSٝD\i&751ՐDaXccG}w l&Go֣R [[EW5UNdžNJM LX ߸=]nmh.ՏuvTR#@k92fktg]"U\gG@kJSUZB kU,[ȯ$t-iD̊]XX5ܫĮ{uVnED/BxI*p[j:EW)_#7- &su,kt$VY eT44m[˖"aÜ@‹U+Zuz̚MGA Jhr-‰%>8G$(@efXHCtSfT9\wnvn#vlN۬ju|XI[^FJ:C(6*0{ﻬY;E,nfE2q] yӡVNhЀ]ڵHƠMv89Lͦxcs݈rJihB3*e.XIڛwnO;֏pQRTn};dvgccQ5VjWe6W It6= h6,4)$ ti$P2")#$#Ƅ8_ $#)3QĘǺ붛ymo ff޸mGGMJs2K+ic*G[]%^#n}SbV/@ZvNٴ%g|zlё+JǁZ @aQ#AHmmڽKPwOωLc%]hȆhS؏pw#&Q,>iYUݙZQG%V[M` edI}b/וyۻ㬿MeW)`jS~ڎ=nY„?xL'F-Xёe2rQR4iYjI+(T^r0$֫ +c sZ+@jka62Yr!a5cKiS@3U8'>Aћ:/C7D]2R1u{pl;"d0/&6P bs)Ww^Ffk6ɾ^,Ev_⨤|]$2Rh$ vmA\KͪXĕPp]uҨmi(ǏKӭcF34|&ۨPI&vz=ψlEJm\I2šRϭ)r[b]_Y]Sᢠ ,G(8' 7qj)Zi,H:p9RDƩTuXPjnPMq>Sq8 &?;r՘ *UTu;S/42l/5t#!Y銽5MI\OGEw8˭CFͩJ˗iH+$j(U{Nc4TPIՑ]fSR2\ˮ[3 MH*+QTJE 䌮_>lTZ}sokc%NX3IQQR&Mxbur׺ϷYA3LcHI $mZ@I'IwG*aoSU8/vI4w]u r5{Cxˋ2(TĦ3kZX:xl;m|_ox ׽ޝ2[掞SPgRRF`[^]䝎.zeάDA+UpR  SB/*@T e ySA}lS^5PpO[[}WWןеltwLV{]_r}dj7!?!׽գon)^5#N;ӯդjXvq-FJX VRWjIOZ7+ y]sEh=Z)f5G@hz)^$և>3>NU&O aX1DjM >%`gz@qC$@vjyn5z6Y^v$]H$.QO }q+T]dtmLeMlp>jc,Ze-% dqDZ=a6ZF!)"HYQ ~.-dZ*GjG8WMkm*p5lD-EYM%+/&/J!/}۳wXg6-R{tPdqT\'ےAPb 4-34s_ax-ojv&$Vj%x^^g*A~umSj mUUT1i$ Qz6$h<Y bLZ/F!T8jV6hL#\F8uOJV5oV&Ɖm䙤emĚϧ R|jTzISw>3φ,BZ)yXR1T~[-@uVڙE|MNy렒S]H#K"HaS"88~`/U{O*A5iJSstJ.".|ZZXKJjj?f$W=$\ b~D)׻хܘ[&2'L>E5UmuLB5h֎6E5co JS δ=Yx4=(a4ю?J3T BB8>}='1]Âc zzLjtxc&̧RFkRRF kAcF[S+xIJ:ijG1A "^cR#U珡EƤMQ3U;lc:ޢN1X(},7XYz߽*[WYD3  :#raotvR{1R"@\i}~^:S{q,,/Ǧ^ur>6T-J51-{[GnOg^$(~> _7U{u+$v+~dr֚9Z%I$#GڙfX r}'>!m,L]~]g5]!>Z_j稍 Uu5b_YSpWQk4@ژ|]sh b?~Er=GK U4qIfIi6astF5yn#ǗXRP' GG bPʲʾۛd Se1HC#rqMG~p?~ֽOׅKhC8U@Di:]*t7ՖTM@KO\RLtpb.}o!V|E_/rR"T, =R2?R>ֿ H!Ki2H׆?=ZbAubͮ9S<\_Q6'um#IxhJ]X7$ZU鵉cxWNnr">=ު)u=+0XIB?X?J/ 0Xtr.$t[!'B8S=[2s%=6 S+K'՞SK y$>g\hڵEu-*VAOhCy!W:ϮB̦Ը6_bF|zUG+ JkFT s422JUu jydf po,|CF{ O^fehS`pZz/}KsgGӟfwb4Ԭl5e3k[oh ?twe'Og,SDABY=&-'-~Ϥ=ŕln,?&(Ҏ Efcb.=7HWDSSWG? J<Ϩ7gTlUM6㦤|Fχ1 Ma0WӤ W?Md_~tf۹h Gn/Ț$D!f$'"ߏx9wD"훹TqJF*Aǯ "t1AɩM*+χZe?:ݫ8O'|u\as*JFJyɷ%gBnL?fmw 㓤IїbjRr^ ̮ }s\"*hH& M&T1XXn3 P_ˣWZ_/4=7\n0ghIf+w>.LUUKo K\T̯a&jFa<<./P-nLۛK~6䰉 2SuY"BG̎^apNVI4`yw*n Q|[l5ѵa8 BZbˣKi"?:OGWInAti29٩5 bZGoCS,aC,zK*qpScD@3*jH:yk}?Qu,1g¾v#AM8tM%Dl]ȍ?Bc׽K;rb&I#l.]*j,ԸY-eBHdrI[o[ւHq[? hZ8Yi 7j}GW%g3Y:#ak)%Z%Y yބN<_gKڻLY˛ E,%)%Ah(0% 1y>0Y{vT9Ol6/&yT󻦲4LN,Hco3ܩUGVIFX㯙.$1.^;6SÈ6~mVT T$xiM1]r InM^a7fJ39/㧖l 2F8!H³Eq"%- cS +_1%i<:"݄V(sBNiע}fziqJ<,Q4MAZiFA RaRRwMυwdOmRI [2Y$RZwQ =E;ِ0UcQHZF֕qEdƺ$ GnQnUTh2/-V-oې~ϲ W_[br4դɳOZ"Z>߳N-qncѪ- Ҕ*Stm%̿c=.3RpI+*ak;I4%XĖ[ʢ?UZힹ<&}˷&Lb-**1golgDhET^5%I4P9"-F$0NP s۷%N0 <WFSS,@QGח1[gD+ӪQO y)yssu"=^ԩ>dgarPPM#,)n*CC:nrG"g`蝗ST~5Tl=mlx1[\8m(q=%>&%Tt6d{'+u('OomNjyR/}5?MWt]4x=ms3*&x=\#sƛo76# #7M (:/}. A{D_T^&*W<}@P\7}ݜ;:^8 ?K]#Sup)׽~Q #[]~]o{9>66=#4;O'+/ĽHXYBuvUlxHmx%z(1l?oSiN(毚}ӈZZ*X T V xK8{_}{ӳ7&dve` #  [bFeKWj U}GKS F R}}&C)s;waŖrf*-y089:E Ƣ`Jc>=o;Fi3D:$):)`5iz~Fk&IUe XԡJvݰ)((k7bc-CS~xX*' !y_ɮV.[LjLCloTZݓKw>ShK]j)dl]jo١eVS1]lV1D;Ͽ\ǽ.]-.n5W6}4i3ad@3Ԕ  Ԗ%grʠ|:Ej8t1;>>f;lQܻNlWgq8Xj$jU7q(+ GڞŐUdt݁Jl'@ʠ}:O?wy7p?֖E 6+M] biSkR4]J#-h~%\Tbzp[ۻDcٝOgعJ׽7dEmm=>Q' Q-TA*QnQ59IFrA4m zHj144lIlըYwk[ؽhM(HNٵowDB!I4jZA*t[H:Uf&rE4~Gg=F/l7Ҭ*KC V;*1eZ r Ņvcub؝'rmiz6|G%EM6 $Y\ЈЅNL%m2][ 39 hUX: Co[Hw Xa!IuKZ4{NnI\d7vOkcE4;9Q* :ZYaU SIy*1Hqnhq]08gW d,9*騛 T9@×=-khN,TkvhʨRQJ}@VZֽ&v'ZYFYcd^ҧ+N{ڝi?_S|\9 LfnGܑ䳕5SQcꞦ/RC,~ 4[+3RoܵZ.[4 PEũR|AQvѣLw~y-l0mV)dGi VÍSX X ] '&Xd< dPr TM;r R8躽SdG{go*Lr Tu{k Li,,j2])U`j i2poGIM7#1 5*N&:H}@Oe>~ Znyq>46RhU*I2鍴50jmbhZ `^-"O0ҕpA5VMֻo%:ڋh(OvÍښJڼҶF%c- Зf>=>WF~CSb0쒷~v<x)(iq;Hؘ#Ji?C +"X9dvWܽ-=Vk$Gw( +RIEiʛTP`%W'UZE S='$asgˋh'r#Ե㰛sh+S["xŧsyn[Mym֒vuG0C F`ȡКٶ7/HB2j Z( i'(iw#M_gnG0{%~KeI>Cr;")*:VӖ@a+C Cs]AU;݉_nn& r&E]ܹǸ>Ƚ۶nm<-QQ*ǽ܄@QЎך7;WF0RM|:iA~KEN+Rc5Dy;8hdU-v~z*z5LҢI/DtJ񣼨kZC3Y;BϹzQM,E%h*BDlFˉo^VM.c2*$ȚUmN92Gn $gؾc%PV?BHDc j+k:1tx]ܤa545{AIrrLj#Ğ`ěYgۏolr69ۖcӕ#x;H\3{\,[qt\kyo^"(E:чPP:,~khԺ#HɢIPB UA`ݏUэRrΊbr}xd\|({j ~S)Rrw $hDUȅaUJ^jXWwJS%DF$;V"% =V .6Ռى.Cn{HՐD֠4D{nש{US%2euԵP `Ou[35\5Ev? 6jFIgSHKQ65F A .y| _g-b:i1~WS4UR5#;> Y|loXoXEvHL5)d׫490rX$U45j]5=_o%ӿB ]uREN^}p0A A+Âi+wxH<>{LO\2Un]jNc7dP\l&Z㞞kF5%<(![u}+ {9e[xRi˷ -8 l]2i+[te0mNM;# N+^)}Wah +ދ;Uࢋ'%N k4DLFW?72[o#[D8y2T08T*i GZ2Sgh2K`\Oaל}s^L.@7| Xѻ5\AeF'Sx@kN=O M&t-+x CS][T%>)gED09ta+ kt^T{'bK}mD F*ɡEꪡy}Is?$]\nŮ4]ކ_=O1Y |36( tq}s9ʆ0b?pƝKyc%hVE?aɲ3jvBk3-= zftk c=]ԕ9GJir6`G"︮9>VaNur?[nuzlv~Ǻ #jDLPi ][IQB#;1Z@ cPMY[Ju-.V ][9]r8)/ T9\rOMK",sѨ.@:=ֲ0, gIhTSW#T-]Czz6cm^tIX 1[\OCS;OD<$VDQUV6c 2dkhp4^RqF wqA 2t$($a$5MqEc21j@@=z3Eߔ;&e 6j\տ\4BF""v1[$20mCb[rMh7CC5`%E{Ac0c6ؙSѻoM9=*76_0YE((`Wu}4oO9ʹ3)16gOjᦪ*i+%E$CNP zcsUE'kvy<[d+7lwC:VIDyO"DRasv-v 7;B\@QB>+C\F9Oo[¢3+fSi#߆O m͹hcAQ5=bFBUl(Faa܋xȉGYzԮٕG*wҐluHcECmywn6{o7%F%e-K0G~i>,ԘTd< N(x*ln˺ruS] u;k'^%̒P*e,"/f~il)tj]1 ?$ @cWQzyJxh*Zy^K{*ѓVOֺBUٖ#(MA5OpvWnh ªV`I48[fo*Tm Cqu9,ja*b4TJPƩ*k׽hUb~M8?i^Uj{n,9 h2:zu}vS",-<Juq=< }ӃdǯS{ȡor}8ɡ׺ܞ@_>׽ib8?N?׿T7U%~׽YH6~4zm@g{mw꽯ů{Nתھ_ο9xN9>ܸLQQU(x̾o둳3f9xf4Q,["9gnW߸vRy*(MkU#xuO[v^|(wWU*vluJ?ĮtΨ@!볶~;?=Yʨ`fU̵hNb UZEroq;9~(gU1jm@Rqk\Ntip[ &zJSmx0/&}\mk,ܽoָV]a(鿃ϒsmLrT\QrI,f^NUu}d[JUi Tms\==\5ҤmKU"K$tJDr#Z[^=F#OUA +coqe)H%FFBvnn;,{r:i(Ajz}e]zہcb /K9@iw!qTKM\M۾\_>6)*Z3?ۄ hѥ7;s"FhAPPBG5mLP徢]W|1ֿ*tIj+7en˗҂㪥EXGnd5>ӛsm{w^H|/5FZ5}G:I=l.-Zq&54A}iyo!Ws@|{e83 UIK4fEJP**UB4bke{sy-]. :z}^閝Z(LӬ|f[~Nkv6BR %fvzj(rM2E>A]Qa6d倊# Z Z]XJPbT}CTPI̮ڦUY%Me .= vȅX3GGN=  >($tj|uec]khjUt44JGDeԎ8'=C2d־EQ y:O4n RNJJE8,0b5CR=i랗*G8 .oIVPnh:l.\}('-;UGCpLG>}trOFfdU8$ؚ9u-&:O dV-˪M}K7pO>_pniIN h BGFuӵ2iq?\uۘR<{ʴz(DIpk, v5U =yg6{{BJy?tҍN{ߛX{zM^1-kd>k ZX!b4uz.׽}U$ػFF -VZ$䆧;l¼wK{}N14]Fb¦[,n\hxCp?'wFN_5//q׽Ӗ٩yT^:fgm/0J/վ_-:|\ցy `S{[mE-KđqY;<n>]+DCGgXe39Gݏ+1<&d+DjZO$U~P?Ok{bIod$\g?1zU {oo-ǷKϦfJj@QXX!>lDRj/}:#2k6mܸMɬcHc k,yC omBTW[ %p} m˙!iu0V+mLx ^%wP+}:M䨤tIH(j9`mKrGu>K[{?zI2(pGʞ1׽[=ݵiRh"ԩzx2 ئ,t_04 ()?F>֢Z ?vbNs~e n !E9Fiڣxj_TT~0Ln:8ө Gk20djk}k䑣lb,Tv]^tHl!p *,,9O1J2l%2*,A=h@_/N,t:P'ZhC x'Xk8sTQ1_#\^=wDRIuԴb|šax{A~_Ÿ=y+Wxz|}ltN^5h$X3FJ>^ ʽ{ڳkTꪝregQ"2?[loBNx'9'Wb%MNH{J"h.@%~١I_?WOYx׏LF,\#%PoݻsU$'z&b$@Ԅd3 WtܭF%3_zyQUԀ?{q]$y%j 0e]h[@7<ڋ;dJ- u?^JWmd_l{!M}݁)Iѕ%e_[˸Dc?5܅?NE暴d6'<"1<0jvkǶGV\11/jWIEoF:jXp/1]$VR}5qU昦\VW~Qڛ =պ6i%Tqp+Fg ՚Ln`OV?>˼6,fXeҪ[P8$q_xlj?瞵g/PFؿ57^Rt޿ؙ<δc 㪌6+,TB1幺Quu;3TǷi:h)VQvWZ_Tr!{sEb Habj`D6A$Jggz?_ld;o 6ef:3 F媡{G1Nuf,3QSJPCzS(!*,G`A=jA]K$Ʈo+u'1䴵ԕfPI8F}Գ;z38 G &sƈTA-DQ , ]&`_Q]2=uW[" gt˔l}cacI[%Y>K<{|`ä= Omٻ UV SjЌZ j&) v]7sf3ZwKK²!2Վ4hPiѽ/(A|q?í>[?]G9^Tvo___V$zz C[Z+j P'mS] _O(e'l8E^5d5׽ _t_;NXrEl-G}Eӯk^RO$:V+>8OLy@}.,G{˭\.?WߑSC0&}̩;Z'~];u\_I5o~:wj9QuK+kҏmJs׽z{^{{''߉=mUIg]ԻkuRa75FJ̮u Ϳ}((.0U28*Gp߆ xBG_ϥ}?f:&H.Dt/ˤ<5q.2:%]<#őzLזG,\"{ {g+휛m]36٧OKO@Tc*k2:zy- +2IrHBTKa%/Y.V9o&Du#L6{xfY ȆQT|Wc>>1q@ch5 IN-O]67?y6J\>k/>:)MX"UxQfyXgsZA4JjEIZ`;sFV6F@!}iw}}bL~vQN`g,²F]΢M}͹{1vGqMA6jIqorI][?sT=GP"kf EXew³ (kE5W nXT]P OE)?\`K|fh䣒 veҲ:*zm 5㭜)u婕 с6[#IyuX$SB~X*IT.F5We<0GFZЁљxi e}U6xJPTB0B u6-zjl>0U-GKS.'D2\&bʲhפJZTXwq~VVD0韇P׉Rz xuj%+zdwFWSfj$;wU{+GfxY)Qʛ6Z>oO`nG.qy;}8>nyDTZu %X+),;rrQ;ZsN#wQ_6KV,;FIWtgopA;3)K MmAjx(Wi @@ s=?Zt7^I5Y- ]d[|۾ct9&.3!R#pޮ* :5PF1@xTt\#0u/ìeq5- 4zZʂXꖔ=.&g{k2J@I$6ly׻:y E4f[C槈1D[ϯw;ݎyiZ QCWxCb8fx}3Q |N*߸U7YधJ'8 ]M`l>K6nn,5,fl[RYiDfofQf I>7m[u-خXN|jW>Yv t LP6Zl}d$t2Q+MUFƯҌĭO'#s6n]h(>sR7MDeq ݩZ%z+F8og[w1XQ2US'I5ƺwNX.HQ"j{e-ՊUdڵsxUAqSCI#AR2tۿ 18 Lx~G&}q8@TQ!_PfGa\p j(>OG[;^=U_"=+ѧ|I=Dp*ku7Iِ:)){ K<*)adjTO3gPHE56t7669]NT=ҠIbgQ׵\ci?TϩTIAJSDzHqr8ůih箮X+'RҲLH56#ϟ9r+m\ FOz] &ch{AAស *ivTF'H2p o`wӉ\L5O*UQɠ.鷽):gCm'A7T[+ucn MG4ǫـMm ¬I_,eFwnԭ{ UŽ<:J u}{U{{u|86Svz't<JJ>:jI}Fӻwo8K&Ko\\M0,~*ϰJB>E5(OX'^j`/~n<5'G{ ִ_'b_O^SI-^NCkyuucHI/M$\xZee7eei ׽%?ffq޿/:̯_{7V^@~Zc=T[ QHgTl)ez~sGZmLզ`qƃWXb_q6Jdk.:D[YwNې.ݛӵp_ާVn6^&oR5nE4~ePb-xynjO1X|-%BjAU,Tu<'( AX<nƍ3!2Ĵ^)Jp,A=⫙i],MX(t"D+pvӪ;nmW[Ի92޹A*v +GMo1>?Q/N3gM'qcq[Z 6apI8mfC1$tع_tG:LZ?24sȵ7ZfP(qNb*~d@Z0Si-\T|QÁ莹So.g ;giEl8|-2ih<"jѰ"jo̲jDזuSbivUn8NJMLF4)l忺xvqP1\\ ć_ʙRH+QNuYO(Gq}zdFgsX'"i8|J6kj2fpT 67/1KO>U]˱KE\W۲fH0;Ʒ tXo㸊\*i1^'WUT8rSo<)G,pIO v& 1>{ )}s,v$Uʶk"jj1Ԋ Oighl/t+0s憩Pc-b]-i$`-=͟ۿݕ=ɝVFИQ}]]4!LZY}jLZt{w_þٴ6b!dOYRrA QCk:$dr8! |UH ^ q K!P TIY1t0Z.R[<"af<ۍKs4ش&K,`$sE(ᾃ7s5e責sZRFW3sV)=\+?r@應3лWn}W%$0Գш;G 27"ij"L:n>SlᨡLI &j#wmL\y|n[쨧s#D7 .@),iln~$)%m"D4JH(izOy]Cf.lj%%$$EMA".ehpYg*&ԕ\0lX*?j@ o$ƥ :ųWVC-m);n;1↰U6vd#"*ڙeBr{w̑K_s4Ei1gDguN" Bc;_^nw!.W[sJiXԊi_<.z-^ɚSJbuޛ|Oz} S=\. ,!P,Lb/Swu|nW}[snI`$_qg=m{3>V '\l.٥ډe*K#5+{AV>3M69]Օ(YoᘚHHȌ-t3*>v͗{.8k>E4P7éCB:4eK~;FB)D%]TZh1^Ů-)\0?(!urMprXN}}*JTJe 4ץ-Z9Uo͖ң~鿖HEHIe!’\QE I+9B,@A 5ZTs^>l=f_s`c9Ôhda1 ZPP#e7uu׸ng6gvl`ܘݭ2bwO`cs4Aho:6,/ns]mr4Iqm-HU-8؝,:9ݯ7feWhèqi=/CVb屻/b{Kg c3zŔ%hmTի&GjƣkS.$}:}TaeEdRd3bY,uq7ۏXYXc]7;k͜*`ۂKj-m45+T7"_\6%$lvӧ xԒ+多iv,Pvsf,v{sb8Նߔ4gI-DN4S,ܠ͇[U/po =>7`J0sC'3"܏-6K$/X?DkiyuKAxAB߁_Sr|nGf %C8" 4^p$ۋl/[v=;sޮ8ʙ:_|&3-XwhՐsLLeR/h Pf()حⲆ.um ϾyY!0ԏZf1ҪeqC㸤[HR" w[M5RSYn,oc{RJ񘂰(ziCn&t'A۸:Ts+Sջ,WUŶV),C^Ej?g=V+_/]Gބ6Q=n/ 3h^96/柽G^'+o IK%_ QԯrIXp-^$S*RG u?!qSEG/>,W4Cw:Ѵ̑Ǘ|RG,,4-V6 /anݒfF+p333hvڤV#sQeWH #YST(g77qoDE*Xપ:iP])#72v .`hOmMIh!"B#h2zķ6@(# rN@U)H~uLs"d_ݶm̦#J԰ԙ(r DlE~mS͘M۸6XukUTejdF駥uEl6yBscH,:UHQQP*t> F1"w4HXiPxoxlbs&%|j*mTU6U,|q0l>}Y7,6/nP0R5ުeФԕ ଚlm/LCڢ&BAV[opVnݿ7^> ̀jt|t)JYcQQ[Xu}6bZtE [N*,4ymR|&q&;W\ta^4v$?}䞥f _JQ{CkDTQ.|5e<?w%椊(U}Z*摼frG܆-m-m喫!ƤԤ8+a,h}1/е>ଂme.]~|r,W3O4!V|j!Ga˷yZ3u9 Hj#N@eY`1of[?3kS_ [ҖC<+CQV[I>]M%cvMzΈB4zBIGXVU7/ogusn$;h}&}ȡ?8ygw9jq;NZkf!cgS_䨒":e5Aht&BmLykn mθ>'+cT cX$I 4TV)<{lLHTiaΘ^#qN9mfzik~>΢!c#S[SCMruVWlM4UTGMvM0ȎE*?[]h( W!crkMB'ק!sI'ktإb:)Q$*XږJXbSVSյ*HSX }w;}IP.ԐKPj5Pq`~ޅ5P"&$p Xafc~?OiMQ*MOT݄kY1r,5{c;LR)>3=2n}Wx_/ Am [?tkG|zA='?.-4Juo'rͭ{:tG{X{OxlO^=-q{O6[Îzѭ*Du@=0ˠbWU-C>xQn}yG }!$'BIhEc)1uwqpe:W2HﴭM?vІ 7LOO$CQRKxBUOn q)*߇ڱ_g]­eZ QiNM?ӟf?g{S5G%UbZhUf '-fLg6O|L I? Xݴ{/{!AW1gaK>%5(帹$q  _[V>zzqMD/C$Mw4ZY4Fkv㷂H>2_WBѓɩ/jz15C6x,Z~GQnZ4Ӭ!E?N` \[<8"Շt ^~G5~h?_gT!xyz:uJJ$Zu\1"DBTÂҼ> IE5uI$ & /lxZ> }\jPS|'ĹV wI,?{ط6:V;Id= V*ʷR@sn>ͣkm|J]QZyuZ齁\0=صLőVJC_Fէ.-1]΃_RT5n#K_Raٹ&9s>=DDF bsrm 7:yb8/Iݥl=pe5t(1aRJ,evponAu< Q׼i#Zz_CSUU%tcұԁWQ͇4Iϯ{̱kjE&H*jg!M؝qZQAٻ#O0iBKD~2ia{b.7fU߷+h |iek@Hh:!Q%g_;M0شyJ<~Mo(!+d0cE,}1pxfQm}7_W[_S ,\E<4GB }짺F⺭%pVjÀi VA_]jІ\_*kvvf~ػ6T8X7/=Lp,CU5 Sj*C*ʧ]CzszOZܪڛӨ7m$uaXaJҳYSL`9Qa"P[>som &CFÁA) {yhc"gʵ)N7ػkNee`=炡8 ,)]SE$ƚRXܫ$RlUE<>٬WQBUzhZMAYʹ}v6{0X~ٸ~] ڦ4QR h 8H6O#óWtc)E)ei.VOEE_%:)"_SqylZI+5pVzKp#A|f1QuGkmk=EEd1e#7_&)֣> WJd˱/L|S/65~.h▮E^]o{M{l(ke5 P?E$aBK$}=]RRsb?ğo'D S}}߭u~׽˯v /K@']jn=vKyl_n_'v<_ﮈXj&?:1e^8#{y6u [uT@+ǯ Ow~]{PZĝL8[^$CrTۍ7{ו3)(YH/:j,-&gq[xqn %{?a'VndwOĶofwj_[}?\ZOJz{yg*~׽{ؓs{W Ԧ*Q8#BbG6]mNc#V+/ˡeK=Z(]$$Oo.T*`i6]9o.J9rFژzj*!dilX B T?GYj&hSWAž?oM*K9D 5:6~ᡪ UdT.~WjOqdVM.hv[")pSbiѡTi|Rfh9bȐ1#smFYhuw֤֘k;8i  3imdx<3cs)(0i#aTpă|=dCg鷤ko*qKOI#'YN3S~h#p*u9Rͦ;벆89d +ˢՅ”Ot{wJՒ%uiCmrWsrMݿ^Bc]jCI{N=G{1-N&U GL`& "7o ŵ}sբRa5SӦx./Esv5%VR=+9z#V5G*'X#WjUdkoIZ~Y5;(o/˔c)+( tJa1"/Y]ֽE UR㱻zn}UKKR0E Y8R˦I.6dRw0ej,Ċ֕N[."gUiQ4P3"GG444S+I!y,^Wfw2j]63ټGv%t{^q4⡨IwS?^5Dq¦OAMrդg5MtQ<Ac |ӭ- syjh2ɘTFK>!jO'GuCoRj+bU]FJoh!3"OƃCP=wguCBM(:xJS$g.}*=qu[#۪/m*~ޚbk OhI_ě(f[mj('TT{+Xb3+Lry^ImSM9$*}/q;\⮇:4 Di TƲȆ2#Ealj-m|ՓYCUY`hqBIbB2ksy_%[* ~_9:xiǂ6M.QpO՚eJţ!*{|یi3:uq8 Zdt6.~{XR:unt6NJZ |㆗#W(|UhִZnXn/;۲'|8LQܞ.%=M4#^%n$*~V(Ԅ1Hw[remÒŘH;> IksKvNFq`Vlr)K4=8t\A: @eeU{ 6N v.{=>3= JZ񎭛;d?mXAĺX <%l7[ PF#GJxi,1MubAԹIpyi ==DKJЊz靽jՀk܁5讏ܛ he蚫 ]_gV?rg1&eo:2iYޞ+캉X" ~+^(>?l Z[uQQV܆&UK5DKTcii֯%Gy1~JbF. bqsgz Q4!E[G (AN 'pSǏҗ_d"L3 GAIM'j ]f)^.peSwRg*g4xkVԬ6USԼG!DPJ6.,1EHPVYowF ?$Qw3%>־' 0eQ,ʷALcxQ2I\_,Xhj*|M_YNe(  pO)QVTW ÕjM]Y'#N#I b\mn.[N ףmI UJҰU E RBJk-޽q)rgmTWKj:ʚH!hRB ǎYCLP}#Ǚ7ZE,|Iڡ@ŕ$ ߨp{yF=9sl~Lf[28ʦ`eB $o qos>IuSJӞ!Ǒ>'RpmkRi}Դp{2+}Uq>˕f6Fcem-4굙[O 4~]B{}4l5 W^8J[Ok$N?_sV۩C?{|=^r)Soi %=DW{ou|1|s[PWy[F*|X {)'yLdZc={ܕ[p8  pT;Ҙ,n6?~33 ׽^OnnkՖFs׽x?Q\BaseˉPM+PF2ު6DB3Wi)Ġu*Z_kry<ƾϚ,"h|q1GCbx&x;Z!V4̎Đ?בPG}c͗tvєvh-f4$o4eՈTF G]1.g$xH]R*M{H߇n)ir%ڸ~FVRۭo)ES4]c0w;f`mAWUmL&+j3eus=WmVMZk cn_X#]S3UBM2t=ε?oPzӣ~:gs 5OwcW0HQT8q?R)gݻ:ro^%&=[ςi'L :, }Z{KovE?0YK>?;T8x& JjN/ߚ<ӌO=푒8+r?pWc:".qF. ͢ sE KUzv]xb & k2ՂM 4: ?މٓ"߻o]>slv (ŸeŚ4IH*"?>U0ʘw&ѥb瑂L9&mMw3# ׷r L22khᒧ?{·U)FsEe+-- {i *|@1R5QJz'\beߘ,//7?8"?s9/t=HYy&D`6mGv>÷7\+p58OnU]a+uCLM*BNkk ė+Jm4. F!ʓIɩ$/nxy'^:5$ &׎O\e{ֻwoح{i{rlVngb(L[%JG;Q_d6=winRmuroG7/_TVb15LufGSڢ(@$3b ++ۻMQ`7qҶ Gi*B( ˙#pEdENG [[ީmVan چ\g/FsPA$㉑ <ᴆ??^k1.h޽Rv]rV%ut3ֱ1nY {w:F.Jv[0PG,3 [ ,z3/n16J_jS ==仒C5-[3zU-.`-l{G7z<Gz.!OnVB:oub:p~]-69qgo@^E.m)ܡZ< mxVX^ы T3@GShn$ 3q4:@?ҭ A4}wlQQ_ q9n:1G_Wz/ZB4<ʮ}l:~˂.R~yAU8GWa)jkII# ͥ rl~B2nw:HGTb<7`j qK&,e *  ,IQQFBof}IMٍǼq^ˉiDaO1FJcbvqPmFVRo M]Oq3,~ؤD_e}ضco!Q SDŽ[kF}Y 6{[]t %W=ˤ$cI3g:breXAGݛXLDSUõ#Wک+R5S*V+f,f_nݦÂvKJmUQdHi5%, Q9PDa7wa= An4n! X;/"m_0+-CdҺ5 :PPr4X41Dzr F%55ti4-2Z0?ev^8?ܛ]Tf1eT &0$>mYr7}kڭlU<y4v~Z%*#4*)`:Yc:} ~/NZӕa򸎷I=V{ Q f_'GB~Zi1 t k3YJ-߸6 i-Ef1Ր㪡0:JڑQ TL b=D>Xmvl7*bd mG9rœ\K$#cU`*u @_緅v?_Us0մTgEfJ2%[ɌS l@0Dl˗cVgkt#:hg3j)ybc1fXl+xe𗶰n$ s$vDwg%LM5^PD{x%b}DEAҁ,X>D`TSGsV|jڦKC/u( P_7 DevS`r݁Z-KYTae_mC,(Lb/%ܟ~e4*>54Қj :4\id 4#M5**s^ 8j|>\70}׉|yX|CLmEP>F$X_f#uNá;#/6ܧ9#+)wj̴T2H!gcO`m'cQ$ܬrмbJ֠0`t/oAw{ <@'ֲꐟB5HӮ厚2:vmǕz 3C]^hz7I ۣٝI2sHzMI-^3MrQ'e+97WmwZ LF!H%jy7l:xtvM(ZJ kUx[wow:r`]sتFl٨g9zeARTb)k+/QPKfs\unߨњ44;͹pKU!ΊA VA{w0đA0ưA"0ժW=?i!LsP޽x7nR|ܔ zyptGZ[et*zǎ!WSDbDZ7/H+.޵#7sraei3YWaQEQ ~C CLH"}d}7KDGn&IIV 1/p":_mj1 S@krM犇 |'=Qs2Svc/$ 4AeytGV[>v7eWm p YD۝oXQ *3-5R4CZӠn rne&_6h9]C$9<%h#*}Jԝq* r~|V2Tiu*F"{ovO{F$1"-4\KmGs]*)C*+?e6F Ðeq覠O%G=u=B#=E%ڣ :}GK|-9G3`/??$pʴ}uSߚ`o+ۿ^A+\\~aTg^#={PZk؁'L?gIh{xi׽.>0[2=(f?m>dFzg+Ϳ`Ë>E[{) ~^}O7^)E ܏8U~#׽s ) ۏ>i]'U^ڴi?N^WW6mٱc[gz YM^t.)*@U [řrd,e.Qf=ߖh:u!-jo1nkY:Y2Rzp]%3%=BFn}ޕe/-* ̣QWYOS맒xG8!Sg̉~2PPhち. (8SϏ҃/"3!UUUz)*~)5YJ22!#.U"%;re-hɳr钃5Qnʾ94_U>M<ְ5TX 1ֵ8u}Yc^=IA禣RgcTiE<e?W? iOش%Qwi1 %2nI8Fň<#4sJٮ+n "CT+ŲMrk\(%FGyյy9sclE)ПC2CҬ+ Z߼la] 8v}n |nԘzyy#V=uDOI8GU6;YJcib B=j3WJW/oޛ7lqTyaD#zz:MFZoVa$H&xM /fr J|#hL~7/[Yz(̥1+&Cx[H5i2H zrZSl}<@1lj:od=b F <\ukmDz;p`뫦l$XjI\e1M*\H?M|܉g+qnhezԠF0j8ԝ2ش{C~] [J%TV$U?aN8NQⱸZIYh!̳YLr~>ͤb1R8tӓOJD dr5'Cm2s01bPa`eLI7}~Y}/_^%:%iթo,zꩯ63B8 H7}b?NsPH<-~,='c'Jb~AnT\^đ-Vˤ{b>|1Ӌ׽̍^۟Ԃ/xunM^}M~ۀ:d1{foX ]y$}wU&k>O/0~Yre?/,,2~_E)aZ.!c1rɆ7M`8N8t{i5LM`WDi]-];/mZ5<8Mk^@[>fRhPk6]eu98gʟ9d 0eP 9=]UdKA=`vKUDA$('`,o/LgeFkǁGdEMVH ۦ' -7I " ݀&e#K[W#ۑB?0)B-]hi#s{)j0W᧍Xr=:3FC8s}V }EfXc.V۫_})h@ 5yͥf6Rm_bo%ZX84Ij`2OMQM3iC^Ʒoj^ _aVfF>!fc2s`-؂-ϲՕG+,=2U԰zUǍ/@IѸ$;1/ ,k_>'<{Yu%&6meZ+,)#ԒJAvoo pPݺFjqÀQA'l-[>Ǥ+_-KUCMRVxDV'Q[)e#ytIǀ;3B k}8_hr&3R\G"Dq#qYfsTi\pWY*2uYK6h ^JoNG,h V"ר z)I%=vE.^xϤ`a썙1@2L<G%DjBVZ_"̒/ho-<= U:_]8bA]{چ>0RrF)Sxϊ +}Ρ~-ϻ_NV~tR*箁7_{dXiy5ФRt./~}(Ǝ34,cK?/>+m"O-4:j eQSX1zY<1Ucr EU'b1WI֜z#2yG'de?VGUd4Ԍ8i%VZ/nlT?ʼn-I"|kJjCA1Rj&yQv oAc޹ wַ3A1/qM+ndbpAOy6="Bܻ\%8hkk˩`7[lrW־}j63>]vJzJ;vQRy#eݘ܄Yt MoZY:mpЬs^> Ԫ?<Gi2v3ilqFr0OB2lju/ER|O 3ydSt()Q?umokX,AghcךK{ĝQ[I)nnٜےI[7v'ARo {4ڞdmn~{$2twwm6uog2'w;Yf2%5owI)[-Om&Tτ=<,h8'`M;y55)S_FOYm=5]-PLvh19*p;}$(!0,-CQ3*^H]~ê ;|~3#0cycXL,I4  +IX+k V E( 1`BM-ሯkf'}i#?ly6m[Gjyek閶Ykh⢥ r:Kن_ۻ{~Cn {qa/ QĬ3aGB(TPRP e&˜ t*MOY+)kɌ~cMU9=i~}mU:Cz3؝՝W#9֯S+pvj)д tc"[7F:gN'۹ӇWOJd7?@q o_tE:o{]{߽u{GwXq||uj?p >K?%m8~]Կsv8~[qT#66ϾAPj:!m֘t8m;{E(?^o{ZKMΫy_o[e.2-J6=WzȆ6 n_QyeG^}?!u#x+Y.zɿ'=][u`j|۷;zlj.eqV-zUmJs׽{^b^vt&k?-3[4Դ1F“oőoSXtHYȤv--E:d3PcY&&M{2jFKĂhqsN8P+뢢H7Tʐ@,"8Rx:^z* j= ,ઋ&ˇuT5%HR8k4DRI&(5P^/r @ fϛ12YrQ E<1~5SࣥUWTq50hyBA$1Kܕ#={ʖu[|ܭT -XH$S̴.AdQXax{K ebC,j |Ɛ8򬷖ϧJ"Ԟ?:wNKv]6c"Z摱VLHI?S(WwsKK1 &+-T?o!d%~8, |A}4 ,m- !m-;&I(Ob@59:Ns^21 # rrj: vŋp 󗫡WբSd(ڭikjxXBV8#bUR㪳9=MCZJv* 1YTr(j*'D}jc(ghaan]I 8Ҕ'="LA(c "L|Q=3HecqKHF՛tt IKKH]dІ` dX@C{Xq'q{E{<r555rOa@ךza2>bMZo`M؋a)YϔK)gFHЈ`+tȝFmn۳-LT5*HDr Y>9_py}:Fc^dD$N)LJ˧n],6-+9jxi+[OHRSZ\ƞ79zvӝmmq;|^dHY`S4xoحEqƸ(d{SLC z*dkOqe%ǚIjU2GEN,Z>YM;pG|Qi ]Ybv=U}LtM*(IG䲐-H ;ݣ)=p =?Lr)P@Qd9RgWc)䓈bਮ:eN1J9[bѤ oߐKej]w7^M=BU$MhDfFd-w̽I9MXߴ-UOKAS**ruh&T9:RUXHS!Q+iZ ^MϸZ+N枹]ul>+g_̴va()%k0؊3)e:eh/[_dh-/Hrk*..\"eThUHk9,o6SPR]hj(i iN&9ж X h}znMñNTƀD@,Fd1r15/RVx*&f%#RIn[="V5*3q{ y1~~8'd`T%sbIx *m(sSSk 3$TiXbRFؒQ[% #jc%~F֕Ii7 GnQujҕ`ʰ!VT6;nO}?W8z6V\ M.j2Wcz$eO)fPUl 9,gs*[Y >}-,; }`SSON+jDeK 0QO!m~o>y|VNHvTL݃=AYp'>(7dpuI{/Cr >iJSP< ^pivɥ'B0BTR)i)iS)$GP/Ň=hw^n=G`gn>_w̓5 PLM 41kB;0l[2 1 ^L->߻cU͎]OfpWbbYj XU"3Xj!y4-ѹwsb7C V=+QA: :,YEXD, TbfDy-=M F18RڄDž-er9ǚf/E6J֓O15ue>RII)r!yoUۇ*s7}w=m/ʯpИ({iKG-a"}n xJڅC-?MzdlMӁ?~՞cD4xJxmp؜3 gG BVv~̩2 2+Uk~շcUEAOtOIS=zlHoIW!'H(H>,N^J |]D0dbuno=YF+XWZ{fIE)XbIJ 6>ٸe=lnmejhM<[GJ$pLHcXc8|@2H2!Z}ѽOl$`<*2zG,Aj6%iV x^/ܕ~54jՉZfk{ǭayzjmQڵx抝+>a$ (y$]Xr" nCnセ+w5gfCKً'eAWPkjiYih$: a{>o6)nBNd2irŵ51*. W"y8Y9sm lAw&A\~63Gx+%j$fU15Cj܅7nl>hq8l;# dr/} ~B6Bk$TSCRĖҺ\;[/lS$OqA`jGE9Gav֛sXnUԹz\>OjUIfUpp#Xꎨdr95uN[o=h3y =LT&Egĵ0i9\QܺK{o%9Cl]“^d&$0L[Id 5#[U"XͰX]Svcipk^41^ Y]/la av~[-sX٨3sS Lյ [#m<6w{6鎧jc&]3/WcjPh9ڋ_%ܐHK\Ao6F))$==8e5TSW$iL/*ll;O;MMGa}Y;m3qQn,%<4pZWI`ڻHw9Z{w11sRlmI2>$j\1Ug2.[~_ainomu1/nZN)$h ]-@4dW!ccCܔ?kC4ɾHT6S{'v炇/~aj2_[(hH*j(LiP_j+vsK;~ljvbw%%&5,dlS_-}򽏺xnl3m˦K1+m:#m@jNlfi&hĬΡ !Φj8` m5DSmS{ >gf}tMQG3M6C%Hv5®V! /C=-Grb7X~>υ͟_RD$a@ _q~<Ƕ<.Yo)  >& Htҡ iѕ3r]ήbʩX4={P0zNUj w>muz|d~:38'*4T"%6{o'뷕/^hv3׷\Fijy23 F$A,9f%LId,EL"NEUh]F[R\I- 2I:IAPM3LKV޻uWK[xT_F&VCMAE#O Gs#_leX=Ky{Lӽ>e ~Fj]c) zswVrEFtգDV*ڨYXP P( sԏr VUc4ċ^&te*>R\S1E, AI)!3%i`@R6|ؙ:,e~ kϣGMN>Hms{ ]Abzcui%&fFj zC3# *2#b}Ŏ7YML²q7K K)*5{[b~ d{ ~ޏgcWJIW,6};Cuܝ}IUT sd,Ȕr;s7 +$݄l.!(Ĕ5V•bzM[[%YD(>>'jtS=0=ߖpRbvjm7\}T4hRGW=XU3}v1;|'Fا[/-x\N+qd]}xwd;EV%TI Uc~TQ"n<<7Y}KݼE#YQ5F컟4Xw} yaXaxM{~*5i@۳7U]..SVLQn] c4M-eD35Nx>ѻs5vv d%gtZ7\yŌmMR4r,Lӌm5e66i$H*xqШ F In-,{Q)tMr4(SA_<񝁶gR|4YEsy9}"IE*ALdFl Z[Cûr\Nϒ'Gij.UՔe\$S&ȍ4#.-Iusn:6褫-PRPn"mײ`4+&02ԊOt["quGz qZ9PKֻ$*T*#U$y![\SQ[lzof Ko~aʆ _f- ơg i8q!gU% m^Eqx\]Z9nB))pXwUtж]kwl¤֡XM*KjRAP m?}7Fڑje;?Ln0RS}8j!gc*jxn@L/SIjV6 UFY|uNmG (d]u1v(V&1O^iG4E2Qex2 UbsYmFș&3$4@RX1ƇSMWcD:ۻK7.B&f!A6fX2KAA($CCN>n}Ƿ|9veދZMTU\rVSMK241wwҺr{cxu{ .- GQV Ր TyT'5HG[ n]ddܛ/S_".jSF.gD YPa[/_yt{ek%ݘvN]YOڕƯ%G>%-MSR2#i5HCp7;罜rƲ[r ܲ q] y~.[L$&Tܤi&Ex:v&d䎲 ,w;@E5/Խ4M,/Ʊ*6 *'Vo639ʜgjnbkj*ci ϡe(U6j!h9^zw^V'*.ȴ(;Tm['N$E.Q!4 y+еsKUHyse9y( W4JXX|/i@~oO|w/wTW^frE=FuI߃f"گrNI|  =VGeᾼ~V}?RTOG~_׽b?<+ΛoSz܏ ׽anxܓ |8S| v䟥uBaJur>~߻K7}{P=Vy#` U#?>?{uj'o{3ӴՏ35S/㵕pIA5۸ŻqP- l YdRy9<Y?U0U(KD SL:_q;r\­tq ;NF`d0Ii;f`Gٵ^W- j:MW=^q6jjۙ˚ʘI#HP@4G\/+g[4$Sʣ_gIǺ+6#hϑ$U;ȱmK}J_XP}4r7.b91Gr*&7MOy*czdh Jn;(h-0hʼnfcCSƜ[kN[kO8|VoPƸ䖚J,/.N$Xe+&6,}loҦO7hs= ,'V9dI$$Rڡm1V6sRk*2:=~c\80J)(12Y)T [ m-0+QY)icY ˗|TpSF=b$O"_ϴQ-In٣xT҇:crQTg^,M;Ls#)T+cgb煮nm29v:8ᦦ#UOk(ZAQזb[φzIʇH󧂼i]ݵh7^ےj:jS7.>l\`T#W>h];VmO.S0:S+b ZaQeY(7>-Z}LR: mq5ONSS>́PӠ7Soaz=$t=>EiP%-1 (n,@U䞚W&޿'*)*2V@{rڕ PJ 8ŲJYfUcaq*Ʃ "d-I\os:о'Wc+Ik돮+REPnv[eBw1BE84 P-tsWOU jIDi="F7enM󯷿4DEKM,uLOU1Jx vamv MSe $1I4G]>}uXj 5TOY,^y(h(bU$fj ҳY܈7{+ڕyam,aIj8Y~ kd wϱٱmvLYZ6 <=8|:m.f5 ^gB&h)bEdqvnTOufXG@r9,u ZȳXؙ9p[{r&@b*G'?EnBh):SE&o ( RDX aaoi}&▻pW0LoSɭRYzʒ.Hiu! u9|grˮU=*C: 3I"_I}շ/ľ>.@RI,Bٍ_-C]PXxyIv@U?i҅*ONČe6͌nRgH"zt`c!7H$:oXEWU5zu}R+(hF\ ES\{Fer`JYb5BHt$,!񹘠]|{bu4)۫_Zhu\ssar&r1ET'WUyIf`o#۳L-|%|d`ciIb-<}v"k [irv)^h&U`~{vVJWH?zXF9 7<>ϼOƫ_tJL?Ց׿7>b%6ɪ1d"Lh_HXPpl}Yb~c*.UAZ+Eb̌PʱP> !hs5ZVT"?Oz6c$$Đ }t\[~.H*R%+Κ 1SM22x7"]f#YƕFծ~}{'1E<5@X畠Uq tvԨ$K,gJp>]{m*!Rwd~~ʤ1Ѫ0N׽i1Ê[D,6HŽd?AcN?⺺_*ub^*9#"*O*Ag9iFmk#$7uf`݋_~΢Ժ+*{3X5B**Eky&}kہoyuzVH7/"=ZADk*Fzr[JG[ڛ[yconMw\־%e5nI.2\ HKh`J7}UW%`nqSW|B-4fVS‰X?,h#7EPʱjϺԀ|?_/|sS ԿjB>jHJdB$G~/Tbp?/׽QKvpU4QOFJVi'EZ,##K :m]r>o]~9ÑrM=U}w uo̎Xr4;,$*WJ$ CǼ rV\EOkD M>&y`fijT+SM_Q+"Hӫ%?y4K  ud-VpIsaЌvdd3#xur#8ʦÌbŎJ8ӭ#44VCEX X[W Nɘ=kQDVn[MMHĴ#ͤXzWuys> ںb .( =+҃u'ޢ?Goztk1beW!Q""Ms=s۽՝;Ք57^yf“JX$l\U7$esMLBdZ*Ң@U({TSu}%;+v>MrT5TpV#]xV/Ü^WikF3aɁdUv43r$$Ve]&^wKKwȦAaBd҂5G6@>?jo_:A8ߖ8f~3vnRA&Bx7>ccd`C%dlЉF`nJo/ҽ Kw3;=.*y7 n:jj"8I*{{kv~02 Ʀq?ɯIjKWW)]F,jxeiiZb$?>=퍬Bޣ%o%4~`{ٚS[I:@)M>c{d~׽ߺ^t\/:po~i멾~wCt^"׷7Z?>-:*4,Eޑ@+qq~͍k|Ž,8^9{eKor?ܞ?޽SVx^68__cݢ@:0H/_ G&uFP4.&97#?}5'ucYջt"mۯ?^ 6);>9=~.eqV-z]mJs׽z{׽c1ekq̋5\ m#E1a m\?xusA׽e; 6Z=i 3ظ)`sdqǍk] Q0æ2M Ja?^Iy2M`(c*)Olj/.ZZۊvX:gJufTC)HD#8ؕu؞X?=ҸY 6U6zטEO1 che(*1B`AS{{[ WjV WnpK T"N?k-t9%YlE"#5TK zV:Xmsbόq߭ҧ(vV͵QG#RW_Q JdlvP:8s nŋ U2IAI= {&Вʘҙi;&˓n]6KqR1o"!^R:jhmU/ O[> Jޣvn՝aǗ֣,~$8*#֞x[X,mYmɿġǏ^X\y]KjuЁS[+L'1:wT{-~=kia{,Uc&jU2r#r4r;~ Y=[vLC?Y\}T;pe*0]MEqZXfZU $n͵0xVX#XP gk{cd1JqkǣEw_x5(˜ѥR+.I9_ܐ=̧_0[kjֶ?v7ƮJ, 3jYEdi["6Ays/,-JTHrEj~Y2IvsY>} \VV,9Q2h]`?6ۻo~w;#KLUIM04mc4xJ4Ro呛]1nH*CN]cM PӀ=6i.߶wxc^|b3\J&AZLL*Ҟ LR!`-rtOxmY7.?ÒTKO/`dh^gv^D!#P#"٤_> PxjMLF+rˮ8C:"BMyJ r]dvMxfbr5N\0cT54@MHJ4Wf o}d=ƈ e&^@iZQA9z8s9ml+ /*Gfn=[Z̝3R+jy)*J%TC8ipEi^ 9>\aj֎/ǃ]mV/"#9$CT"@6<mum4͠HJFS@i\NZ÷̓],^B|tUpMI'u7 ,H X-ɼwWhRK ec"cUWA[@Īma];"+V5~ 8g,JcG&ˮz߶.<nBjヤsD'ETQwCJPc6u^gkK~aDA E2~?\q$I"VR A~?|ӡVvӰm@?>ޡ=D>[}?{@l:dp>#wFͯx뙁k?7YS>]R}{9y-q{Ǫ?9u~]{ܕtmcY'MPr1&rz|IX{rn\}~˅5S [؁ou 5Ï^ 8*@$~Sی@}=1 ?~}{رJ{/?;,/`[q:nhy:{TGrχ:Gv}q޿/:O_{7V^^_˻',_/*)݋yj•HD,đwaܹ}e[٬dgjRZ=دXeeߣ?J4M:$W"y"OSMMA&x`MW;13:gV 39yk($L+.mݹik-b&-k( Hi hMMi뤗[DǍ,ZUx Q(ڲ  )և#2sۗAKuQdRs<) R۲\I+{:Enb۶Z2Sai))Z3 B*ϖytFxg!RPkjGj(I4%ۗ!bfU, 'N~Lo.IY ]Qew9\}\_ڽ|SI!W^v_y߭m6S1U9<5;[jDxVBWI`4 .&`jk[9"[9#.K#ͥB&)6ݞ,KH-0+x{SEM'_xlm&xkume蓋2˸q6zm9 Z? %yl=Ch[_1=K7V"%T1,1["es1-ǕQ}d&IHA:ƊFt7,a=eр +62As=ti4k#0* j5oNw!WڹmG UmX'uXHopSw>.z2M?)ȭ؝v1pe#OSYL+RdGtkk=eo (j0,ntUI^O$W99(DcTe X+׬]Ǵido)qT=}rʋݵ4X"ShT:hZոeacPd{ =؛+ e5,I[D٦Y'Hl 8SJݾӴqwoJђ /"@aT K%@N}dٹjNV)eRYU%#ƭժ;ԝu> ogh&^:9 ה>BZcSƪC;XϹ_{nyKY帋[\1\x2A S3ʈ1+ݘ㷰Vr!nU58SJq AcnRo,ګ=,YAI3>ӢLѣN"irɺLǍS0Y{zyn]&?!^GC3GH 4eмGq;=䳷ԟ!K2RvV6՘xiՙ\eCP)s;dl2Gr=fAM_JeGJW#XH{;ﶹqn}}E$q٣ QA},[u~"{ddF]`Jē*{G& +.~ۆ uNݫ*6Ns=sG$lDTRQB1[,lh&R*U뒶x g)3MU4龑^w$/6hn`cn~,]b EhުKkROє߯FpnBh<6 BuP 0*уUUOb\D9H &ܹ(&yk1wJdx+YJߏ-d(7'p/7=>vX+-Y+ap2K0ҦrT?9׺Gq" IXunʊI3>".YiF-.!)1(:%3/{zcl^mS%5u(a)f<8姦݀]B0=qS TL=M>*i%Vt$j%S 0ޙBLoJ4oݔUV j(@5/=8%kK΅H! dڭ+}[]r1>[ӼгR7@h{vO6Bd6qkP ^ysU)ɢ MۍFyV` V"0[U Pa^/:=wF+]$RH-E*+;xd7WunzliwUnyF}"8hiJy5D$")Q\/ba\ߟ"5o,Wmݒ=UWa҆]CmTUd>Pŀk*nŹuگdAe5DV #38@E:!ވ{) bi k4#GM@dU~Ifqluգu .3O:vڟ;FML)ɍY}^ْbw~MM2d (,-eܥ5ew\; U$tcYM VU)Un<T;{'Kc^)5nh{lrq ׺H"jRBJNF+%mU|a xjIdqKXK#os?m\ۄ]4TUjw-ipsmv].7d.թڀ4ȠS|{tٽk++m|XnfVm]缐I,Me\1E,bRo.gp;C--|fNv£mRaLUeLQRJ)Ѵ8E797dlճ ܍kKYc4#7R uJOaXu[9mw~#P8K5 K#)-NOE|ws9@W €= zo'lξ9.b\Tj3;kpCu*zzev稊w(C}Cm \.qW[5F6X)&BF*Grn]s}7 n^Cgl\)H@3VOOlLd'PJi⡪Ϗ!Z, vT纟V> Z!D#ˀVwaJU*KPYyY⶞>vlu v.+U@6Cb!W(+4PɢkPlx&}U-ڴ$_3-"$-G=j@=^fS O ]*+M8SI0-fvdU;k=:g풠Rbbdj_4r2)Csљj5#]E>*+0 ͎^O]% ;<:R B,"IBe>>h`hh e!uV"%!EQT!,V tG.WZ( Ǡާmd6IK&j퉼`,mmQ0. )MN8UX:,jo<-N5[үK2[WWg *UFKʥKHZ ]mchI"41Fx/s$2!C Uepp(GA ך)h":1+HfZxtwuMMTO4U8꺪ږ&DtY*}K(x (PƂKG ]FE')SWoBۃu;ee VM{ʯiw|;-Cp$HA TkVKkSP?z˛T*siTi" :Ѽ(QIjq5@ 9K!!#\SUIOFгF8e@6 M͆W/Gݿ qg ŇS}B\':ꟿYym׽t81./o}5K˨kxnyNc:E7bA3w׽:ѮOtzdiޟg{Coߛn,nO^^ĢqۓqU:w›{$Aܞ.]__wW/e)׽ &jt9~5µccacN “c_{NoƟ{5|ëlv󅥯ж?j3)*Pky n}xR@J4-M8dGe*+ݙ9XdY8҂J $D`l~Qn1ڹ=ͳKtxfʊ<lՊf8Ձ-֛[V9K; ? mjvi%Y$V& {}eu?nsmw/OܳcaZl~Sd_s*T+ZbW7<a!uwg&12oIpԸp Iyغa۫CŧcUN+TJ6*MՎNHEWR-y!{6QThjZ`-(MݺqaUK_V'pe45G-=.$I]Uy%@XmcsUee9Bo\y/`()N =KbqI=:v. TiN%UX۟wJFaqQ~vɕdvdG+HY|B iU$ .FsY<ҨkӶ<a#Qa։ĴtT"U^KCMZʶC*4J5 TQ }|C 2cB?sERG<``ZT=XԲ?qaFjH\5]x.]־.>`TQE(dJW1Rt>7@@_v>VQ E CC⡤FMQHuU@ii=.KX!k CЧDBd*IESM{cbd+i.:;0(UEI8-6$(T y|WU7ˤ~R(jO&c]*[KS?N/LNWK'b(疢 G;{.A@qjxN',(==noؕ$a&³ KZ@iOtzV{1zO%`ofJ^.2I-6)Ct.:fM^~Qu=}&z>t^T>(({}jQ[#<_@=bcI r};?hГt4+$w!vH)Eֳ-9?/xNKU?~ 68[SGO 4"Gwө/ԏznN/qU(+$dYn &`Jy Zl-O\T-U}6ÐȬ x2:JHgq$o[WFW^de Wx?C|pfC<4k$MMP<®)3^C}f&t_g[iPW:SJcF-NVuB.0-VVZ% q%IJB6ak5 ϯ^{ ;TZ*k쩦Tߦ'GBԽAW7ApBbtt:JuS7d՘)g>G>DШ"A϶-"r& -8Av A1UZDskcǺY*t)F0~H#Q{HYVFaJD1¬~NkzKka$_'¼ta%A8u/671 ,RC4$Rk(C {fxY?|4RoNZQ?QܴTx|5=-D˦8yY4#pӫOוCIoxbIJ ϐ1)5A@O?ݵOYiꪺMYN{Pc t_JB=5]<'ܰ zDb6?oHsB8Z_SBI!20{\orby`pSÙQc%),kXTXX0xcm{[Oϧ,_яgKt_FH#\Wb~i>gfϢ9)kU{V?{,}ay'ş^XK ?\uU2U#rޥ\~}rQ--MT%K,JHu-x^ _ef3_?MWJ?c ,{s(#YPrH%]KkFߟ+ix5=tyt:)W\zܸoӆ9U [<5KFTU@zvXз!״g蝳2,թ ixt䏭,9|5W]/⍔LxbT )3v>+7Rvzː{nn =߆IAG"zjM-'u,1R(o䲼$~/c[k6CdcξPws'zVڻW>G@bVGR^ ,@>Gl) AIttsSF-Uf,F$y&5h-q7KxS*TҢQƀm2GA$y|˪_U:SO7޲b8k2m-a-%TTc)[ILOAc'TNV{?wX<.EG][GfK&4-dExD*>jv-lX/o)t'\kM54x}z'ngNZzG O B8 >b4\ۛhvvb|o."-юo@αU|K3UlI5,B&!#zpa1\H#YPiX =/ %5<2> 9@4RT {9Uk+4ZȯiYiߨQkJRDc$Kx316/h'p{vlLԻtR̕?U(/E+Z4m]Rʪ[nﭻ؛.ےԔ; A|uTQ*A&"ebHF#;;{O:< YU-*9TաGZn>B썳:޻)zi_r{afhhr~9+0#QT!IԘLv_ߌ;^ٛk>S;&؇v*1,٤C%D1)yiG7#QiDʯ2TPT|s^-X=Gu+=6Fxq{a稳L~l\5lPzYeTR7V[mTR<+1U\=1z jt0{i妐V++~zär:׺{ؽ8n/?O|j=uS=$n{5rׯ{dm6٣]ruyn~?K^ ZS Gßv${uNT~0_~M.hNVGr1_ړHփ{۔jA- ~{~8c? D׽mpͤt%hW/W _zz[UOu- ,Y5GǻJ^6)oO>l_s/t_*Ҷu^Zu{߽uboNvNԠ1"MzLj_ɥGMZVY:{d7Y0-_8{\S EOMp]յ05ycA pqFgbcyQZV3ox!UCO: =TKw"7sM<8:UҴn^HK"v}{mf9V8&43OQoM\452 DcjDs([vYooi[ŞY| BWTMHB0+½{vͬg t& < 0BdV9*dv(.Oz> Ęwgc>껪|6k#&O#H)䪞ezjt*/% wڶfgBb IhG=Xs4Tp?fەTjH9M*Ԩ3˘|,+xKutbNﭗ P%{m$J-UZdYLHq"K 9{K4BMNTx(mp)f9j.IV Tɮ>Γ+{3=49FYNB` 5;6L ;)(K) a>ۃ+X ׍ܙh(vt5G.F)KMXd x[z/97kuVM M"$5+Omψn+ yCJUG)сΦ7. )j":cVY23Gj$Z62pǎ}_~8-fY큃'-bJ*"FaJ|{0x䩝2[ETѾ#ZZAH5@fԫjBz)k؝ <˧^OϯקzƞQM륯ÚᇧtKU5u/kk?;pn:È=֒-ff_ؚP<%4&5z>ej}55~FiV*P#5 tQfAh"`dj}ihm S^AqJEgv 77UuB*W.=Iҿ&]pP\>$w~ɑGc*b"{6}{݄kniTpܭ㳚fPr>'> 3' QzT&%N,99ŪfB$l_U˳+q٬;5g9bK]5#J$j`g ,vF*Z$U.sRXFܷg{@>*) f|r~΅σ{3vz⧦zQ\ Y:yie U.Kgg7~6>^륒:׈1uЬ9!2Ca2x#%ۖܿs!vdЙYkP 3MT4:\ٵM5鴱ܽf5 JpE;ݻ_wt`ejmы%&ǑKOGE+eSSA2GzEqU+2ܴddd~ҿ-MM-:9MT8EZjq(T>f` t- եGw_ϫͿwomefC#CtY*袨TR"JQTMͅ5|{рߓn,}%&!!)] ?EL^)GU/p wd=+L$Wk֣˦^+,1>ܻ84Ҋ|*9HDm>G&Ƶ`yڇ#㤢M&ڏ!NخUDj֞*;(U[hevX,ɴƤ̋ iP,R3Pw0 j2)v(LhՌ`+C@k:__&*=M6Xlsdj҃E$ M7FR投h)!zjHM[˧sՍ9x| UN,0.k1cIMW,.5eU$e<^Zh.bP2e+p0Lצ!.SG4_-z몶>j%vvgUBz\\VSDx&l=NK>ѹGxm~_e6F9GjR-QSV)"PFU)RHţkz?gnSgL`6쭃)≧$l )HUf,E{AGeOLjMMktSJm۬n7NU`ӅiOyLm !$aܫ=Zc4X!0dq!1!o;޼R!jJU4>HX*UAIZ|>fA$')j%o,BA^K\ Lˋ߹FI۫rCWtXu.De3X 4z R=mŧ|)".)A׀4Jz,v 5.A y|dZ~S҆h$X&ON*LlO<`sbVzbPT U3#Y-N%PK3bK[㲸oX\pxM_DR!= +Q f1K$?gU%1*r/a'lPo<6ߟ+W⣡a㍩+ u=JQ1PvoI-/mjfgbխ|r.8͏2FZY~fHb e~ v-&; [IS"3S)gybJu$2E!yHݮxGc_0y]}NL}}MK5ujy,S3N5+bei[\Ȣ;K%E4U07TkUR4"vxu4uڲUI "JxGI\_WlO[oc1Y>vr4;w ōTQ,=D%2 iEww?y*Cxf1j\> EufBeT3/ӑr*Yߏ]1[nm[[H[eQ>Zld4U{ڽjk|iUߞM3Z}^$0:XW>^Ca+m Ϗ+Bn%X/*@^{7>`aa6?hZ7n\ũ9ZH8#%2$H[[EunvsVwxҬkFbHf(3]e9J4J`HMP`Tt[_q6X,#A?(W/f:@X9^37.g![snL^ؖ}3l7 iTi MM R:B#GGxn*ͭ_I+9۶2bEsMȫ,rMe<֤%帶=&S;\ C\K1tpH4_dPxȌ,RT c^iץ/{k/۟-T9Hț.JtlOiݨ2hՒF |v4N{v]l[UwRm-gr $fᅰ?ixv(n!b/e`(I> ~|͑gra^P\Ҧ/Y//6ɭ&on#L}ŶJbjjdž61i,Ɲ;Gdr[l;;[WJVy_%JL5iRi`j|kϼ~o "1-F1B?'Dܨf׈*V|q~t~FD^. k'3bqԔ/KMR?tDRd l~ҥ3MS95Ϩi`Һ5I L I0.[14eBȀI a1_MEF,֗\(*@+PğJצ!g9_&(*EWUnLfB%Rκfz:ʤu_1}V'qTN4RsнYstX S5nlǽZmr!k29z#.?m .z0Of8.Kk"V;…*PU?$vqb+Qf,}Mu19fKU ,pnE6;zun,\Ò؛lc~dv.JiqyG+2MZxdRn@TCtˋnv^]E1~vŨ7^Z!H( YA3\)Z I ]*2i_3^Xů-Ngn<6o%J,vC'[ JESǡSRkd:[Z1=UzuG&_) 9ih(8)MRQqtksxg{飸K.% Aw#C'A!Z%FX-+hd&I#HRMZ3WAKǝ?ID4;3e+6cTԑ/ Y*8϶jE߿uS7.. WmVQMtiLI2i =V;5-\ (iċ~{-䶺AtXa yPփy.ϢII=EC4T;;6:J)^E3xlGU 㲸Oln=mڙLnzlȇC(xIAUkO7wm7O%,PUK*"$JIŞO T&SE7mQYٺD2W?1C+ ,ԱG21IKxtr[Ξ۴ nX0yb%585FNjFļ$)Kk1ʪ;J 3̠JZ+/ĵ.K $4(L`mW]o]+QlͥIMӔE읛OW dI%UeXim`} ^q29m$yc7["VQc̠RMnm~}Խ y[lhKƲ+HVڊC^$aBh,7{i#<*ixʑy9bOfݣY=t6 Z|xݩVQOw QKʂV-]csmљۘsaw6R}_UoieZ2ceaLԢQOKC`~yat%-(M=,H 3T\/ESrRȪJYV$Jj 52=c}ظ,um^ sYly<˃.3M^+|Je'UubogjsUl6[=~IUl+f(Z,OV _Thȅ0  `OnR o:i&0!V_ZuBr^˂~fm;?C7=P6JKS%\)=w& hAmpsMY_ūgpxc~dg FeȈLP` 6=Jξg6 ;7xc2 ?d20O}IZrHkd L2E,OG#Vhś{'2 $_ZKK@xNA`w&feěG}+ 9z,V0X=-uK=mʪl \9k)&Pb)df:RɪUn}xnG  %ڴ_)RI{KK5 `F)b B6 ^ް1#Ofܭ*cZ8I JU;~lL?:4y^5*Q$9 ]KS JG4z$>WfrFBPO[jQJ5 (^i@"V(⒊S0){;1F YݠQVom.69%\LcH}.(ehg'wfϧe\Wyj-Ѹ7_G$USaq"`$Q4 1G٭$iR`:*$S2YYiSQrm\NDQmUpn<8f)K18ڇ >RijoG03*ܔeTmq[sm)evaLc Ke4X22DF$0*w ^o3O{=FZBv6sMh)Uu^[TQG351lvo~vחk8w"NcuYP Rvu :@5oda5 0Ej581H={|V;SGܦx+hrY :dQ`(j&c1fU"' Xʌ^G!VUDO&n:9`&ߩ9g"@#4#>k7{l?Ď+i*#!ui:)JMijW PW4=2d;po,l nʨufnlږCTrܔtHRT+C`5tZZ&ۣיl{ac*ru>iOJeS 6/bA_o-¹դ#m(HI02AX?j-[G'4Ր & +t=?!q&N%YQ,"fTXlTfl몑LSj@ǡ9#pg#+*) q<@( _ k35,@߻Z#ڴTM϶2T=],qTclF U(9a*Ux+>MKkIb smٜFT GHv6mFۻQbb1MGE^;&9u!Pv|Q5Vhtw-=XlY`zdՔܩfgB`r\j8RȂ? +ϏF 6`pJ mi04*r|$k~8ТHz nl8qϷsc!SVrH$UVEhXYx {}&r 2 >qXޚGC-=-:8Fn 9N,%0)3BQȘٖ wWXL)($-jiE9d-5>Yǟ +:dy808<uQQ7N'j3PQ1LQTD+(@|khg&&m4sV4T'45c-٦h8WQ3QH,eB֚} jfW?>{g5$UWZ.MSS_U2EW>ҭwU/ɾtOKn(~EJ++SAO09*I{'zmY=|iUS^!YJah#@K&F-V.wZdY >g>CנrgφAI[PMQJ&۩}mNuHNN!1  &dՄPD?*UjP( MH@ < 9}%P~}7R"J5 sѲ +HI1[<= }|xo:3C硆::h HbN:EOsȏqE?MZydqoW[U3 $s$ʪh*D4,IS FzO/Na[WF 6G_ٰ!ұ׽ʎ1Ņ$sActܲ׽U-ȿOHq1j%RNFz켂x'=Pp{/+qa}2yubS)u[$\w{}ot$\B?ei1uw?󢶫v,lQiDnFk&ZPA#OKiiˮ}Wy5QjycCFu/釼({92) DȟQuRYu~csIױ\-eW:GO,AӏǰPj(2ZI 4N# rA6m>ȮBX極-t]_*qCHIΔ|&E:Ck~opl=Ѽwm4V k׽J|tTzLԪsk~}kfDJo$E*~}u'p?ǜ;UP२jiVN@<{RH5Jk^2.ߗ^9&ZqxU~?t7GVt>|3:&CO5~Xc>Q2+!>M[aE:ć]_: oZ254 )CͣP}OL:UW=?'Q*aiG} 8m!+Rg OuJkaZFJ`LlhdY'u4wjzWI@jI!)CZ_"HXړC>Ì^6ώ%4S*T0k-m {G]-O;IW+^$X{4/Wuf!?jQI ^6Y7ŽGmWT~ޗIH ,[?I0dXYҞ셅r, &ZY'm$6\YϦnI(->4"wh0AӕM)zDoEZ׀8nұ[/>QEAa^k6g6妫9*KiR)YIS^?Fhj_~UoGL|gL_k[F=w2Q}AZ^3q$aꪥ?NƝb[ɽQ*G, ˥zg=&{L^}<HֽWOMTc=E,1̊xĪ @{Mdi#iCz A$|oqrVi]Aw8BA`}$OnLVw?]T[om<=FV J}$Qt k M[edN-ruԇUQ H 4ʞ}{أI4]fkSUKTTkfHߛ{} z^.8qV*O˨Od#75"܆{O9hVh),rHi|#) \*WV_89$l568k6G7Q{ NAEAWɲE]E=1ʼn*LvmAZŀhE~"|G=ضu5tp:q_Z7]K_~$娶P`2ر5,Qvm>?3 k\uE5LDh/Yev_qte.ٛbݭQ_QNl쯎,-^0iq;xj[f޺itB&f V8ϟ̏*}g_B\փ<з_u=#/ݕIw_o fC{{{ z&aӃLu{Iw/?ν@uO-7o|y?wT}? C^-xWӯ=r˯{ʀZsVZyy-mCn87iz^)T=?G GϦH={sU~~qI.=j?E|X @CjXr,H0f`\&ν9t.@'HouY hzOWp^w?k1rxƹ}rQ܎?.u~߯{Uٚۗtg=>neqV-zSmJs׽z{^ό3^T:yɈ)*'᧧CMӴd1Eg~6 I vSSϮ[%԰QbXi@?_64Symm nJqKMZحdžy1GjWev(s"oOj 4j ȪO׮l7K,+8+hSG]V)̅n~?Ofoӏe\]Rm>>sM1Yd:Eǰ~a/um 4)ģ-~|"'O $!I6ZJz̖-$]9 ALIap.Uf_+[Kie.9L.!G&NWEKqyzYQ"ioQv`H+oN1tΦje?@tUfWoUN3mozTpd*iK$?1&.n0YʏHS șW!S,Hi i.m-nTTykPiM Cr{fޓ@G~TUE h3EKik5iZ? 9UX_:Gxw?c᧡z?/(30 B P҅/F*ȗnk rvU]N0J*kô6jSFJuw ;m랖<'=:讒)%I"xf_v]x_xJpn f%CQnHYeRI%a ɽ:e Idq *4%eOujܽ&~m3Tb%5Sbw$j`!.ݢQG0))  gQ .]$F,Shղ"dy cA7jׄjPoVFKkMQIIhkq2QLSHFUeJ~'PI6|~qewTUc WNc56P*PiÔ䴎ya!YiI:F)}:,h}?.h^+,e>3!&>))[VjP P1$ܩ>63'}ᚗ4KZxaz%DUl!ʥrwso=Ѹ(HɫFCUçU:n^'k. qՓCXWc(f-$2bnD$~]/~ܴ8..\T{{tn͎ʢ&@SHdoʾ%ג\kXȩmHAۨǗFBx+OA)iOkusm | J1i*g,ei]Γ x1uF(Tn<+=I\_KT0G0SL+M^^=jHFJxtҭxdS:'gs؆~] ^86K*@PZ&E4VTJm*'|K_NN ٽ`zv6@HOUz"0CCS\_B/MgJ^Иj8 ten M$b:FuKV70Xנ5&#?:nZ,I5SO bW)Ko|$TNZ(R4 `vܪە&cz*F5 (( +[E]VWazF]wU뒭\Z٬s =DuRWSx&c ᬂp`ۥ̵a6&uQ_EES12E VXIbYOo,V׍,0\?XIe- -㍙Ć>cY&ŷ5Gbvbı,]LBK#FU_#ƿ^Wwau&{O':\50bf\| 'jzpj]##][}I$?/4 Rh@2,4:V5&BzZL}6uj*^c7&TL.}dAAߊ[F]]FJǰzK4]ME2OX<x$ x[rѳ]J ҃WpR8(I? b)5|ٞwY;-5G(⤧ 94T{3Ā5}j>ꧨ\4GT<SOFGwLHBX(kf:pȠ}q4r *>]_~@ŀ7$j#NJzHYbi%d8aG"Gb]@+R}ϒǾ6R,T0q%ګ5يy\fvv& O, i&L۬"gQ2ć1"ˣ >Ƣ;=]N3WAE+mں\P O5FB qDyhc1(5] Ngكڊj}]Jm˖j IMN GNхSib3D-GAPjvIkVKAF5'#; ѶhKQU#JWHȚX)%XvRnAnhvmJE0X.&0xf;K#*c4)R0+pR.ies*HG$O2Z`?;YP؉ f4iЮyo s;lsavUf/m=u+Ŝ04Tx:1D>YZ STDao4qK:jPkPTpϭUԥ(qCƇ9wNn{SS㒤1px$ӕRr2->#1̄ɍ~43a|"TMjJJ'DFXCb1 ``m⫝̸y|xӏ^9n~6xZs꣊Ji%uBe3 UX)bȃNA!KѭӸ-9Ѹg5Eet}؁2<΂JZT].lE@TTqO 6Nw24Z/Rgw(I\2jx Ri2=>΋o;9.nVzzYRWEs̰k`ttnn~}m_ve콱 SYWAnjqI1)U&ex lEm=xL>  xzr>#ku7V+Y?D;;7&K/-<4wPi%%呁&X"XPPu|wYގ{>T%=DN?_sVۡ'{{?}4-;/ 5?qCM뙿X*!hIackm_Ekz{K\?MK}Vqϯ^*ί?{1D{۬`*M,?_uԄ0jg{Ė%y1<}YPil}7~2 3SA׽ߦ~I},/q绎Wڮem/{Vsyvrn8>z =?_ܗWxʗl`tm7VRqH+BV?^O}!n jo/X2Ǣv:jRǯ{#-ڽyY6今`g0j C%O0I(*Y27"{~{2nܧOݼ2MᬱLj:kbUt?W ]v9}6nG 2i@iB˴Y8$U4y^%_<&Q` TB?;oen?3}shz Js"1%BQT6+Llx u\N#g,f~y!0.4nJt4 xZKW1,miY,QA9$'_p_Uhw wuVڃꠢ2UHfˆ*q{K#qn^: ϴ2Mu6Jڴ+̢aZШ*.le=Ex݊[K#ݙ5q*tN%NR[G>g$Rɦ(G*4jTа\T 9=vZqm]2GᣣbFJªz t{-tvo>evw7zM\IY0i>Nb] Mp2gkoJIx!}5E=o$]G <"kP FR (8e~Ru"~&תX&jGl0"ieyTN&0cpHm9iUFLǽ/f6.[<U'Je.G,6ط9^&2ީR '芵J3YĆ҇<{XJg30%l]6lZɂ=Ӓ+k0aS:x{_M e,euVߓM.w9&spk J8E-Y72".W>۝r kydۄmnfG%32@*3V[iN*YF SU8RmUs{: {j7nӤ-SX(M7"Vymx}ыy,$9z/w.۞_$SnHi/4"c%WqOwv.f0m\]Da+K/$i.(iSeאüg/{L NB 5pœ@=J۵\/_o \5f7vsW:LyZ*'Ƅj*78edO4fAz6 ~(=w,4X^-O]w:} S`)$"{@4c{.shs6<D4@K̋ Iwj4ݨw+@VH@܀  I_ V~vޥݙfm&PPVt*MAR#ԈH[J~EitȮݻ}ٵ-ņɣEf)-*dH,r03n4Z÷ڳ ZTE#b ВV{m.=b|3Uxi6jHc&;;ym˸z 5;C:|H޵yqjSڭVZcQ#]dT?pt6bzmlU>aVX@F?Zk؊{Y{^uLn Xi&>WpP vYG%8 =7t}u{fyrZڕ+I7=WO],<t0֬MOH>& Q+_;e![t6|TI({]A6SV@jLMiD|(sIv>CCZrm+2[^ ]S (q=D00e&7~7en\va6F?hMؔ5865I1)j^M7uQ<>I%obVҌ&+IU\,b5 "f(h^ zrc28 ~|wQe\i˒*uoVCI1tLݗ"-?Y%עju{sAKNdyQP+UB*0~;?4mwv47;D1Z TƪSGD׵b:]q1ʳ[$VJH5h<P cPנwOtuڸ^܆ݹx ,tL&ʢYK7=ɲq{ ln|'`c"n r#%:C$R /!eAdb{mw)n|(@#%5QKJRͷZ"_R>T ''#-@un?'hTMPp&@ȳiZ7t1~* ch .`rX@LN:)AKNx8%bAM@5^p]I_dbڕ4M 4VՋ+T؁!]ҝ1k3r6o:<ȭa7[?2 (j28 wSuBY X֕zpk[izSOdM9Ik2yx-|W-=Dm4DqJ{-ߴoyM̑KvrLb5 @A8<&ٖX rxVFRڜRPERhI9uwUNԔT#nb8\&:bڴ|hj3T&El̿=/r3*ݘl -f"JzZxY]̠:IݩWNkwj,pKQ/MK* ݣE!Y6-M"f.*]I}$p Ao[Ohjۇqi6~{s;b姊o838V[kN^2SdM?ۻ-;bY7&Ej$KtrhAQx+d}mۆ-J-r0rS.!jŸ akX d1U-2*AnS_obn=Xr4JyiHu,T^/_wV3є׬hpY,Ԗ:,W5:KV4Z/l7{g'\!'f qJ :79jG)DNVqȗJ%doT^@#S ϒu5;{m')a;*C%Ex)a 0fФ?[>S=W|ؘ=,vn鎣ߴU$ AuI9JZ{U*>><ϻMG.^3h #pNqHтѼf@Bɫ$FponvK:(*rWK+Zd5`6pcXӟ늌_zHWa=l8TqܦgTJzILR>Y#=s{bRbw=~kڋ<[?3ۡij)U Ff z+e✽r;-B!keiĦIճ,I=G$E:/+v]I&]h+*  W ; }f%+E}sD7 ی뚐IiCGX y3 zvoPffwNɖ-1\c۲wQҼ!54c /Y($m8D2+wXت0,Am FC^[E`r:ZHJJ>uS{>SM`ܫ:<b<hk)4k+%r,4+ۣnlwZ׬O/EE"G>8Fg3J}{?KvesG6SLJS#F"T:UmoYB FĄ! GA rڬm}[6#<#X?%-0T4^Y"]j U[Bj*Y)bWb%+ (Ď-O6Zs^p.ẅdI_ҬzSožn68|>R(Κ_=$0ySp "GOP/]ګ9i>fP _ipk> qՋ޺^ utP#K:aWS{ˮ\O.om@][HOu1(zJg?{c/$ڏ`#Ny}Mnmj:Q]TMWO{mD={߼m-a~ NNQu>QXu5$ܭ Ů@ {]7T&{+_O^Xk>[}u_Wפ߇{6jVRgKS#$uzEEC6Emra(o6K[ٖ*F+VN5RQR:"_ۯv3#]5BSE$R,ɊAeV !)#aǵgwv.gxzp[wRe'ATjjk*HO>W-a&=ARiӢ48נgu+aLKQ6森R_bZh a#̫; }(bbudjZ gMkңmIZ:㲔 8WѬ݆`cQqy%)eCF'zw(襥3'#FB=vd{{\VNBhx^mxgGJ|1+֚E+cϥ@DY:5,zbVU}qߎ'j -]YRG OƜ%nG(+r=YGGUV$:KWQ0vN}ާife‹RX N2NMiKm-HA)_K_c۬%j* gƺH5{1GH_zn[L$D?f1҇:{Jqo'+7LxW'{t[3==Qus?׽ϧ.>'`E bS= ػq~)5O]:_G,,.>fm\MpULP쉲݈>QmnӬ.Ci幩?MZ@@b tu9RS5,zVtBkI }K帼h߳uZb$cuR)Xf .O??h&>J:%1@6I1\Q}7$B%[OTH@lZN>5{pi*bWR#1LA; ٍwZZspK?/\h)ER3,q{';:I}^:JZzKqң0XԺM]#xʷoê}Cj_$Or?qrmMSR@ hPR7$~= o]2ɨWg?C=Ֆ9xaf2?)"U_i\OPxHE-*HCgUS:x.I}5!$1뗵٧ijeզLuQf,tXH.RLQ]'sfhm<߫-cҭJmf(3j_}177JmBO|`(票 NeGԏ`ngTuZa[Jؽ.{_Cؙ_?ޚH%iu?'O"H F ^}f[ ڹrQ0aoXn^粝ǭ,*Vq:b eEBG ~oͽ:z:c52+a 8*[ME3|:v8js==zȀ?[UWkhc)dg:1x#A ܂=6\5GWDf)1QX]An~K{Jg/RQ3X8__آ{LQD =dGO Z`.T:U*,WeOe;+Μ.,u,5^G/HƉu.o~,}5p-_tR U:٤+vϬa%]T39ILEK6*l}>G{/ةsTڹ r%df"dB8*I%cqXYk{={qQ""VIFV120 zGԋ}G 7Ҟ_t阗Jʞ|sE0xEUNC4$J4.@Ծׄ` >EE$$nbVu(lܛ? :I3AQ׽ʼ R}:jI`d1]OXޯ-FS'[) *??D, 2?eM!IOo㶻,ooc2{{+ASYKy/ >Zq2Ɔˡ"#fI4C)ryiFUTܻc##m0) ds?r3ƺVAUtj8Ђ+=mAvU|iηp߉c6?o:\;hŕ8gpScXxiF%CЕG9jJ'lLdr7/,jQ+-yD+_gDĕfWcKXkk ~ڻbfsRHH)abUE"K$G#l/(UV=jހ5QadRTP ǿ ѽWzp4ٙg+wL'tqnFPG0=na.{ܹjd5eDriep ՓNpW^GZmSu. j 7;bz;C;***8uA[QKTޛMߑ];;eTϕ:m`lɓ,+19 2a1h a2j9G9Zs(_:KpcOI9@pW*W# ?~gQv`oG{C=CA˷)w&/1?qI=U%B#+!@ƚYfknl/r)0?In" 5ǣCϲjZJ{_(),\\/j[kq[|n3]Ҟ;m׽W?Ԓll?$u" Wr/{9urה#?-ȄsêGz/G7Qo  i֤*xun/0Soe_^=n"^ڜoQܛ pixtAn,>1ҮJʱ->@:AcDT=':LgF.疎nFB7_dbO:GD VNu"D ZE[KV@jVҤpE*X-\ׄHG,_f|AIմÔjTrٍG H^ ]$q0JK_ vo_UF~W-nO;l9(uxn4Ҽ޶Q[xc/"I)@^e@'C[FFjhSW]{csQtWH궧ʶ(`wZ* 3r;"q"uvrnǘ`)ihq \zQ@:RPea&{uvVϺ퓃=d-ZAR+M= 2UYZ\u$RI&Q8Y:o=d뙶bޑ`B ,qRRc0RgjL֚8 Fi :*+Mkq̻M E0N`O}UosxdZPJ`gOQyTKSqlGK$.&t3S,t!lp![n 6"*qQRmÍ4# 4s s B=Ǘ;ꛀ(*R+h$B+R1{ϩV&'>$7mV-NCK@I^'&z֧IKV]>be;ztF6FcoC<4ԕ4ujX%#}IzE9jw7[eArub}W&o,d8cG+%Bڬ(-2i4,,7ߑ ۷tRRqlu\n%5%dt[㦄;F^Z4`FRF9ovz58Ă|@I ʽyok 넙,6 Vbk&F{ JF,?7흭hq.oZl>0 li`YZdJQUcܠa*1 Ԓ?}3Ǧ,+߷M+i穠z J#кUb =|ttiNz:&3릎+R YH@V]Ac|03kZP|1RXhVk:Tv^ VBHڭҝscS3xJ|V hUjTGF)J .yu5yd>swr6[!t481*H*'o}>[_zwsɸf}˃KQ<]]ijEnVDRJPNDl,~'\.wnݾ"+@>*>gڇ%5-|]q3ja v/~36UDJb~Xϼ5gv[S?US_Oqy?m)OkFNݤl[ J~lW|_Ҟv>^^NBu_kɷF4u W{İ = ^B?O>"zG^JIpm[~3ϭ|8?}y':^/6ユ׺g-zdPO0s]>s!?ly:/eeWӯ{?_${G͟0߹/[(3>l`tMq*GQ?K#ߋpx?{ G>< Z,t%~1p˻Qٿ/qzݱ]:"x9-suVAfjhq[.vgfy̞ ̑{i@#HΝ]uy Jo"1AZy M6:JSy$43ʕ:H|.G Ufsy=u6=GSNs;N*Mu4qGr+YJ+([{r͏1Ip82Mh[Fdi-ƢTץ26`adv% RHkC^g^}WY7VaNRKV\hdਥ1 j'yp6k QIk^wme* 4UJD"(Ty~o"nb%J%+ (lZ*E ,'n~ÕK;L2"w:1!XvHR&+U|@/Z(5AcPb*Mx=6[̀.Ӥĭ>[l磧U{Q=PGU*|P[oS;[1ZG-],kT05 lj& x`Z >s~i/7Ħ%@:K t|h:_emt1s4Qp@Жӆ8 hnHr ;{[Fv- mUgiwT6܎c1sMd7W'taB6[U W)[dd A\P߀ ].^kO#2@~ʀ|^>Sv=-އ/:%ņ8n*E2֩l$deY]eHX*s ^S7GK029 mzZz6mQ\՛1]2>EE5TT7ZbƜW)V;̛[8(w&AnHUZMaqjwA],̊jtLF8RƮ=(sqc&s)1PR Vb&99WJǏ|F%W*DBIS8<}QtT{=mu4ngwRrsi U4,Uy&xmlnTxCn4,2I2Ip\WUmT3D#UUBĚNioxGUX :5mf.=aX1IYީZ.墺E]OM7YjHx.ɾ7=_c#OEID vZcY`DۓFeglݟhHqQF,J".ӲhUZ)!i?1݈-gbGVnҴI Ս *Gl,.ܢQed+璦0*k`k!Rxx݃6`t63ƴY>n4U]w"qxkXy*8q]}`UFE?p}Vm&)d.-Fet*(ɑӻ+v75-P#Xe:STSz w~],#~SZ!53ɔܕtE[#A@Eeok tXz:/ ]׳6}2TӅYkrbmy ,d%P#HĺGp-J*i/;M)dܔ"c:H  zt||/Mێ9UOݝOx=FmhsRP@o0}iL[ z|M+oYj6VbiEK1>1]5 &<hՑ\ ݮ(rF6i3Ax Nm sATk#V8$T5awo<h*ώ5;gy5^sṁnlZ]ޚGi6і]xĶX1ᆴr>AfԛLT X}ݏȢM#<1QUN, 6<;-I_1Z.CķFO.om$v3 Ú=C'aA:,>kw,v ~eNܓyCTiڽFi7nFpRPEh Krf C=$Ƃ=1 xFuٍwMg^VGywMUYjfR,1, ۹ٿp}kkkC=}PvS 1m*ѩf202|wNh+J $ Ah;crKAۋ[zmr,tN%n/"24,wUiDUF͟ڋO 6fxVrR\)>Rj_VKu,C 3⢥)I[`RI\ \-MaJT@о[L6Wu-7|ɢYhhbx劂2 SDY뗽K`捶%ghmm9C-:&@EAFuBo&F%$HLGxŨI9<08PGI4~Ƽ8\~kji2y UJyRY,7 \GV[(M0G-6mLεMQeȳ˥^8>U2lnov]|[1Os<Rҙ,iug,3,u3]aG ʚJ;1Y[_MOM=6ހc|:OШTU ]a4`=]e;<6>5X+k*Weƕ/s:E*sO"{gr8O&0k# t+H;_8{{8tk5 Z-cr*#WԒmm~G{%䞡N{ڻ'? shiՙÐ@?S>#^w?F몞WCoֽ{tkns{qGG\V!׽Pߟi;3r:>%͘z5[PH<=\[#}.ôN¤xN):mٸ/^#?NO㏯d)@?ten{URxT-X}mT^S6677ie:D#_uZljՅ_>>{~޴y?{R=Iw2UIORK,)fTn,b0S) |Ē5*@fcPs$$=9Ꮇ{LxW N2:e"1g[w>=I[>ujJZE]j >q:2^xIcU*ayh0Aƀjp8LD)֮n -E<K ?۪R L2#ob.I!gpؽjݓ_[SԭETYhqi51V D4R 7KikKZ *rzbXQOA^x[|u[,a)V|8^6DFSg1V<6^e+C^Lfj cXT[3B)XIB_J\JEǺignTQx~@X#C7]_ ihkdC5D@STbfP4ڸAd{+sGی,b,=5^[&^S[ 2,i[I(P06U.ta ¼ 9S?8E *8p=}.[)dro.VZuU-IbƝ-d ӽLk3U4A$T`yऎbj` vqrM>6q2sFJ>U>bcfW`^NǼ5ZEfWp Ol kd*\uU mu=eUSS[]\T2u3\('-xcosOgv5uhkHj83Lʺo͇ԛ~=:j Ne__= L%# oy*ppO壷6{Ylz~}"w|| n@ [Q6] 협媼+#qKeeo*VEWHҿW,,VJ=˨$i?x5KKdjAȥETO'I,ĝCHh4nMTBE>Yrzv2@2n\[ GPD,ڨC-ײoϱi2[|3 MšjrX p**?Qd7d[­A v^8j95~M;V*.&c "ƢG"ExwC5Fck3+ꤋrf$Q$^h쑷5X`PPPpӻz,wg^sנ|rTRVEjalvY"kN Lsdc1Gl"JXz ya4:nwy4; Pߐ>~c)~{Kg2M=>i  1N R/!< @^3-Q>S(E-o_f :ӯ{rQŅ\{8.XqcqtoNdfP?qsLJgOI_ rm?A/| zJT0^*u,] mOwht"]zn?^r_#[ͩQs *-!vFRœ76{n3u1S ]Y-@t`sP]pxEOp>ȭ[lWeQe-6[>g]X3%-﬑Aw ^,Tcj!fM#*.M63! $4ԖX΀MNb`ߑDz,V 4*JC ˆbl믫=H1?·A \}tIJ7³I%nB*Ï:_gXV1,K;@jN"kOdkzp{*)"(Į*=7sosWz1J~cƱKA.rHnNz7Uc~GSGCQ=c1)eb?!I'1em_coW_!?XeA_5#n}18WoS @MEՌl56xَ֋$O4ǥ*#M#Q?-l*%qbΎ鲯<_mF.J Kӄ0S~"[{,}Kɧ!{?đ V]\<,OJ #_$C -ǹgfeqG!y},[墫1T-F^6TMv(^+[öV ӹ-4zYo 4a)\W1}E1x)C+E@T}]M55mY!, 3@tO {wtCZjz֛J(rѲ$.௓E^B֢G @Pşs>;Nw/,rK{ ĕ6' +O뎅v<%N~gQNO^;fN9=%;WG/b jf=;M.9-*J_JɐsY;?qGY~'$<ۇ.w7ѶgqWxCMY]HZI%6f{{ѹ]Kd8OëVUj fĶ4:+Ӥ^˯o8De1ݟ$Tx87[)ᎈö6\x”tG4L4$a`m:>Ն31xA@*5>UwBݣ&L?gQ, Ou;%JMQ+n?(5VRy%WPQ-,/Hn}ңA!aFՠϱ?eny(k<Ximn-f6 x8Ϯ..Ck?Ycmc|vzW*Jw=Kf?Ց׮ue>JZϹU 6(QkDo{}}l6j:4OWgSȲ$!dVM;-tayצT`tNj*DJj2f!eYپX}?ĭU1?,|ڬZjUNet|,T>VGoW[ c#5={|:qPg0S"SrnYXj1(*Ozï J#JF}517i{c$Y_ë8Fߛ~?>ƭͰ0݁UM"êVR'ujҝ,=.#fPt:w#;5@_?te$ E?:*թt5C$_X]@s  vz`h)1ۗ*w%%hs:4)RԍȬv67'7h۽іKamz.ȞƇ_o"?4#˭I?LUuWٔICo9f)TYKUFѤD_q#idO%4RFF<5jpKZk#5|\q^ê;V:mR 3(`vp9@= .Ⱥ.騒]}6 -R栙 8dY`@~7{p#AUxSf$O"mT;̧?p\UeGhm>޻|IX I_G꣫ڹtIGҨҢ]mT 9t79׬p?~=iNLV)^"UeC@fPHb}&ؒf> ^_ Wz<W69lvcp[wbO-%EVɔ˸& ɏ2M,t*71Tnie78+{q;54 _$-vjS8S>C=q{'ztl^[ѷs!5&{ 6ρmpŝ)z8ޠ&Ɠwi[0=YG b* eGW1H1mLLxsv!n^xVBZ!BG=,?8ua+x||v뾫{v?XKo=qQf~C")ˎ1QzyHѭl`HJuYq40N( /{nI}~{Э5Kzl#XpZђ|Ke>7go85xi?,uﮨuJ{?^A+I5\zr(C(ezABk ${W??7g{tzI*o2 &cj!Ah'Bd]L )'݌[ =VOi2uXh"zl^& .!5[G@+0~`MwEIBuS ^v9ʞy~ݒaMӑ 04%Em< W2c6 ܃kQ  I Nf 42PEUhrdʌn,ēp'" U'#RNY *F{}Nչxz"8=P^O_#%3[ 7F++~1ɠ55JF)ࢆgH1;"!0w4]n<8lFv+QTH#iG5(ט.$۶M5Bj{HǨl;U g#*jiJ#ω|c߽N[އ龰0zlf\vȭ62HJEFH$lY#u!bŮVOs q|W9*I6ےtƣtmUc*SfqVT5:#^rֲRfPw7>[zdxܕ paۧOY Ԯ>BO^`C#R=F *EszY>ysdFMeu<GqNtUp6>e)!K'VI2HK}HT2Sk_՛#=7k1;wRHݸjZ܅mn/&յUET eWHٿWۯ-m%f Qhhyt&ޕ&#>dON_E]G._ڠi٢VJBbA*8_vcVg`[_=ɎyoC4ՔuU54 @rčfv(4Bb+Ά ܶF;ҚCgH.Nߘzjǒ]F,LuXܽ(&%J%LSe+s[{`ާe+ܓ̆K !3fC1bĉ#&5 Qd{-]ij;eNJb5#zI-YgMЀ/NIm򻾳7>:\b-IEH"+Ҫ~ἄ;Y@,UzWVuQfsovFVAXIܕRS $+DqbOR$6#xm>wQ7S4MxR{r"\ZpVϣ'lrmns3SC[-V&uPBϥ4w@S鯌9)ݯG3msekᧈzWdSiiԓSg#Y'{hm ?u4]* i,)/}.#ad6īۘE`G :0.UB_%RxyضKTy$ 1v>ĽX} ^%hS]&)`Uid d pF;&%QfB IZR9įʻnͱt8W_~et8#)puSWUBiU&Teb (+#r_n: QTVm9-%2ȃZxbԻ1of( hlë*$ $׊8ץەw9He' N?G횢svy1lja(l zl &jSp@䁩}ۘaw$r/YUq4_sOx5n *ԢX>[6MhXWV!8(:kc ׳3=T$^cv-v:hЌNxiZRe(Q (v֠rPDlnGqi<[~gRQUQ#/EFa)wt vBK;4fV1zb8#]6CW&}2UcsQ,x9Z#: v_WdWbuQɏc(k}L)uĨIV%Vb [ ׫bN+S#AkZUX`'BSn g)Yo P9 :2FNj SxFݟfd7~ZmÅ-$T|HUo܅5DJ6BC{@ZW@* Qn8N5:@#eU$>zAQ3b*q10UP7)O>JK؈FBv[YCCY)W6Z⠮䒵9E6RTwME WMXjP@ O!L/M\Z<ε RpOL[dTb+)掕*e62J$j5J=AP7_r̦%+,49,vZ#F5kHXU$ [XlcrfR )uCC5G^*V8moY[SMQT)hŻ J44"Utu۝oM)zk-h>K+?/d}+M)ՎsQO2I6oAU3Au3Olӯ{W~ֻ['ym-ᶦ.grrnj+"2Q."EHo=Øz߶k坥, #Ee ,A H3S^{̜goA0t3UA$5'Ԧ.ƧU ]Wapؼ.bzL9dIᮎӳe- >Jۯ{q籘ni6TRvasso ʲ7- H`|=v>O;Y6, I{47jBQ:z^nq=bY-3:ƪd"Hb)N;kS׸%AUdh{#M jW>)WB+c=?ۙ`l<Ӿ1d.KD0cGdn6}ђ6 Z^mMuf;\r#:(v$׀XVpI1F5E߉( qO=C-ђLR>&fLar}IfT ( H>и9~1V?-Wv۶7B1K3d`-Ik$>߾rqo1EX637VJK~#^IpXf`C|cѵvwaac}:c yfHRm uz?x×7&}2+ڴI3OPR"@w{orI %bojeSøbͮj.J)0cTfE_zkNy}s4NRuq*Bilje]S>N=%qƺ3Պ;Ygri FٸC˞YKdf(x*=;n7kc%Lk@Я cR2Ljv8mry^jgNfݼӮ#R,AUkZ-|̦ :d(x+e]1M$hJ2MgCAlW =2[J 7LIbhĈd4dwhiqzFCݽيۙ '}EaAIjSK3Ī*x3)gU^LJUnlwUх޴>l冚@X"hFa1 3ܕ~HnbG\"Y5-)תC%ahKv+RT1 tCMK%m%re7]cjwm6FJHZ*3.E4AZN=N?(  KT8|Fi 1QG|C%T!s d۞@UD>HVI.>2,6> C)}ԅx }?wf~?v7XܲO[PMKfid`tr]E6f[> Õvr?4Ǻk1T$c%CF$H 2ۘKI&jZB0umbFiЇjz(yAwJ#PB БR|]`z#&_tWlŌ\lN֛'mfjlV\m2`i=ʝg:SnuZ V&ӼlPleV|Թvn]W*S!;4UCWR -D`"cM++{h.Dk_/+F"C+F|@}ʿS4U QC6HmJJI"Hפ?v>8d %Z#FəK?`nOuO]=Q{o L"x? 6n>ޱ7Wpuc^ aeu~(>OJ"zw PQ=3I#l8'.˿Ioi#{m-ed&h#E^I1oɩO7pj @M@y=ga7*:{9S#ClA8y :]5U')/ͯ;_$%ȕZF%3M gЊJK_I.۹0 HwY5}O,f+Rc;[%Q7q}OCCqHI!(%_]ϭ7`puC"zruQ͕,=E>1 Qܥ½ݠ+i=vZ)5auaN58^8n$K NA9] 1;kk0ܰ ZD \iQ 8TK*B6c?omiG ][9:Yqf*?dǎ>5j4 AWqm&I<THdU"R_ ".7涿fk$ >IU T_Q^^3r\ln%<w=WUiMS~wYAM21Ega.}8by:*S^ԔI^U  2?xW#Oty9oxH)H1-\X:Da %"BA"s?+e9|vxr\X)eQ,SEfQwĬB*γ1Y SRglܭFrRLfrJxSm1l4,"#`Z*ERA^#&˜Ǹ]Sl# $!pxSNG[>=ŵr{t_{oq;5RWabY撱x&Tcʏ%lÏ WlZLgVf%jiZ]UO8T* @d {~ڬ\mc࿋-ҡ 234J )L: ϭ4j;R[>N'yE5e~Jj2 iw؟vctQ5>cGK Z0Y3>n,Dܾg[?!_Ի|R6b<[U2T0DDW*=y{k-]DF6s]+";RBR%4KpcghC0YZF=EHcƀ#eS6?k~Z8=ʯwڶ׋-%=X-Ey'UZ?w/~|36M۟AqInn߳-LfJJ,oN`di# J~ݼ ke$JSiWH YP;3j #kʋMb=z㒀n0 5jgjB}ӟ&v2lYp]+Wa8!:fu[50]r[eV~ٛkb}^ƼiVNJj ;3GgwgoN~nึ"0'5{(:Yr~rJd2XY]-W"h˩U/%Q>g'UeYUaz&D5ЄkۻV-Ӹ1AHHjZU _}MtQROZd댜&7;{Ut*ZiW?w^wKsKll7Om4YWR7?]T+^_i_\Q\ʟ7^#qr.lPXzt٥qﯡ[Cֺ@ P<ǵȡ^M <Ϳx[u}1 o{4,JR*zo{Xy>J>y^#j&?Oi؜I):qD,8Oַӟm=WJCem~/kk_u[J)9N Sʼn8h-p}-#ʨڋIO|ZȐD JxcOӭv*L dԿbjLD.OoM58>IRmCjj: iw `SEZ|>Q5 JnN.] Ds1qMK0cMU5Vg1=U.W=L;G5> 2[~Ux754)䦆y2|2x΀`?%O:XB@K/qOg:G?H\~ . IKY姤IQ(+0,*cn(<pm\VN*Zz,}\tTk"6)&Gxm;R=k* RG_?!_ק뎔;vT%55SU --L < <<G i ۟xkl|g"1y٠Qfb*:<`AURԱyn}w -ICR"|Ɗ~ϳ_>#5<#=5T֕ZwmP1$*~nly,mTU3@W,fY@d乼M6jxR}%>=8t>JަIDjƦo(1ԋ%mnL2& @Jʺ3j/bc-m+6-[YKӢ.#-8X_'I*[D"*=qG m?Fj1A 8hĵ<XJZJ]n%H凌}]/چ-">\q^5걮[RFZjPCFe8jUe:ԯ1jz\|3Ly#Jjyj [=|qRNGʟVT!0޹pXm@f#Y$ i4&#)"}2)]T651Rb%NM59jT%6yu*[9T P;h898Z>&WQZ׮8P=e$&ȼM=jM1QE#~$[{Q[UOGAS]u SYQ&6i.i ,ҊI" e2z1ۗd\۸Z*k3EL'y$A rY @}c;SO᪨A"x#)JM%Es&&Ioc@z_[HNڿCɨe->nWZh={.(dJ r%]DF!$X8}kR }s&pA$m$r7I ނ@`Occ#L֡-X\7{AA:}3*OsKN^e<[aLx0AhKAfFv'HvyO*euң/_y]$F >C??ւ u8afA"~H-$"}C{zmȪ98#?YOJ\qQUM5%%SH$VH6R] kK'dPT#ף2h*q|~͙y,SꪺwjSR VG4jt[8ick[WmRd4?~FrG8ً"C\sMaYS^ǟZs=zObU"--\%]D@:`$)Mʒ?cHKUYsWJ3P47~΢U,"IUfҷ8;'fU(PO$6XD,J3:.n`mVʹ+z7zVԖ#`ϠpUm\TY ^h/jy%PeH7<.O;[^d7om=˶1YH'۱RQdw!#xq^o=vZngrIVWy5#aUpnlޗO*iQ_*zk?}ON|G24HXa'DBUP0e-qPbh;5@=~/p&*4yl}e5F>( >*yA2BI#391[4]В\u3v=!N氒}I$TW|F'gCv>=םm݋m3xZIsk 5i+1,*2 9z2*U;s!JfclSCڵ^Z UtUz]mXY!_h=pۧKxԙbpbԍO K^ٿq0ٚK1MG% ;65;DhPhT][XV.N%3;獊(ZiOЎOMW)z1>SIr3G$mʼq h/B̽vXO/f[g3e d '֠6ܨ*}6Y̑IƦ^ WC+*",. ,]s؇Wzzi2a @.@ ?}GBjci!TNSpGЂ.+K-666 T,>YlD7'w ܺ=9Sk؟vb5QI_YA'dSGL 5`p? }?Ąi?o[Ij*C%l>S>X*a_ TUES m0*ژ0SnGmIhe9ϟkkRRO5-PHgi3ܝ!#rxݞDdBcm\|BFX={|,Z05PmQOTPi#S07#?J{pyOҏjDZEZq xgKW ,} Kq;oIi*wƪx =n"I,zD<>\ܯoΐdAM5mfl&RQ r~#BVELdg4s%f3wHC;.WD{G]()Z7uR0wXieW s2?>c4s0'5OT(e*oQ%ݭѼFhpCR)"{Yo Bs?MCm|PUbpy:M"«#i#kvHFQMVr!\* 8NC>4nM HԦWWP;goq~?3Mq׽77ߛdl %fv{A{eI+$IhSe3h׭ ˛f%}<}T~υzwG ؎['/"Džd"dܒMtWa6OP7ƨf;nL?h2ON\:V}Y%l!,eTH/9y7_9s k$>D$̦:hŸ"xO1ê~goT6\% pR d,^:0ibjYT<KPǧLk1;z{O \o[ab{ʦf} @7Alu^νƞ{woj v^YZp ]M'_nUy\'\qoZo֦߳{^Z׻#íyĶ n stυLׯ{)7b@E">C")L9{*N~.E}:mɿV 5?hIju PI 17ptYb_Z֦_e Sm7F{9$ 2ǛB?i_+P}цwZ{}7]{-즶dG6?>s/u_+Ҷu^Z{߽u~׽!{ YCO39 ESEWH"PQ IFKEAeomSA"dƍN= y7~M YDk}oXj)⩏2]H$n$Ђ Anكn]\Ⳙ٣3FZ)A(I2LF#76m5'xЀ;IQ{}+sjL zOU}=N kKFG^_Y`W(jj_emSԛl8\]{7T4Du(2zwP.xG#c_ #O=,D>(?/Iک1uՏ4tUXzXdA#}W2 K}M@ ><;om/w-^\^ɇoRc ;]f/`ebM;czvoS,g(• 421{j?tWku6`x禆LjR5]|K!GI1G_=7>WsOV+83h+#&*2a5Ja4e NEYPThstm[eSQiRAtScyސͷv*6f?WMCWGQ51<>VPH"8XHiǰ3={:M]UQ2VdXWyc [%>f{%YLȕRRuQZ0фNjߧNJ/:G?i[+ a㤨TkM] "iWPO>c}_n){֣2vu+E,aԖ$) {8!oy Z?3VHR<]P` 1DWԏYD%}ݝ?:GM<]ʕVk 3m Tߴ{J37^JGyyL5i,r4Yd,ڄ{] Yeq@)qU"@8H( !>9Ou=!涮sPUA59_+IPD*i,-k)RFͅ -ȴ b) 6O  ܞteYزўAYJׄ;z`PfJԮ~5BEIphY$[T"ōk}?*;r'_Y_cC {g)Ǯ>/&cSy#h }sAeFC"eMT&O^=&aXT֣Ν%,sbf\$rOOKZ-/8EbňGa7doNCb ?UQf4ՐI=m2U꧝sU 6p0(ɴ[I gdt#EEhkO>eHIq^6NV,2A'HE S6c:A+rW}}YݛLN۔XS':XJ".JE¯ԩ.uiwo7G{)R uqt|TˆiH=:{SUT!xT1  NJP 믒J=&y*#u5]nOMt?u[wx.=fU Ƣ6("*4 SE5/xv(,sŽ7<{֋|)QԐ,ʅЋĖX9dk޼ I7ySS㬸:јF4!縸y"=HSŊՅXkW ]. G_NFcǹsil5MR`',w5-e,̦}9c2dU*#PL*塤u@fP"33SV^3kX6Lk L+@Edu3]N( h8 *=~޵o#vwrjvB +X+w% $uA#jHHFui uvI39VQ%MtHH.>ՐZ3EԎ^0 ℕ>T?EYn[-@ۑ=ilN~EY\GOGx="E#=2@ $ֆҵvg*p۪e3e/Ubdy \r6,T2{Q>A,YBCEP8r.q[gjvlߐ8骞#dfS/ SxJV\fAᛃsR %$U*c"WMPH%ec>Lo KYY=58(h4:ogQpɤIGOϥƬnz ^R2R&3/Ƽ%EM<2AM cҹdUR<]eӝݹ*I{-f^C1B;BiiZʶXWHLŃe^g|WMč"ևiO*ge,w *WJ۲Nd,9}l-OULQĈƯƢTy>Oi6gTW ͝g-;Rb+FpQDgzVHIz/w )YLUڵ_F܈:$|IӮ{ւc|L|,#4h.ҭGamr@MRymMܵpGhsѢQe"eFZ Gk l.|i4r`s6S<ƕ8=?u.zeyTKBЦJH%;ĚPTRH{dۇ;yMK,5c%Eq ?g&H4Tx%bwݒhaFgģQ6h^8ػ,l;Y@,O|qFRcIP%I4EMLաA#v^ZjTf]&Fdg%ICq:J2\5WBЂFxK ov$GZzyZZ ȲIL#K qܻh抭u礑KF[B/$-mdSV CA?>xgެ=-.W㟆|q=BIdR?r=ʣXs0?׽?UKi-2ҾRg{{:Ho?jMGQpz5]W/}MXNot[\:/O{&Daō },*P#{,=W6(=_ՙ$HR܁>+V@|c\fo7T͟{d{)sGuRg\Zo|, { <<}o0`2{+ګ![l~z\]6\"FPh />{Ms^DvWxH @BrMkuw{nL\pYU#S +Es[gpdQcr!,tr@h\;#W 2E>|XJzz<ڏ226-FܭFA]}ӵꠧH$_즶(~rm43jvi\1SM'QRkbPT?ŜpA!wT`֚ 1>[^(vZw>['2[pd6O\o0l¬mn*9XU,I,bwK݊9X^Sm_S&/FPO+NAbڎgW^޾;nә`u)Vs+0ȀH["}}/#+=+i4WQ}DGe+ŌwVvRƯdxԕhkCof~EpvVo|d{[~ڝ}:-U3LKS[K-uX,ǎb%ݓ;hcks,{[t 7yLeZUGXVH=xbc˨eۮ䷖LEj*\:*CswMA<*X btAf'tafۛ{'9a U&V۩#bAn=SABdE=8G ue(:aSS\%"6#iY]p5Z9$X*&+rKi+_iؚff Ek m؛zyO;*Ex^YZLPAh헊ofmoWOj>bT󯮆Bh~֑\291h\}M;m9-h8e/nI^mlFc 2PBiSeno3㧛ԙnEXZgquWLjjE,P"e&&W]MQ휆ݐ-7kae8AVĩ5NN̾uwЫ]Š8wx %ei=6bM~`Z9!Ԡ hCSPSlL^fw?Ud6Nw#w^O1Yh&JCA*B^*8:Yϱ>>._9]؊"gde\TS*IRO󾵞,0nW%%+ *XuWRA'q$!@K#Wһ'{]؝)deݸLv*NQWIhJx&ׅo9 K._WUdz֢՘8*k-VJyc'J͞U+_+a,0v:f'JXQ-ok[b1h^ue*AZ1zhkHISQUSȫ+i'-mcPFZ|#Jdՠ]d@YJG. N rQ:p^h ir5m4 Y&1heQ F*mԷH *mViR0j*DeMuSq6ۉHᢐʆ`h+ ~-UC)jUMIMYRdMKK$-K,Rh,/o?aޘ Ç|mF3nby}ꢥ]UB&xUh~Sw5o"EYi+XtYephv+F#8$+o*AbAJzxf%O_FkUhƨ]u+!xqb{:ϐ퉃믐gU.{W5n+]OWMxDtmb%^Q1['.s.jOcp){nbft=6e؈a"ZtimU Exm;JN]ɹzkճ}mᖪﺬ4roJ*zֽFVA[B)j)=Hl?2.h~** )rγ]\^`hb5yke7HRŒKHڗJ{m 1M#$K1Z*ׇ@[hn7Fg6?U>)sfy'p(T:k_opbvtŵw:6Ж.ĞmI#T%QRad#W>卟{-wM -$-Jts70~Hi-VBH`D'mɇ5[2:-C<w0l٫ܪVA$;ڷ (g9`d[룩ܘ|ۓtje *y$jy$zkesਫ6&6QlƱ#YdA@}A|4+jPTP/%YLj ܫ!ޯ hW? `º$r_B=)k Ͳ%7q:!SPɩu2A^ޢo,{'c, ;j WhQ#+Q!H kҾEv}F*ufSka >ݏ%9\4*prMKZ㍥(첦J\)}}}A.`xqG#T$HJe@5T7X1+9%fheUaQAC^=;asyL~qpV2cmʡ܉S+e#TJ-pl|Zӱ6OѶFpm>,TNWҭO 4ZȺd&09'kG2CwDSԉC ֪@yH+VK721i#x$m\c:2VaW-[n}++]0y.B ƱK8፭{6%3}=Knmüzcۂ]̔KmUC }T< ɫУ(O$?wM6%EfXN@S4f3JR:0/EJ.CIFX,j i (3Pz{v+sEUY1[gI),&K3S 0Ҷ1U\rIu :vGp<_kc➢)fnudU tLKx\ۢ;?iK4v7ۄ(̡jdCƽI h$Jt[knV BϤ*wPhjTH t4m:N mşYlTd|~.lZE5ۆ沙J Q*iaʟL;oV&={.y"[}l7^U t>fS` s<}SW ~+O׽̊3Sx{_)T5n={}M۟MA˯h)JهnLNܪb|$UHE[TnLJT*NZX Q,LlƄ4]4jIUTMP;@J㭦o8!ʦ˲QfmX&d]rȄ8}uKBDfNoAZU2_t.[ZPO[J q5ڪ: [6_Bj^MCO6l tT)ȄCv ~ǭqU-6eS+YjC7rEY<×[vd H)1ƕW=N\]LT%V( |XBu8؀K&ĄqmζtTVfmY暋@8jj9eq6O ڪ!ΚFxѴ͊kN4+鞖xڸ+J سBI5Xk@_4IM;K=UȚ+q򖖢dF&qS}mX}ψۑWr2O-}TQh$4W Tg#MPMNzP]QtS1ù9Xi枑)8SIjKqkgL mmjϚS:J)I]2TV,5aokwn [ڼAT? yzi}zQN05jij\1BZ(LKP- dk_޻?/&K_qLD~H d侶]FY@G [xb([s ,}&2LߣxbLdz t?@l.@'/_Oy9!${10C^( Of>^bE:F- 'N'׽H }z|``4m<9?>grhq ŽFI_K/8bRe$؎Mݴ|\=EI?ͿIzrW/L]{|Ɯ_l:{9!m c ^:veݧYPWtSf=cFMm`pqYLx(.ڬ൬/o}qFRC|^"F_Qw uĬG5HPHA ߛ_I<\̴;iE΃,q,V*׹͂{% ~&J:M"uYq?#s8R=PCS@##H6bmc!=7A$]J!U! _wGGA-C  c lIGۋeh?NH0#Q?}8cG*HZz*EL+D%,B兠C1^0iO]ssXOhJ,q:-76b J|z@d]w[t)9J[*"?$o۱<Ԛ zO[TGGWvX>O?Ԝ{tFz}k>ۛG}Q(1"QHjd*af9>+էV#}scv[˸QC(ёOCXiHY֞*9z{회Czw}ۍі Y<ًI>:)hCB 'tL|ǁo,PjK<1&?EWU!>0,qy-7G:;>ab,B5 JX 'HJ yjEoGm޺흷7'\-ݽ0ݼ'_#V ,A @ex"e#N\^G%; -obwFgT];;Ʋ5tO L2-$sޙVsjӣCRŠ%D[MG HiuT`{$֢8YEBlͥzۯ~>jII6| 5~?xvrMeF }M&RZTaQ;{|v^vGC6WImmV;Jpk[%=Qn,Y~r[&0FE/n,Dř rxa2JҠQʺwS?8_u=}Ք흇;_y|w~)GƸ+Zo(O!eΛOU=[_w퍩rY)7M7}m 2mJM$RE QIQ"¦U:?z99Zɐ")m$U-qK,-]K2kѧ0mW[|4< dGfo ˰?ickjfm,Ϊ}ǹ7l|5E2c5u(˫ ͣCwHqU0Yeh&Xsy-743!DP5IJq9:ɌQ$ 48A/^yWOȒ Z[ %^(iki⚎)a`ѶSGb#J40^ V*(!_ەu66Sry{A2B̿ytќ|˩}f]qvJESGUc)i5F. ?{?kvڤ u7gK15D:ÍN~ڠdaY"HHҋv|HnjĘL=,[uW+Ϝ0\=RLl L5 GE?UwϑcQO$M 9x6+3[VۥK<@H έs7to*9~#E$Y`VCaMՇgym>emvW'VQt$T.iR+ԥw|;r~ ۶vT+cmzJ|dTLVUHЊJY4xo{l}]_J5]Gz}ͼ8@5?[|5M }X)[>C/t"&'!@I$T?Qd,U 8s;9*p41OIHwN]ą7ݞAx^c0x?gW^jʓ+]{A{t㪪)*([$lsܔaQ #OӐξ,`~U pVG>P|C.1fpj4=w/_Ɵ%u=z%D$97%7mڿ¶mN fz:z:l># 2:\n]Ԝ*yhO4y_ܤ0,XtrƢ:-xNu@iFuGsËo>ۛ?_)ݱm7DI,cQOSuKbB#HOn/WO#{35GHZ[a"5W}@Jn,xAϽD;Ѿgd?iJ_{w)#{W_Uck|n+}bzJSn]D/uO3Y-YR9o}rֽ{߾O>׵u}O"?ߺ׽*9m<~ں1kxz94`ǯ{j@Oo4~Eztxk6З}ckک2B a\rIR,XJ}7jW?CoJo׽ͫknNOlӨXO+m^WӬU{{uﻛ};*8׽_ÏSl_;-Sj!0*?)C0RḊJ@nG.JrqwRv23\k EnoFo RCRuE*協R pgoىxw/_ FFy,yc,S=XPѽUjG0E8WE{vZ*3yjE}5vT,#K2ӺP$Ur25,w>ښ j!Sm2\]LC+U$T/q!V%ޢڂeQ1ԫQzMIRXAƓ\2.,D_ pii*hed7 R$DBG FoWilߵ|0S6VO n0v# :nBf9Bc7ֆ &꛺) k@z|dcۻBnmDhae0 ⶖHY*x9tV_POuȺ=ٝw;I++wRddy sQV`0ԩYJ $;.5:mOR~2+FHSLقGZ ,+H< #̑to>vV<ZzjW@SA |Wpnxq8jȩ7_䎪cB#e7 0_M-s~ ݪAYRA"#G76 j1A\ pi A R4S,0&kG$Fٰڭ7 )Hi2Qi)k%g@#.$#[{+ym+ бtޙC2LVJMgVKSEF$+ [KnZ 7뭉ٟb,4R3eZ}ǹid3l%,S%n\wSU6҆\f#.ADc8fݪ:d`XQ`Xffl73nVB54Á*#HaCrAᏳ OK=:Ȭ4e7v&jOI4wZl>Ի: _irE|\cM^9"T%mryge ^ ~ץQP4w|&ۣە*NU9!^[ O7g241%m8CCASElNZIX+Jo#j0S]HX<8#07Pvvڛ3Z:/Gq-U5BZf9J<2SK=_axʩ?{1v.l+ܚ v 0C3 IeiHj蒠U yWSZw*}[GB(kr9*\2qG)&o<&"e­[@;йG.!m5U >Goͯ%Nqׅ8['1ulj oOY)fQNJR72%="+O d)i)k1XJ&C+WNEJJ ̥l,!Fe7Y+J2JЂ@Υ륫Qճ>^Os-f}J<Ԕխ RO#)R4QZ)S}eq..!f_t}^/%]$iP7r A5DK2?R˚He$8bL.6IT8S^*F5{Nfr1NypU8RASTЗeI`RVVduV8ܴY%7MI*+d&K uSJdxIU dXJIO&UAY4@TjaJ<+L;t./$N~U].mϿ+q]`X2OV~ MZBxXͣz)qcvT4!|^ت0VHʶd,pXܳJH28d!MAaJVT͵MJApW'uð?V1=SX'U};%Q2Qfj6J <8o$wV׏e;ve`jE{ mɘ @8j榤8ʯWPmw+>T=zuWnJ T8U"] IB^][SšӄjEROUWMK\FW {dK RHMHn4Jn.;y=DPR};>اb58 "|O4VvfQb< }3[Vh[<*7:*OUuTbdZRgo"1O@ˏnR[&P+FO[^?A[ZkDzH¢HT s:r9EN(`kԻoR1AXem[vkHdv, 9>^2io~.ԔĐJ ґuA`凤_OPlϼw&=a SE ѽ)3 ڹ#YR4ZW(!aV}J5&J8`2>E$֕8{,kP8}t* I$e Qܘ76ݥ0TzöT[V2:BK;=J#`E%WQUv(Fu*SR`2;?vm&#wf#]b޺і)YЪ0x;ēdK|F8YV (P1 6 5e[yVM9J)rutAN*]}}<; X $X 5rDyl|̗s\4KjtӤ|4r+C@/rYA=O~gk܎`[[~AYc'LbduûPu?CN*-C9zMhàU3U+ꤿ݉B_#4u.4\v6R Y[ӹcRO[%. [Ƣ+N,4ZWgw&oJP>AT;1"HT,#Ԉl5;k͹K=R|,9H3f "Jȡ1*^C.ỷigf6HgUH)֡ %q$Lx%#QǕp(_PɱsxO&8 -WO[9i9.H7ܽb Kt0C]n,z<NW=O;3[h1RM⢊4QG #_]q9 lgIULh@]IƩ$?m m-{cpMB [z?h]||Nk ,{Un[AFj $Qx>G+r>en?~嫶N3[!Y x`}SK>(,TY&tqv<=ܽ8+ Q r3u Fu}TniBZ <!I#䠨]Q&s|PT'Tݙf5)4GtАvUΞ+{/ ؛^~f!l<&*&hryirq!$VF;~g6յ"[hkXۻ,Qu9b.RIc.'^< {9[1G?f1[s)w~SIFsr iY):dWuk=茯`බ]PQvVnWzw6WpaG%722PG4%Xʰ۔6ۗJ{emGJGFZ"9Z证y [VT:V:p$(s@]+~v-V܋m|Tl:mTb/^9]˷?G#}ݘ 9[nU6EIb*Ɗ)JL kk`ZH-+O) xTiB Mtz&{C j`q 0 |2l.d*ȜFlZMzՙ="fm+:[7)(I$tqn: 6ov vv2-DZfƊϺ6 DJy"dF`t{ǹEkmKI[ǐ#TH(BJrkn.T7ԏfuk$=+J+QAzEz/|Zٷ1Ym_Ga'b6qenH#OI m$STIe+E*և}mS{L\STz :ٙۇ|O`VTȵtnmlM4Ĭu3+}em MN&YxK-e]#LJʪڼ~ I,$PdM6Uv%-۳Ngeǥln:k>*|yO4P!BTG؟ zs2ֲ*OI.v^.)8\ԒLaywͿ|/uö mxIW?P.aƭE :vmIS4< n"ՃUA GD-]!Evɿ=wlzl:βˊ+rQQslS[W QLO6Z#e#qo \{~0r'yȢ'cr$xzNjaCGeEkgw;s幵2 *HFP,09eB CnnRf6F> B;qBH J> k.OU pO6h_!1UTFh< t@9%>B|mn󻺇z}/6N^64Rd.-V U hFfJ%IikiՆxwK]_ )2"̤YZ5f)PGbm0fO;٘wM.wd%,y: *uH1eH#~X!BS̓1Tg:VޖlFzxRw8ZqzQ#2#pQ9d]nH v7;w#}znͺ]IaR$cAVP xݍ)Nxw6D"Zv !",ScfS)@ ;,hI?a;hoTc>/S6݅K6k;Х"Jq![^CL7cv6P C@t$d&9p"iq cb EusE cj \5uiUL{EO`Ms,26&_%TiLuq]_W5 MCTRЭ6N7%|SƇpȩ1BP'GORm n r8, z;J6Gy<h5_Pm`>nM\slr_@:X$I?`Il9J{v۷HekuU^*G@n^Y97Nsig6nj1JWhuY)FF ݑCrMIum>QFbtwKd2uL̮?wi={&A.U$ql3c P /&=xmcT,bR: +6#}e3_t6#vn\níb\f.=0Y:c1TVdOZ)tym+:wnVf|>[[UM$r[_===Z,W)ʑYwR}޶ ]Ihn^%bHD"hPvrT'rͼEW@%]15YGz>m|nw<皗qWEWJ*y%אuKWZOo.^kp O K%]4 ,IKM4PԲX>gBw;?+ȓZg1ˠ1 cc" ӡ)4[MCm̬rjgYԧh+(zSP)jaq4MOu49L?諟ԺR@FYg~_ݙe=/CQѹhvvZp4 7G \Z?DUHI!*{w6{!s%; C[:EuMj%I1U$g0o.Lu)"͐7GS4'Z'7)f+[;Y񈒊XNvM챝DZy3USJУ$?MLu0 (A^Na'j;*dvp]GVGm̱dZa_*SxQK!Vb!}mX$2 "mZۤ@(]]2"<NXK c"!}ASU]b*j*pPjp%]/>sL&GBrJRV@hǷI떾r\[.ڏтj |9dQ\ CǞBʛn yoeӠ]ڧE4vC2`>Ms!~U]O~Ow|m~ۯ{$ [/r׽yoJ{xMC>={ߣb^u5R={$^ē~G {tM'={)/sk_ X1٘ԁ׼ZoہzHj-{4(:<.-`ATj5^"?1W5oF=9zu|m[cҮ>z)LɌav%GPKYoʛIbVG+*@89 QP׭zw/_XL}m^"uMUHԵ\S+F|x]&IT6)}I-T3F4BVUURKCJ0-b=<;]qCƠ+:y>][2 *VH 1N pQmـe1_4ﴫjz@JW, HLJ+B]B a=-!XIJѬR ?i&dYEr<=) z饗k?eWXl&D"iV)%I6i@@Avd Z&aM@|Tt 8Z!4iKZ]х$uEF[$"کv;fj1sYV l8\p fS]2BDCiu_:3+#>W?aL^~m쪆4[Ҕ,԰MJ2BY dkwvnjeUbҜ;aun u+awje$ fbG$i_ MP0B{-KvPTA2 DyaHRTje@:${\ KpGʝSu&d-9YjlGP|KˢKX}η=d|5+R4[ 4:qxX-J58*ILg*SG `IA VQY IBp]Hci#R ~]nP/>],3ˡAKH#ѸXA#PuYOo`M%N饡M.VV$a]ׁÖl>ݯViZdj5M<3D T*d)dc% oqQ G%Yi"͈]몝S зmE^:LZx=(+}/hRiKPD]dzy:MNhi3pPHUÁ\#[0daIWPu!Ke[c]>T:|:~zyED oQ*j@+|nl`7*lajOCSlalg2T}ed^兵}[WQHP9g_>?-uV?v[VT/`OP6ReO<~wfܭE]D,|)@٭\Kr. \0=Wq;p= $k,Jy0<3Z6m9FJ0t*~]sgyWY=W_y(>L]U(5a*.X-=ir´=YcBJʭcK=m:{߳I?PM0F?5)""A* qɰRP$J_IwuoTHY {]e,Q#Nt"F}Ĉ-L%FG\:>۹qSJ*8*e3-=ky߬l\)GcY0H EOl}3]^1C? ;{I_;jj*:)lD,O{/fP>|굼 :f2H PS;1}?}K;yCD.tHKOSuS/*$6y {? j{ OݥpWfbpEUn]1R YC$RmU|*xa.BRa-P`Ϙ7=qzۢܟL  )9)_,ף>BP?}[x$-ٸJjo0STUhV7X,r|ʬuG?u..۟;tO?I@*Pd +xU44ѯ?!w=ۯ6833(@YMJY`h$2baiN# KB~Eଙ pѯQ쭯os97@Bʣ;}0" yVJx!%֚ Ϳ[a3۵|#$q' _/]~ß=D{gj+ϪV*U$ynq5fWX䏵65jWU%5F_j:b/7!$PG@G"s  \)uȵHԒ4u3Bˆ%%(@ !)n'WB*Nx|O'qՔtJSTl<Oj<ڹ+nx\7AOKYbdXeJ:( ؃k[>EcA@2Q??~޽(< 4Ќh`YY&zI<Ɛ8?IN*Χ~}uq}ÏrvV#+ 2 W}2S3徚C5'M{NcU[!OסM'N*Dx x,bWeO᛿jU*D[BCM)cV2Rͨq;kYgeo+ 25)^>:_,KAO>bc:l;u:i'5{~ZeBA (#y+e˻%E'ףw{8`Cؿ)@I=/~gU~{֢1TtvYjlj DT D"DDmg|~SNi i(]#*Y7?UϠ:pK/Nyg$G e'OIm*Gb$U†buΥ2{~}jZu, JYce&I#YR,NT*&zzzG*Y$'+J["9mkq릕C7Յ{.!7ewV ܽkۘ}-%N\]:kJ "PR8[ov B;%xT"PM VU3\֕45_Z?Л33q=ɷ7{7ZVbom ="u(ks]K0dn?.7;y nΥ.ۡLMV&q G]rO_SCU422&ӱlS7HKjąi WD(O=?¾ߏ[;j{6ˢywYMNj6&,--4ѣC.\ s`]Ɣڛ%zTN76[},-ǹܭjH%w}:E)|-s6R:*+i<=ci9}K`lG@OW%m.o]u F H[/^\.$~ -'lozv^C7:f7?}~xT:SE ?*rr9?OvVI??^T{X=OcP5Qï{m oĎX/~]{Rn@rX-{$udH fH^y#ocaslG${OYիw#>3]n 즶d͜{"ӨX=+oV랽X׽ߺ^~{߽uy]M`My[{pPUQ[B2:~rBncE-^>%*M3-Tq8ZD)[ ͻKP5`>?h)}ẖѤP-&{z,HѴQT4N$Fj@. [G~!u_tEXN=EFJjEU)zHi娅 anU& h E-imcaw'YUlYjsqKck"+PRQZuX˴aoFGjqpnű10$Ep:EIH0,s[x8dA5>By $I(lS]G/Fcr6&f$5b=S״QejXƲ&y %*8G TW_]L1K+s{γJRQ9)+rxZ'H0#*2Iap6ۗyP @+SSyt{+6s*ZK"頫gqnSqu=cT \Pnex ;Mdh^ei#r צ[Mvԟ/Ņ3MʗL-to%"czd1 n{-R`֬)]ZhMM(:_*UC@fqcף[7h-VTEIj`*9(P׶36 \UM]ڲcPa2Xu5YRCr]W&뚯Y7ڤW䠦cePb6EWG L4Y='K>`uXĢV` @ P0: "]6h§, 'mn[ [Aaɤh kvHj]Y=<}{^tcs2n,=Ʌ4tl UUM53R) 1ڞ]&{VАWP̥T7e th"%eƒit{lmC7U$R'!]qEHM>ߔi}Wʼn1 pe_G@Fi%w2BZALNs;Ljm 4:I+AqãL, P sХ{qn9wRcUR(aqU\BfE"${4m?8l-^&ݼz/w/PɏMUYxqUuvW$aq{57=ljQ(“vF3*БLꕼN q?>cvN(n*d`D Wƺ$XA$O۠ݏ}͙GT,Y頗#SU%?pыI4Ohٽ.CquM.UY Uth m\*G` dcoU#RyR[ѝa籴{ncX`rVbz@QAxWI* iRI Tՠwj_b57i}GWG*_ > g>uYxgͤ`]y{e!A.%OOB Ѭ\ȷUNol헯i18 Ft]RhICd+k{Hko$桥Pj:u >tz.lRr(?ꯗK]۽W%I2p+*IUO3]f(m i/`A~dmNl>R5UkQM.KtI_U\h ;Xb  )%] DR++J]&AP^]N?LynNĩcW+d$j8uT.qa=Kb"mȴXHx D2U4FrFLv n4("*XI z2D0]OLiSӇ2V1Eh<**Qk50UM7}6*]RmQKm쮴t5tUB r*rBE% 5fA Ux5?.5 OtTC*hF_mS%EE6I)hHKJHR ؁:18)nj >R˷42avE:jHVxe8fXj0+(>tIC# cZQkH**Q6$t'5 A$o}]ו[#G6U}eƸɊ}UӸIx!Q:.pQüɷxd0Hji)J5{eč8F?*Ӆ M:~o&$tkMn=M{ :uUgwOOKMGǪŮkJ w1_lazE;헬mjʝg!+Vd2W TS3T cuax*NsAwI VۋbOpTPPSViB o#@Q=ΠF}+ƇGE{d;ڝxhv+Gdu^IϖkﴬϭDՑSENDB:4q_띯ǶmzΣ -uF&<8soeM4w&V$BN`Gz^b{y--<rM"7@J SQڠ5"[$r,@rC_ p}JJ9ݹЮܝvY-GX5G(*WQu@~m[Z B{; b~MSAr*Oږ<:]Y%1p-熚g Q]{u@SRV 7`i!of٫D$(RQ!v_jE>ɏjbWUz]U9fBZ)[ ~5M 4ṞJFi݊u?/w]+iuE/jvfyU޸lq`vUSɅh0U$q ᧞#Vf c{1%v6溻{n9m'xxHc!\`S+أ L U%J56T͂"w7Wf;{aGsy)qzۂW)]6W#PCk8yk%:AۿS7GUO\$ٯ%^I_ -U$M)Ta'")ݝu'+KM]ܬrΓ,3 '04($nc] rnJ2J)$*IcF O⎆Z,%v%M)Rd:4KFեQc[Y[/?ꩳXto|[jv-6whKI*$NЉ%ϲ9гƏko,qfqjH@p@nW\ѹ؉Ehn'h&^5 "Ƞ^vDԘ**L&e]F4(Y3+{w?LL_ n=GKOT}2Xk4N e"T31nV1-}*ı)L L*L P/<;vWSFE*|#gæ59~Nv6f}y>™&2m\E}n,:ҕ]%NT_'I+*Rh);qoahJS{&~J0GHY /ݫw.\,R fjn.@u*aD4-WebcFj* n[\F ,v*51w_I=VjL݃kvعuHZ=gd1[:+iMLk]41ıjtY"3 6XW䒫5&hQ$Ot' k|s[M°hY/Ёz!IDht?]j2y ݦYҽv hbzP7 ٤7*ME{R] uXSSLUZ‚@ tsuЧ k)T5{D .ן!)*rSIyWR&юGJ <3$*bx$~A~n l~RZܖvvoH0ٓSmZ QacR4ueYL[-%llbR$VL uYJӤ@uK3pD1-,/3"2Z=d^ @Q4{Rw"8 IY_$$bo(z7_;j\W_wnk4w?^<1v> 5dT"g R0ߺfZm߼v78 ׷|Av)Bxgt2b_4 5Ta;hUӏ 'Q*XTHSǶ=H[nvFgd{;uoLա(wgR2IQ4ljzw) xK5 Dp4Q ԬF7 wߵYm..qe5Ɩ Y^vlwZhY`Ix4!r ^5,馥8Sp`;Ovn: H)Wi*|oVӕ-?BFa?3iA:?32٦tȥE5!OM 3dJ& iYRggL iHK#tbB덻|ݼ\ ل8 sṒ 5Tm3M{ vMGS3PO\m:Z+ *X? sxPFYD[sTzyim.e7чmO24q6WcFI\L\&xs߭ޞ +)XIai>b30ha}&bWnAԹx0d2Fٵʈd H_e[b}߭6=J}CTR"JAS]'3`!LP *E{I:Cc-FK1݇IUШvvpJddV7%Ӭg۬ۛ^SW[ۛwbp(j)t8,ԬJ/RO_r.ӼMkFZ  ibGsEF\k|ҒӃ#IX1%6SR >S6-nSsn,dLC`ʍ\Rd3;@fudi$)Y?",V~ʈad6E0|CE0[? >y9c'<4ƣRq{ùN9Nk>[9#kYXpRH""H4{(wc)I @CēR3iƝ Y acro@EcrXjl߯:4A1LhȎvN])! qXMe+Mde+[D,DCww3Ie8IYf>$`jy*J%L ڴ`Ͷ"YH̾$TT("|xv-kkj+#W&>d(D7 >[&ߝO_9Qj%i%fFbHbpEǾ{v&/mmSF-(aFp1){U#LRup$[[ ov_+e_;yU=Wzۯ{8 y$}{TUU7`m+ůfUoMǯ{\RtӋ{i@UERi׽sck<굔p,S9QAպ_uzC{N]kΝ{P? Iyu|I% ,-ff\dX;zQ n~b}_ol*&1#_P6!x^{Mxuz5~t4 >ݠӪҍ+_+׽8ێqVF:%~,KQӑCG:vZX(˹ و5*e`NiA<:Y*|&'3T lϰԉ:]KpTi">-$#'Z*YqPbP UfϏTs;z5Tq-˴]t;1ys}FN檆Fγc3o+:jTX+stب.c۽E5x7 hŽMfM62搏̱,uR RU9 ܳF= =ݤň Wci\Y/,kmѭ$Jŝp?*P g5lf2 ݘIcVy S՚Y!1ʹN/$gr&TD͋)u XYvoe-HY0r _c'CD4KKDC,L$g)BŸ#?O}Ã3[C-< 0%5CENiGM,35PTI$dVVo` U_U$Q_VnG3L%zӺcci#&YnI`@ X{{[9'{C3t U!&[qaaϵuT`Z*#xYKk֤Sϥx^Q97aAT=H}8.'; 3e)jpyv=S΁kc4RI͇c(|(̸eb?KUfw7Dk1 s}4sTm+Y׏bPB71SVaBNJ v{Kj_d;N!8:ϟ:j͊wgJSV-  Yϱ͓aaSTZ "sW ?ݼye!Vix]zDzB 1 «+*fi0Oy)Xl%/L"7GO%Mⲹ|(1X,.1Y|}:y_\,eo]4`&`N|K&==ْc1ųQ} rU4 ,VNC: ܐl ֏e2r‘ }hGuOšF~?iE^ Ijb9D(ԪշGxַbBW)N S{s Pϯ{̡pGQGת ]{ܕ76WխPK"^TPr W+CQNP}{br>60øӯ ^&PSb?bO쓟G'uYП;yf??w^n~JnUԬ|OT@QqUcblǂ}?$#O:([y$ޜ0ȵ3O x>W\[T > [bxkOf{9PUBפ::5+vv})<(< ƾ`t޸*&Rm%ZH⿚om[ 6&/AS𩘆&f]!H$#AQys8Tj\TJ)VOC+^o_C?O/y{j̆˴c^es]j^^XRdTUQ {(k㒳w`옜\1M=*TIQ$Hgt^:m^Y_Owh3F8Rhx59IEg1 GS]C;֪8en CO0WQ.:*ɣEj5wd=Խs}cޱSbl]ё=^,PRպY"IUM#y}w ]I%ABfLq@ h=HrP0?*kE;G|ud )UHFwtlDӤu2E5|8uuC2iEUuTa6ABJi 0(1'}^s^hIh̑֎ekCH0C3PFRsqGWWբ'/#{[uv6xa#:hvW}氺ՆQ^# +J+&NYu67*la&E:_O6$O`jLIQ$˓`M938;lߟf1 64t̯<]|ew|,4M-\5us^O>$c$jYfY(t wHJ}O }c5{ 7 $X5,:3iA k(IuU)$\i2@^ߎ?آ9O6jB$42-A8&2!cp ϞBAji Dq.*I,Wxټn;s1Ό*qҺWCP{nf'W:SsUgc*i TuIR L4d$lz?ԋ ?_uD)4b-5f-$BZH$, f,]ܵ[G?2 z]\u@!OHџtSV?ֿR^? 1ݧS՝w)ژ͋_7b-)mlj:-,N"2hw/[ZsU>N@9ǧUž]/okwl]w`mλr,A#&R9L+mf:gwnJxZpo(h6^ҧ#wx7PPml DiYSXRqN?gΜ-r;קf#4"x얠4S'YGVCP)Dl"Td>~{7z|u>휎U;ٜn_bR!&2LEESKM)dYgbf) hBbF 4NGpB W: C?5f.eeV2R3x/8͘B݉ *̞jGڹ:^/L"?߫ZXR#h Rl+_"3GKWNjsz:T'-9vWȷg]4=EV\7=N}{ey\2 ݪJzXVe$uxeBJywۯ.6,.Y\MY q5^-'>tù;d\T?v%KQ#KOe2PޔGפbםAE(۟g*K㰲5c,/m*$K*b mX*Avl//nyPV}`~,5N:!fY|q['5ٚ$E frjvie !K(RP3w&;C6Ue$9ܭ+QRNjGH3 r( {xmJO RkBզ=>c:No-`l)[5[?%RU&{ .I j7=venJI8QB,*:L;$,ꊆRS"xikomֲFi:ˊT,Eb&kâݺ蔨&:O .Wm&`}Bji.BJb_#x/Q]#lEH/#2+09M=ɂ9Gjg5'pONaYd[vZΧ-vhk[ԲI+ h."GQ݇;#YOK5ery,~ގavITFѨ)<嫛^W28T:U>C^"c@jUEO7KVg#Gq\Fu ؁v}ܛ/3 ڙµ|d YٵY) {}ϵssX>3p?BCqrvZʿV33vDBJ̑IA(T4xGY">Su;KnPPe)+dܴ1VDK⚒tEm1ʮ3+(niŁedPj5tB֒Y >Dc1fogz*O=CCAiHyKL`@3_Whu_x\ 0骡,s* zc҃v$c6zV5QQTԎ@=VkIc힞l?>#7~ןgo7>?# u4sD&g6$De -񃷷n3]UNkSQQ_KIqRd["G,:!Q3ٗL`wxf>]YLdjПr{4?z^9̂ELf7-Spс,=, jWmb }~u~kmQUIܹ F|y!́XBʰȨG7X[jA? F+O#9fE5ncٹJLML{ iqpuy'Vx^vXMIMr#P:5/cDbiqzzG,%n ;I-(W>T:=ź J&&f} ]/6bS1i#>q%SY]E;h}-nKtmuuUy|o&44i1HȉM$twn }Gڌ1iR rE2 8|s&ʾ2W4T9dUE#O3VKGX&5"" p@P-kqݻufw ˋ3䥑jUѼZH :It>9 |T=w+*?J^ڭpuzX5u[?@{cW|€Y XW?_~Mu}^zH,)G uxq=PڈYGW ϯ{:?ν6@#OglZQ sm#){j9^^Nc_oHٟ8N81MOcfoži=K+~}􀊎^_reK7KV,~'MScXzAID$溭E/Ŭb/pp}箠7ͶlG만PPTj+_?bۼCih]3Qc^uZt޸}ڻi%5C͖g`#O H&a 6PR7\NNj|T{"'ƶǛfʭu:ŕJ,1 9cvx<ĂButKvMY7I#\y+2GEeF˟o;i~4] TK=\Mdf׏naRM{r![~Ym˔:zd: -  ctwfn]5:դѼdtxAp܏o5OI4qޕjdj >U\>;+$QRD*C%HGv? c9N{ev }Ls{_huٖpQ䝓l=]I; 2FhO(M׿h)q{1MdSmuŪxm;sbR࡫RΞt%D3h w}ztId##2:%; B4R-o@rHF+E(+PO`f1-t簹oVK@_IB xpI L릦|U6!2]3ۧtU> ,,{ ]0Re<,k1ֱa{X\mP8!**@[5s)Ob$6sv.dKfhUNN$zU.Ŝ>GNx\jF6-bᥢ%Mz1fYaIg-ֱ2.y/m-7՛{hngEvV,wVUum5:=A9z>`XoN7(bn"GQ"G2*gQn#sUu[-iȥE6.%F%]`hJ1#R]); eG=F:t˘gvDOf!I\LW4f4&_Yo=% .S O_Wۖhrò;^6e+*%Fvik,ۂ1.<3Eb^WZ ]UX0C90ѶL Ɓr)YNo.XnjȠk&+* t#+XrCUv4:M$ut)eu*h4>e b/Ql eV9jJ(R#i$Ѹ7/IA&PR8|EvN5{1}6щLy% $J`!}Ym8|fmׇu0Rn1f([hz.ڏ_}߼wm\P>h:tBuBW4KPOU?OXR8 jNq-_]ALy9}?oūܛ%aDB(3(oK)w^+gs]<~bk[l-~)XϑM_BP~:@ 1 =b!>D:UIJd廚!,Ƣ\2ՐTԧALssUݱqmԻ/lt;o;[:9!2T&ة5? 3YL_de^l[,hcX\zHVPP+x)|9c 9ZwIGX=5gułdK?h-LX\~U~Yٛ$S#Aܛf7se nS9bzL^mqǜY 8kJD(樂Vڠ ldC ӥMr@ MU2ZpvDYG bZk̀xá nzKlgUUHh=FViVJ7?ő-NNWm~Ԩ־RTE.yZ礤zs).&l=N_d[5T4ib^r@ґ0:o|i=Ŷmlg0&X>aH ֝%!ޝ]nSf=nv5-$ZxT^1JX7-OwN1{j-õAw^“MuFkFiRS) v%m on-R<$v6#Y -QjdtS{̾߇XWDդ|PH颊?Y SNb25(\eF˟[x#O+FDg@_P<^W%_QChzsCqf熒\J=(궍--Kzش}opǗ-=~:j*f$n)aI#!m^68w%4[뭳ee64хw>JUrc>K]m&`Ux1n[#D$,h$+(_m{.|ˢrHhɩҔWץfؓ-SGK; k,Nvp)PЊ*֣`XZ4eTO·h.ڮt]Moc4+-SRRv7>Xm{]?>Wz+1=.Wd^Ԡ~$__[{iԐ5U%Guy#l ܵ-oni{pmyPNY?xscǨǿ!'^a׽!G!OooU5p#_ez׽dCŽDBM{t4s_ϯhu}[U'Jo^iU\?f5s^j{aO4{ֳGNwR^<ɓȞeOQ>zZh)঎Rrf$܀MK.Y$1C}&ci?ݴy6.,- SMQ[ I4SFC>q0TlGCc'J*⥦= RRI%Sք. *FI4μz1j:39:U]T13ISI!ieSȲ%S9'~$9]a8Z-U` ` HJbmq#u?">xt4=(&Vcy"Z6A#UyhXͣظÕKNw%a:1]x*zst04ݶ.9()Ï#Fag0n!gG, d1J0!~6>Kva&d2m\&ۋJ_QG6݂dX4jmq0[nN!9IW:tqLU4'e@mwn 8GQe(Ӯ:LLqb;#FDz7[%tpnz>k7NEEIYc<z:՛E*2 UN$PIYTiE`sQ:T<8>WSEnk@OBqx%PP(&%DԔՕgKwR:2X*a.gxp/5/fn>衫8ݻqz)+nfT'I{C\C(-(QG:0O 9N1Ah槅@f'Q')ŨJ/K$sk$Ie [ ?2M83/}i(R7EzS5*E5<QlM]i&pGHpCUɽ>u ݆?TFaQ#-.=ip%^gqY&ZE,[!WY*z<r_j{,`0P*8 _ic7$d 1^?O[H7>=;1׊!)j:ZK*8-HW5< c"(RYGE{.-u:1Q<VmCJl- b5>چ(!hpҫg8KE$Tfjb#(5FevӨ-wi7CU-}bTeu7_7B_^<[5 ,Bʤ U?$$9.3+ٕ!A n 9WV:aE'f_ϻ׭uy^<}E r?[~A?t_^͠W{te ǛrT~kߴT)bGU vwYت 7e%{{=ٜGɬ;D}{ݸ1Y+jSFt?LebbY9[兇o|>?i|}󔿷r9\uds;oSPCO@ؐ:,UUM C_W\rҁP 4i`2JBj ^xmj}ҕ#_LѼ_iXMf# n'ƫbNK+l++15?* 1!O${-IZ : Q5t#HTar.Yx|uq?G$ҟ'ټ}"ɥ&HHV`ZKZ&{YX2[P%?gI\ 4†X)˪#ًUNlG}M嗫[ҾidHL^($1#HC4"CJW!iuӏՃҎզ5j7?ԏkl~ xhT"EX,CH&ޖ&ՙgnx \>lv+Kgı ؒ>(%~֙tADQ;¢WYOBjDmvFsk~=rcD(3WZv-sx"M=aFyS\T[A7ܥ:5[ߋ_pO8*AZ?#%&[gȼPcjx{BCP0mF=#I$oZl;V4tG.HdwU6*LԏME-@<ϩ;n\G? PqnK,5t8USuQJYtsdR_Ar] cFYP$c베b  W{b_hny/{ *;dG ϐy:08cH\{5-uTKԌ]`T||Mm=l6 +3Ƕ_)S'hz(y廕EPy\I,^x?vY EOYM줕OщZ|垒1wG?D|qBHUO[%1/J%eD ,j Fw-}nHSYh_GkHVg"bk O"X) ƦUWhQ Sf^՟OX]mߙ;|&٭CMlvN\VJZ|)q,@ѕ2 {ܹ=weK%oChNJ4/:b *H?ocUI:?tM{qd7K=۔x=̓|Mu#%Ee+ ĒBee;?hu۔݋{7qUvhǗ]S,=HWy]m+s׿|w7,wW܈ySS2ZVzHTU5(O!?37A7ž.H+~u>+aTm6WPbvOnU5\T up8,o;Yܶ =0ۣ=Х 4t&'k>^E "E)iVȅGU6#.X܏pN TȒ)v,I.T jNkEZqϗtC>-+;Rmhz{3;mO2Lz\S~ۘB4檤}NfOW[Ʒ7ɽhkglH",H P[IЪ=$r $YZsPkI#S_*פW(*_ F?[豲'b - R% GjO.թTOXw\?y kGM:)y)ՃEB *X{*5t$i!:,R笞__>~h.?.l|o_(}:~V</p'=vׯ{YΐlQ?\5Fn#V/CϪW{ kےHko?˭bMOs~@OV˯{Po鸿 jڟj[^.l/ pyO϶fz{us,?<n+;[? 5|s1 }JJCę{cMmowj^?͜6?E,?ůWҶu^Zu{߽u~׽ߺ^~{`>ju}^#^QVTSH,a<0ab~@>E6$@"*]-nheP.>vꝧI[l ܴjJé篡A%Y䁤Ζc^m "M S%Ax'V^ew>4>\|gNHZʕXLpT5EM"G %UP<ϳ?#r6gjR%1=uuzJ5c ՔZV*H""%f>wms5q 4%UXM($֔D@SE5Ɲơ|NJx4imXey&:jf(ݡczǷ(zg溞jvnk[_%U4! 9V_ZI 6\n "Ń]5 Bք8Qz"k{{}~;`t8]Ww“r/ڇE+ڙ<+bR'%pxiXLv)>>{j9-y8IYgXDHGWR"yc8?b-k* @<=[ZfVpYŴj}ǝhRl֮H⢩TH>}]˾bqDYUb|QqjldW:{mv^u{(1U7=XcgmuFb~={7XoeuD OQ3#_O'/ 4DzZF<1k>!zUhJb7Z5!kd^6IǕ(.QG9Z 2MTI3}& %j>9v֊T ꌰ $>V+[?4\^W-jC<G3Ѕ_a; ~۠oRV1eH@$Wz9*ta><ᶬJN7-PR|:<|Rg~Ϊ&8x̠7<[lZ޹7;tmK&6 ie35}E5:VeImjy~G  TpJxäL2NNڎz|~^0P޾'}-PUDBt(2hqIW6ԇ-.5A:RhGқ먦1\R} xMռMsAaU . ExOkЋ AGX 'R%+Ү ,A$+o^jRc+9|UmF劃+M2$rk̋4tIJR}.ݵ[ :ii10H'=:i#OzMm&*4"DHF11>&Mә]ikCE|^ Oz޴բKChTR_Iۉm}%gSä98:Gdɖ{2+JN q:KQnjmU,r`h}pUFMGڿ= ^oZcݵY7uǦKj*%34G8MZbKɭ k{4>N 8>qRp,sRF?f'\:ۓa%CJ:7big]S#(gF6ravhm9!]}ۘ:TePUV2=$bHed"m [$S+1jZt{wW̎&'f|fA*j֊j*Y=4 ,)qtF}Cjfص\:J̰I1?<᱕4O#-%K?l֯5R8"TLu2'VqtA'.%z䥁sVJV]*K1Ե݃*5)/1p4(bafK:hToڑfu(Qv,dz׫7~i1ۋ#Ky=d0j[STѤ"9*$r ,w w-3E iBC41fbjH TEkHXƦ8QS#E+ 碳Qguf>M|;[wxo~tG%Vl3 3ĵ>''{vtՄt im̮mVNºL$1J/@ehIAwg+;~m73n6HdyHriPABh oگwD&ihBHR=&P8510ӁQn*Zfލ^hLzbSx~gg,_iB<T+tV$tjՑ;s$^\GjcRBb Vrz.~*xJ `>)-cKL:yxଭFDdhu{]>-uw)M6E>|ml,~4ORϋO 1@4`B@;/s=?ɺFid顋J!UHJVwT@I*YMA| 5A#.ڤIcU \E[KTxrRc<3d ʤ/|2ۻi;=LǑzs{)Ii,HDQ8aW0n$~BG 2HV`MxûƲR4?BiҲ'zvOpt^nmQd0'rlZja^Df-L8$3(g\{X%tU/u2X6S)Wrnz8GK)W*W Ad/XOWwmncX xYH-$TwˡH^pv)q" ¤,"GH8QJp'⼱l<yo=oI+iAYI Acv%טm_l-yI3;=v"aCSϸDCM4rF0>0xyz]XK,kbΨ:=3QqsujeܢSQ? NJ w?렬=QvwDzwewxh1G1GU2x@wNo6%Q6)sI-lB kRG$[o+]Q,.':cm)GQ"RU&4Ԟ۴eȒk5E m$wgϠc5zX|GdrNÿu[[7] taT5aBY 7rkH#1 tT* !iJЂ_ޔ_e2tt*Ѫ쯷nLS5=4H^DYF e/q>W Wl:7HdirȻѡi8ehދ,!_Q_{o}{6҈jI1m1U5ĪI$Pk{(0+ iqVM F/tt[s~?Pml2QǤ|/Y"(7*-[QA%-~6joOm?<&,83E==SiZ+~tj;ݮid/.Lh[2* J4Fg <|,rIWC| hpcZV6K0#6O)7?M]Msod5id'!S3JW|bF+Im˹gМ۴yU[TQSDDꀏo\`=䗛s#O,Dby9,td>Qۂi 1*P!(5f'yM'Ƽ &܋:vo%Yixl`ުiL7ec!/$ i&Ls%CMkT4䣯 .O'E `yYٽ9kbxi'\ PhUwHԪmݕJ#`[I j k,/wv6Jj g3Va+>4 (6͞rg{+zJ[u+ue M|*aJѪ]1UݽXm!>$àIɧT6Zt3 p+mVvM [G$ A/bHFsRT$3CdzbA+Ɛ5X fЪSW}c^\sک(bTF5؏j?{+R2r{tϼC&$~?*h+^#Zu*TRA{+ǽB=ro{٠Mz܄VӗÞ=?%?sk޺8 ^FEMbZu?z+O޺^Ab"Q'Sj wtWŴ }Hq 8_c~OU?:i K[Kke'HB4W?{'6{'9ƋJ|׽n^ܷiF:GZ{L0Uc#ݒJ~{m+彿J=^kϯ{װϐ;[SqlZD*i7 by\όy}}6mMYy1~!XԼ[*\ziN.j܎So"`ERSH́IB>č-&T0cҵϧUϣ74Da?=$S-; Kٯm`mZݵuۣ[KGID`iD)'ŏ$I,^U CٮÿømtD2Ԟ9ƜsNN7pMtQ 5ʘҢmUTV* *  Ǻܟq|d-COSQE -E=<+q4ERhh_rWRIlGR|4%7WʿfQ5 5KY^:wi1C!?>X&c0yvԭ=4gUe|*l JL^ʥ^ 6:+ ( )Ѽ:~)pT؊+*+bYV;O,IH=Y)ɷ\wSUux2U4,lEA) }<~m(Ig^pSjի2i+qUjI+Hk1 ˌ`O UZ2K##P1zQE$S ZA{ rҦE>H$̴\TI) Z 7}RHFIw}iF ӦDKZţ)aw5d1߰#1>wnTSnebuQRTVh_kx&-mkO/Fbe#edմȕZD&$d Rl}kU k"3" }?SZ[ҌV>ym2zu$X0"xjݣ$2CGjr- ^>d0SʱܑBŘͽz[QGՖ5WK%?|*: J*j n"X-+1TX+5-mE\\{y;*i?HAzjVj M.ͨNm{؏b묻WdwV/)kVj Y*j0t1xE3/UzOnbx]85-C n떖DQE$jH/ adv_/- ]"nB-wPo͏ ک}$ k/B[ܒ']hp870cc>6,MH3ia=6_z˭s"#\Ŝ/a&cG N;9Z! Gbm,CK>E0ķgv" )yRAIqy]&?BbQߑ+T)(o=&9I $.z>VUQ?&G?oS(PuDt5=[1Y:Jj"(ޠ(\[`?3 %@ҀA!R1ףDW驘 }5لw(Ԕ*Zl$ q5-d91+ [EqO߳%ev_tWxjzTm%#`|]P:hV⩕L+~+n}N.f :h WT)*H]"Rtz*X++YZJQED pI&=_]4E$nr71UKIi2]HyBHR0\jψś<`T\ (+S\u zy4fV-Nݤ}1ȫތt MQȑ;Uj615a2][GEvlyUwmȸT+T4+8H vعf}W{ Q!j1hWPp%ɧB(=HGoS++6+zl^Y~쭿;Sd2|^lh╣jjcGuYn%z#j<ۗ CC#O*-DC|:eRn_yp=}+}ʤ"jFJM\gUq_[T??eLݥݽkt՛qlXUKWV 5?SJݜ17gbdsM͜'dkrz^5WJecP5;{qZM;;%16c˭ذ =ezSA`1l.:.7ZZ T$$P?_dvoꚹ&vp@5s>5Hūå[!8FoQݯ{o4IV*Wׯ{h^{{?˓3}{Ÿ'[7]uK?FyOcf}6unOuu׽~I\`u}@e,o W>׾}{gHէQ}Qiר^2Idq?썹qxlVߛ&#A\M$jBBmZ65P)M *}Gԗw"Kmkt " P p:X:xYI *( &>2dv=^𯁥8i$) tHjLdK_T7ixE#h)wA5VX @aQH>uDm,6=lEa(is)FR9dXCj$S,]q]&.*j3 ǟ.W sT'D#5), m^\- ,j80+IE\%b[hx}鍬Zef-43w%ջ\; !:0.2B\&m ^ =֙7 MxlUB%ULS"Q)J6ftgb^-v|$t h05G?Y l[!JIu+kq= h(4ҵȯ^iM :+' fr865%>/UKpsZ9pн9fcYsp`~;;c sݯnbPmM/0h>F,Ҫju)75Z%(hE4JP HN[c zUYܟG&',[+PUb* T+O&)$*Y4nm:+ Q:jEU-5%mľ6椚:ukDn{ RUgI<OŞ9YVW0* S*@s9k7>2xmYJV aPȬH_^ .K jǒԤIQ +Ut̒C$]l罽*|a WI] ӧ/ikר=ɴ+ e$5%\%,Qk Je4ccW[݀$Wܵ:^>{?*W 4:zۨR=r93,lxk '%UWơZ&_T0J=-^:\}[IfGAOx4R4jJp2 <-7HͷvnS36/\Sԣj2F;*%[sût)냞N0tm; U&5!Z%UT(T#fXr}ҟ-UjI̋S"j $} rE/h:8@]Eso3jWa|Kai Ƴ2Fcܻ])k{g0ڧ eF65Lads₥XAeQe}=ԇɳ->ەuɕcJgMڮ+\hs%*KP %}RE?. 4 ]sn@;].%'-|+9+ ,ezިX\9T7u;VJ}/kOkFQͪBzOi?tJI~>:dG]Em5zxPxpo.sG9wz}uY7"m=@+TIM/p/F:}#'(Ÿmo׽<o>׺AnoI?[}n?$7?ӓj/uxO'qjӋ/_g^(tB۳vAw'=OxG*'R?XJg;uѿ|iqޏEWXfOz-{fܮr+pP2 CDdqUuq*5ʞOVru:^N&TQ%\*Hߵ̂PeB.vHdPbh.WTkV UPthR,bRXz1H{R|4[z {mvv5v[5(WVɓDY1LI]#oqnr"L(hu0i !8:N+Qwpbnn%Fx:-EѐFcנ#sa-YWoxGW⩻'%`\Lut+HeX̊Ѱabn?=1y]Ƕ:GngtoUw^&gj:.άU*2+8T*B=-{h6}B ) i]jj'2b# .SoB W߷)jvvSؽ\5Uک^KhZj*+^F]1ܘvզUsd+*pXb %TĞf[.nnfi1H1c9U>O%4j*IqqKT$3V'm2s &0Jo$U(ݦhI W79b&c+C!#X&tYYp뽝ò|M>Ӵ0@*#E%;SN9Lb K]%mӷᚷvSPfvJlƵ#wI^4Ժ c~K w]Ø.,qA"o jfSSƅNXJ 9D (|Av[zl^zxc*p_S6iW%fG+tfhiX6,Kl[4Y]ng,]OM,X;ncjjzZ5B)T ^^?lpoG #3jXIa8gW Lq(of>궯&OӨ$ug G@fܵ_=SN \v'pl{34mZ*a*@Q *1~WS4SDY'Yt*IuShmw D&z>X CZsקM=r9/guXAx%ݔXz9 },k,LV1&IS|/m۱w^q7.O][]]o~I L7+X:xxX$蜊fn-xmd6*! f :]ߵ]Kn3A,Ef(NFu b$qSb[v=:mn}Q0|lfLۖڕmQ<wYkp/pd2 S_|xMSCU;+[4pxi22@e`_SnvcD!ަј̺tlU\Ǧ,H-°"@&@qN^tejiI{*8m<<9ɱd$V?n9/=N;[MHMSD0-NF9iZ0+\7Ͽ^;I2ҋVin%OҰG[` xeY42iJEAу05 fq-ٹV^ F6ݦnE[ZʼnWf"}:ye!WOTZmnF~_.7nk;~lFۙne%WIi&i~`$hѹo)}}obgt(Q!M ,3&%FWשʃh؊W>`G%`;jR0M+ZSMo]CAuhn6sԹ*ݝI@$O2<.e18GKLi48me>i6P(lS+(O&k{7?tY6M&iFjj)PYᜰ=hE*I ZTG7oeܜI;hPdڴu6AQd3-gAQ- tNڻ5iv>Z<#OcWxd٘U6SUOP Cx6ƾs;?,ZGť-"R&hZ1H)fP5mͰ0CӤCDadD@$׎=hkХ{5KOS{ j}eF+7@]VuR lO,Ó.&tteF1V\U^.ek6ƪs)2jikxzlE\a,?ZOgۼ.;$TOPvYwM '9L0= dRBP-<ТHe;Os=rX6ꪱ4k5IVW!JO6jHS:_3-2|#'u:ٱ~O߄HO#odwVWVW&k{.%3e(aNCiyZHYa@PюhiJMF L6ɶip;k'}/PSƋL!Ie,)tٛٻȜ^ .⿎SKI.*y9馴m$\{헵#7 gnb{*0((E|3}6> T A^opO :xdąZ8ii E8'u?_)q?huk2}AU%ls{κ8 nO&Zڿ؏o}u/>}Uoro?7{ڍF[E{ DA= sӫyc@؛~m6Eiӕ^1:A ~ze՟>骝{߭o&N>Vo?Ƴ׽5y7,*N}{!%C\_#{[>iU[Dx6~Q?gVcW{uƮWo~?|.QWʽ{>}zbJ;nuulq*ZhtҀ6:ljm<6C >C~]VH^a9am7l=~Iptt4qf`Ճ8Y qr}Fr%jj"@jJ]tPWZ="ܻ洷&]N[R\2Xqz1tPW5:K?SᨪF(A>n=?*{`dq ii[?̒VZܖ6?$R>9xc'JQ*S韧ԡӟ^l 14Fx*rLr$J2[ulm+:&覬xd1xZUSo_ο:#ܭo,XMt_2) t Ef檁Ft'`5s<{DMqAFy,,x՚)d$Bzan 5?3`oڎ(fHjxY<)$PI?=ƮLVv\p I- Us4N`OO(iL w 5j$q.f)WMjPY5 Sjgkq[5a;OMSySPo\cB2jb8<ϳݾ5ZExEz3'ީMF4qb1+q/n\iljP;E#,!ud?}^ b+uHGā7cr4- s,$H&U9B,L.t6dž?GhUcà_E٬ZNy-ͅۦ#)p*NZ&Z.kVKYS$%K0+OK$-ɉg)WQST䢦@S&EV[F}G-(eꯌJdp{Jy#JysPaE$x7ysWde +dkZ\Ac\Ϩ /~'G/$Q&!æJWV֧kf=XS-?{CC?8>]{rD :M0?ZE,3׽΁KZn2ZBƞק`ybGW!ք"lKeT sWwo^-)p/vꍐueZWE)$Geh_hN%~eナ?Y-^R,qJ撡T <*UM>J/zȨ `g_닶vOaf"J.AQ֦ȈU`[r /W72֢&$ @HέlCWC[+KIO(%G/,M"\;1&x3DWzNXT_?=+E'ozvn悺Jxi)h$-"(_rm*/)*XX:xdVT$gvcePw;G-:_%PKNQQRxA%?]ʽ+Ϳcz\'Hc$Y QSUYFΥb>3_K?opQN!)xͅXܟJ&C^$`$(,]r[װ؟ٸ,I%q&FdcSi%<%Aw ?I">_WzJq4z>i%+Z$@/oIϰi %ZҹLb8P@u%,"*A<{qc֕."2ˤk+ٸ=[y*T߉:IcYJ1#b@k{$W gW_g=;\NFx 9R5[bangX%"bh4RXZ:p4yK p-ܬaZSNUXYݗO( 8,|LuGi%#<#LgZiH${rGAXi'vzi 1㞖`x{N0Pd&s2'i-17!`GȎ'M P{~_/׏]>9,=m-TQS$!W<{L%,A'kFi2|\qU:T>pr9a%6U9*E ?3'^PnE‹LM9?\ "`*Z4*ԴYtIRHd}n/kieRBL?",T21jJyABjq(L"?k{)84˥ WǯˬI"(2$z7?N}_ݝM3smػrNJEWO xL~FUKCSShnY7睳w[ZEypKX@OJ/&@< ˜Dp/Zwj=ð|Ssbr\sܘ5 US'4GB1@P+?s`u~\f&!yznb(5( /m,IN'+l [v*A@XH4=mG@ ~8|͢JsS猱G֪UU:|z{fSF(1u,D" I ʃR(4s$ XR"i_OcVw5r0Dj(XTh$<~ [0X6YyuH7Li bX_~1xk  tq,Au}`)}{qwz:x!8UU@jTj^Y卉'ki7 \Ⱦb5$mBq'[6J)51 y<ݹ 16,\fXK#FI<I#I6]"Qc_::pxZ8g,f&w QG-lk3I ˳m $^po҈Ot o}\t4չCKK$0UQ$%rP{oo# soHZMΣUtܰ o<-{[xe;m|K]= ;uon,kGZK$L ``z2m|/\mVt* ўyAkA'j58ʿ>Cu-3?/6|ڮMӎuF3Y؝AUz&ZR)!pIEI7o[t^ݡ(݁kI' =^چ<:G[;9]Ց㷰{m8Kq({udWR@T:F"]~<ܱ[3KJ,*` [yI5T {])ғ&jy}9S@^^~{߽u{@w3|^?am|]_ǮꗸҞ;k׽C#c FyUC C^nyQ> y.,B#ӧT4׻J S{YMk_u/z![mLH~잫ui}: 6UU$X?[Z>}ҽo^:5OTq e[XZ0sӃ*PSGtp%Nwģ =cۑ횪l* YFkCBG\"_&}bE-"ThudkY}=P d.Zx(+յY5tz#v#Y)B.ޟgv&mE6m7FY3448zYJz75dX]LB}IoDDf7 ɤqJ Dž5S3ܔSg_]\tLJ1c Ry+&@%V8AoeK^yv[UWb2p8넲bڹLuH$<'YODd[.h-YO"HdpK9*c1jz&6>XO>^])3v: LT4SSQ,+O]P6,I$"6t܄g3S84WVQs MIj+&ЎEyj6!J}ns(~#N|VUp]JHOi8=N=k45t?ݍO$3M Scw5S&&$CQsk($)߽{K՘}gg{ 26֧UƇGM)pyfdVvvIqvdhu)US_;:++_.?]+X*bfuX1v^A6][k#v7d_ka2xɘ1YҟGG7ZzC"( -Il--D@$pࣁLfL8?tft'8uF:N=jRbI6Byo Jb ekWv[|aqM]QCml6~-מZʫ=Fr2^IvjPl/7K{ ^3:- > R*{-ԍ-U}B=q(̠Ãc?}޷J : ۘ I3%YtI#c+WA1O@l喑 I~"\#9Y[ɼgٴw/KjaOO>$NO5|Xkc(wͱ#H[9.?"患r[yj(ˈcٱ\D&3:'vŦ`ƅ'P4#֌B}zK,aJz|Z?V:jHf!mE,d](DHOןf;u6|m.횚ڊ_5%2Mc5JI$*GaMdW^BNjҢ?[ʭ''~0mSUSZ4QI⧚Jx'rw< umS@1TX\EF㠍Z71Vc:Y*#DfJ 2Gp B<Ȓ\ UXK=}5ͮgVaJPbB$א=o^X©K}V~좋O^DGC׽=woQr{+e~?S{Gw%CkWb.${8蟨2O?=>__3'X={޿8#<޽F^ܛO+GSWETNq媗Ȕ’1xHtjٍ;%6\Č ICpW8!2)W}o.EHͼ4EوT f#*zIoLj0{!RPԫX&7JӠGR6;SyFS|15J&]cRK_9,d_"W)GtU|_^eݛwidywn77ho Uwknfކpa3GB#Mdۻ+I;;⊏uSmfZ{5e>Vʔ&I%=l\7Gvʑ>;1HZiՑ47%&ZVc,b0hS0@0I|8t_wdn]mw7WȒ$2aw~妇!K_MAQ#3?$ܼ셕sZYX !erZKQ 4*y\NyXn>Jں;P㦩:k `;:q,tY92R*UM# 87n~g6lcCްV GMBkrOf'ޢYe]i *ULw V^*g xPǧIg[ng ^TmSԵAY%Hemq#vz?kW~yh~Qd0\d~4(-qM%R^ R9W]j} Kk3O`PI9byFH f@+h=">J|W{sa׬xힻiTm-6UU69s;[TM*Pe+"+5~3Q*i7~L[K D)itU:KȦ5%/<ۻeoۦWW2Zh R9YUTVPu lWv_IkP(ETɠ@pY4u~kGs#Tei1GMRZCA2X|kʹN2XWIIvLW~,tgØcq9nU/4qbS$AUإǻ~#÷aU)Hd[uM ZjKb4;-6ޏnq[@uYc#sZJN>u35kpE$n6?5c ?6>_#Lma vO(`;G0ⶾO,}MU̹DzzhaU 9i͎gj]mekXif)hOZ}RjPTkkh%AVHXDD PŘ+Q^;W&fkޤF2seٷI A&om]ɐLd[zSG* H)%u*on!y ;i:*"Լ>Vj!q6-I1]U)? pp0z˗*,r~%۟)5]=(COI@2IH$/{ +4b_'56tJA9{&5F;(r`ËA@SQ"4eݷܝn춋Xdڏu4p-om[+L!!$zTxh R{ޣX+N 蟃1R u_c+QI+9'xNe ;%xc ^dGsontUfgͷ5E!d()׹D*b1]SZ4i#()6`Bø+slB"2"GEX0n3TjIҪZEHӤfoJYW7rrXV|o|^HIE>nm͒*:2 Ks@M`{0XOkZ8ؖ n*Eڻ8ݼUSFh1Sk1GOE]h4=4k"h&iQ@_5UwPRJDXd.H,3 Ncj@*4'-6Q.⎳7V (YrpϒebLM"O5\I7֍?QKvnत6_d18ϵX)I)M6,Jwh Ű`ڋ^[n4HOƅ`JFҖc70sn(B0HbZTDņ,̓xz>Sz읮z'h_l|]LiPS[dN$L)؟^F'T dnjo̿̅c᩺C}Ga'ackUmMQ avOE$0fBpOTOV|<)V(3TǹIS'5r'̥}Gqj;:/=Wi0 Fc}']wy%q"h1?Ueq-ĭ#eP6X7-H&VHjRpw~oTdqukv3qy]iH6ډ*R\ZZFxkS:T*WNRӰ`dygewfy:?KA5mpbZod AX Em:5nQA4dP5龲g7%_ c`I@ѵ4v@D.)uVI11.u۳nbtfio*]uJG~֛-W׆: (SncVcFGRQIR!%<H2HPt ?? w.~I֒)Dr[G[ ]b*Wmpݢ2܌ PJ(:w~:Ʌ$]ٻ63o ?/'J+A!ک TpĪHHR'bV^h̞K/ RUò)T2z`5ȣHKA_YlyŻ);Z.Hu1i1bpAvupJT#Tw M)]=Oޛ«1tGraw>"ml%m?_n1Ik;يV'aq8Sp@?#o^tExܥ^jJSף!B H5H {eiX*4AI)I?ȳ|0$ *GH2i[iQV(AI ҎTݏxz:[?M4|>w>WmC IUKVC RYJ0/b+B6YͽFJ|?dnZ)O9$X'Yr:X*(ʪ*޾o.[-$S KT[5Zҵ쮜2:{9eۡYyďZc';{#䦨zm--f/?U%6l tJG1EChlvgGO9͑رAbh%R'mI ]uTaAY}x+ϡٹBs3\GF"F, hIF;AoG*]¤K|gVU5$z`EѮ*L=MmJU=MbSV榇[HcVcin޻NMWI/VDŽյT*Q!Q3RDj}^g6 wo2bGx#}7&U4-pS1 GOH='I]f`՘FCA 2Gz_Q$ g )r)S"{@jYw%EKVmGG~8|}Vwn\n6qQ]+jCp?{E˛~y!wFQm;j17\|mqRKtC5 WCQ`yt]bd*,hȥ-Hf:jϔ huh Slӹ=]Sۿ^F@A"ߎ9?}{ $:Xq{X??$|Ҍ?^Uo 7_ǶrE|{en_ͿyA'P׋Zޖ6xu1;nUE_*~޼D^/ &Ď SũmZ={JR?KqmFGM~lPC\rnx6׷pIT۳]Ym/qq] CN55zJO%8 .Ub9*6@RMEM J/"Tjs${Aw_`mMG]9[7iF۳Vc1uK1Eu@#W7>m;Lf[ )>3¦+SJ4 $zqC׸_Q_M+mY EtZs:(bOLOȮbv8zj h*0S%^̼t /XFd܅k% .Jƃ W=@a:yMRH?m*PD4" snon[QEitU%@/ 4@`IO唚e~*)ʵ}1{^+4sxOV >vc+i܅34MQbZh*Qd[uGy~%ڱ0O9ǯzIRN;5fJY ASbTH^B.?-ofuO\٪>v DpxRG5@`HZSȒ-D ӆ~A)7 BUXWsy,#Y_=h2iܑxB^[{v8)׷{ `Vп~ QuwcTg_?^橨[??SM] ^;3c)۝H @߽w_, !粁~?ǯ{oGux䇳 c(>^}[&UZ?&?{#SVx$iC&x2p5R(b8PMig_\@ʌGJi{71mPWUjfZ*XL%<]*P?ڱo{z$Zn_#)umʿy*TCU UU* KM{a5`7^RNySc9xE7RVSc>ߵ٭½(95NbH➫!CgWiT\*=~:i2*4b5=|X5WLTXuUp™j#S7m]QZzL 5 Lb/] sH]Zzb51Z/SOo R-{= QCA-DBQ2v3bEz t?~|0Xmt7)%\SK<8()r^iO "ʠ IvOq^~l@%40??.(нMuD4ѫ3O"$h$ʑ` $O`W:3IQQy(*cRռaI']<2Qcqvv-ntD Q⢵ )='kw6*\;_GNrXz 5 ZX,l{x\פ͋TVckr5 Tו#)S%lv䀠_ۯ iWE㊚WSp:<uKQ G,Pi$M,i $} =9[41 C['Y)*[P_K|CMd'h! [FC=iVR=3f>& .@܂.Eԓ",MHO4U ?IoۑYC/N?}0UYa&i˙4uGCŚT_kkFԟW͠>α*D:Gm>OE?1 *lfMo6%YVȈd%O]NB䍮nav휹o?@/VEqЂj`+DѨ;)=iY E7`ogqnX*>?:ٸݘY^)pu̾Bzfh1Kje5<*sLWuR$ZV3YUٕɱl}6i_R!Ծ61S „ VLQC֨2[EnIq@M\!,f 27!]TӽEQ:ugu k*'~U\e^6*dѬKK!DAyԒpᩇn(f@Z:--?ylN+//Ӭ550pPU ?zuiICרSRSVJg-@ЍaqEXu[:_*7& \u$seph6xă( åPBYʒN,{V54:h4iAPpqхl򅒠(?a4[1f,ĖbI'I~{߽u~׽ߺ^}?˛2lj>T0#'}5ۏLǮꏸ_Ҟ;k׽;ڇ,E?[b}n땞]{ܨݴpG!lOPP$׽ʌܐFx<,x?jQ+׽PBOzԆk}-~U4^4-tIMAZ#^:S{Q}VSȿß{`.<`6ͭaZL׫ǿ(U19|Xq) M8|S;Os^vuiI5@nlط>~.eqV-zsOJz{yi+u~׽ߺ^~{߽u|YUVbBK1(O{|^oz.I`2;vPLF+DGuQJ߹cx~dm 6PU)0j]$T.\*Қc^OY ByVIcTibȬ Im֣$S]׌ܪ` *TPRSPK(eddq\b$?p[QŊ{9IGhwyi IUjE cQBjv ;X*hGhl䊑ݐ )otTaV : Xm$|F9iUCr%DqRVBjhw'o}"d9}"h꣨1+ j_y-X[ۙo'.uLZpqi_NeYEpU%5e]:îYj$MD38CiFJn]w6,cjV chrkaK Y|ѬQ+LH{+;B6m$=bXTq龋Twcc߽!GEKRIOMKP,8U@#QPpIvx,j*(}A@E8zm jO?ѽvYֹ5v"! 14j$qIOo"iè( 7eW>RZꈠzj: Y AL w2T(5SJIudkw +h2x< i4UFjgwR:d7-ۛdTڙikwvs=YJo-C+3,qIbCdߦ" 1_)Ē8*JD$A%F#ww2 >Z[P̬Hp6ksF)y=o \/^fh.<=՞4Փ$v`i.~7~GןfHAI׽cnO:+2q={sfty>J!x礬e0PlT,=41EL/ϥfmM*iï~ A;=Y۶2TQSQhWGUt HcB\loq.oC %@4|:9g-jaV<ٽ)i(` Z3C@B<ʶsuFrĤLlor4dp9_; }$H1eF>3D!{9wsD^ t罧wa+8NѨtp=ԑT. m a{U#UW o{ez|5s3݈M'U<}=.'28up}ߤ{ٖoeS[w:d}[ndA{2AmMcf۳H_K %g^_{7{rxJU\GBUC?6s^E"i_A׽?Hk8usZ^?^^ߝx5}zU|$W.-`n5_~Jz_MrGela>{k/3]t:>r_N8"Ru?4Omcr\s?/f93f'X={޿؃>C;zF;փ{;8lfi>޻s{rop9"qx ͶRVje0&{eI7$.)u3ƃ C)dܻm7miDDp%PsUEͧ]K람⒗-QOdb|>If Yl*admϑ2 \Nm?DU!N8bWƪ.|hչ rɷLL!Y $j ):5թZj:}Ƿ(m -]P5>gIO[|"f~Cn---&;nM)䧏3[0ĸ*4iYY,̈Eqs${tRd1dՙ j㿄ONܫ_Eb?ʹ{KZI;&a.iE{u S1QIR7V@F9Mjwfhbsg(0I 9Wl#&;nY`#2H|"ĀJ FżMh4˕ VMVS/2Y=i8h]$QrAZТ6Cr~LhEW`7Bar9Y6f/ܙT}G"%uU#iߓ>W}7 .n55:JT OB[mұ$'PPxjxs@CF#&-[_$WQ?nj6I_am<ܞ -,U%)TUdy/nap=˸v&eg_oVTd%T~(h¬t$4W 4j!_J-9s M$ XVtJ'#UI\mW/Tv]8/Eϐ}*AIa`ZJ4cSJn49_/*kV=Ws;hLԳvb z¯H4K0-ҏvgf^c]< xP]R m,d^F8p4-rX:X1%OU)ѺRnv2\+w%_C e^jTQH҈)ĵY"wo 7տ2=E{*<0ݍjIgQ˕WlYX =0s)^+ݖm%VhmgDC(NC g!ٞ^2kT*ha+ăYyEL؞>C W&NjӰ~ͬf6F(j"5EO"h̭'aڇ3jvUD|0SI1}Kh(%٤QUGp%)Zxh{9{ wur1]1LLI11!Hχ.iJ(4%I@k{$&'[Qf̡NRP*$0XNQvOj.2в)r撦,*('4rIP,Lk 6VKtc1a_2L}vv T=g-=CUVI,2G3-:+Ie1ܿmjyZo82ܣH , s;i }G Ӭr[jY èiR wMckT*PRsV|~V,5m:ov|ef:*u#7_&SfLMKC#-",PEԶN֞w{tg8;k# W))9i 5 (Pw|G]3ݱm̖/nΛQ9IG=9MS:6^S=omnc[kַ1o8gpQPwA;%|RO4 %P#V+J Fk6Mɇ7,˵4C&H9Z:Pt2$& (Yz|^=7UVNJ($t4 5y7"eyd=pU⺞;Tx2G}2d*#lr^,DvH^:uՉH3k u+C(2Tj9|}E$9Zv}pH >!M56F}i3PmzjbSդ4ir ͔YbҲMx_eA6?Km{wԋnɤP7vY~Oh)֤:ΌʺHRA>C4!~wYW㷎*e2ۣj1U-j0RzT(DiA%^u>l*3hU >g1gdᣩ ⚚*5M6B[w췷Zsq%]+(h"KdIsJ&fK)Yc%UªaB>#SkKkM[.ŭbeb1Y|.r$if;a-rST]-//_9$%~5&ASJxSⰻ7ܬ˴w_d:6Z7p}S\5i3Xj*ZJi] Ufk6|i(rRir͊Zʱ. jrNOVYCSbjptӮh{k455c9MlfBi;CD"̂}sTVC;nWܝk=U8P'vV+%{MPT*i H Kםp{r9(#]XeiQL 5r(jb6Mmۼ&YIY B1O >YpsHL}F:2X6rmI _%!V eA{۾7}w"3XiejłOJ*i": 2=Ϝ[_nGz=Za{Gݫ^zw?F^Ӂ^,YtuoO\o{@.C~ <~?- t֯^QzW=ԲSO[_}t#Mǫ/sת&׽`H"}x+ouGbq׽to7}>1jyWU*|FASHzK׽U$0׋?{ֺ5DX Gw:Q^?i/zb{iS\}-g'b**i^k*)$"JBagp+x`֕먶3)8g=n&HPzʏdP2$1E(68qsnLN8kWT:K@ dAf$n-ܘ(x|:A5ty_a* $H4'ܗr<ѓO*Y.S)Q!LEibXK"y)[_~I8}X;{ _:^ƽgGkK+!1~V:t1$ \Gq.ZHWKTS@*ST$|VAMBM?z-X3>|=:Zc*VH]s2^}"]g Zj-|O,?JIJ֢/ةfUiSχT,JuƶdVH'ȕRO$ZXX?K;2M]YjvV=&!)kqiW1WĬ(表U*xyI<F:㤞cPAC kTjhHĖ$^=]Ѻ7]PX]MN"m^dydI* c5d;_/2|k5E UJ}pO Fݲ]*Hr4Sݙ|6R drtK,I")Zic&0%X0T*_$t44ȜtEN)bh0*\T TSUMrZZXqR%lxSxo$RP,ova, ix+2T5%OxPA#y,G2&խ x>xgҸ!Ԛkf?w%4TcH0Va|A[sYSCQHچ Q %1դIX71#W?'xeTW4tv[T8uH/𼄕L*^p#Q , ud7ibaS6OsB245QȊE \.YڍZC鎴#U 8?gG" oM8cD4SN!$ʧu7o82E,%]vTrS-xS[vk%w͹QIӸhU 6D7.\JeH@{קTu]/8陏"D9}/DZ zgl ^~H՟K?|0mk/\u6[#i0cz̠C;C4gf`Hȹ{ŔbKvΕuNzNd(*b2ƱәdpQ7'p,94br WȈi n#˓`>q:Ƶ4^>e@ ӊx [ƆTӞxo,\ei+cID!1%$bH<Ms+C[81"Vr2`E{})*+)1*ӟߒ4):=PF<[QZyy QU>δ񯍡xz~]w$#g:E<^XZ|vp~dJ)X-Nn.W.FzqP0yuIJqq2J3IboϷї`<R> }m|u<]n9rmSRReHdU*"n]{X][UsU0EP g==m ( E/>tT|5迁 p=YqWI!#uK%F J:Ȩ1BAYAV6'Hm޻Jkw?FQ˻2qz!YKOb OmǛ~Egu>bS(4M^B-:<<'ݯ;y[pnJ*u`@v DfrDD'@>J X%QCI**JqJRr?}ɷ$bSS"5<)ux: FUeL/hI424IE !)L^^Z5*yHWϪ* ?D*ʧQ$X!MڛwRc³K/޸ w[ٌgXK8ut(#i\pLJlVgLZr^I"#A?R-{c5CF @*pL-$7egQϪT Bޝ?`P Ix匇ru'$` }=#ǫAx#<>#I~ZPG^/&+HTliy$FM5%b' e\l.H'wbjuTW\2x^|Y:P`"oxq*Ym[s12 bb)~d áUF/18XM¢w {l`/՛z)S))!r4J=,⦏RU\؛u6ot౳XᠬbPg *arKg`eh :WSW^"SK@ aO>׍?gU+o3:cvCc6Ir[[7]S_^eԝ{X6{wg1y604QEEQWUWbݮr$d[̋ RA@zf@kh55'|i8gZ8W[aYo]>N QjvQwTy*8Rϑ'\U4u`]oo~t7-~n CMKK7 QSHJFLd^f.\ĵbI,@Oe[|:>hmJJ&edI(\<3XFXs|G8+G)^g%R{ŭ /zCU_PI<9!8S =ic|mOIֈݯSjɫ J ZE@U[5=j[fPVI5: 8~]gX`MP(*?%h:F$J%`ے}6ݝsU3FArxlv9,U/ +Z$&4H!%X`;fmd@(c\tr4Y`yMm 9E,ML)S 4:eH`Q=r LV*:8B*TWLUJCaEFCs@TICG4N}xSQCn/G8U|f Vx <~鬨}MskP{3f6qe@P::ZڬF'd¥vI3£S@Kq}QMFؚ5Y=Tթ&3!_[ #C4Btc]Yh5ю2( h֜3ǥi 6dZf, :cnXYuie{:lմh6Rmې<ʉ1[Z;c:x?ɢ+c Bdr%/Ig-k^0FHn95_]M;~Wd9$͐IKQf!4:Y$@痬+=e]U}F*XnjjeN@@'oQ A q"Aҝ"-wiU+ƿ?v}/w]f uaq5 4B "*ͦVVbI-ҹݫ{+QQZU籴qӟWPPy@P,o^GvƂ$*2E:_^Uy5ێoYozL#KzPMK*t&D4T?, [mk[cfZvz\6V&2qS)*yRFdd'ٍxrIA / T")C#aid3^]yTyJZ=STS KamBXvEvJJ:ڪmg4lsI',1Y67'm˱:,~/@1Ncj@8^+$SS2^hV%y*rONYAKx>2J eZ4%Rl7Kvc @+((]<#$L#u#RTb ?2=A{ >)*KO?~f~zj{Ou^~{߽u}eI{a׽3{օ/u|Y_7z@5Tiq׽{{2?zݢ{}A̟Mԡ=^?{/JvP.jSkq)(_zn殮UY?=J]lM?#H{ oKqu͈ejju)܏\lGzy^?\ox}{^m }3xbInCCҎY?oPߟ; 013Ҳsw<]_^8:~OcmL){EWf93g'X={޿=sRwc.sS'6?3E Atjˡ,+3i<<'{{/) =(p4$/1\l\,Pxzn!q߆T8Q!Y,Y\DTH%l{gb`vLb ݃fE&Cum7N-\< quU4]_>]p^߬0I"z),HSPHឃ\6lmj LT7 mMW9fƾVHbj{!pI.|H`=1=R+A@wɢ5XTZŞ9iaKA9y (P9Ctj#q.eE㙔:R*ҪUzdƽߕ vQSPᄃ76$6Y56NtŶ Z yY25z Kyd_I_{x7>C%OX 5s-(JL6O3-^;.ӯ!FdS(bgK3u%FFUN}hqiުOcpGl}g`#ACTՑ5z(YWAbKl/*Hke7fCd`}ٸ,餮ܝg⒚},Zk)4L@% yi1 Mk}%xgBp\twsEď,J%xnpKTf8Iwlg&4vSÚ-i˴d{!4DcQȿUL"f* /iRuRx\vgjiKmHb$vj-#+ư =O;9v-Z1 JHTIjQ:MJ6ZKȮ_E[ 8aHm@=\WefcRSujaݳWI[>ߎYNe&+2rfxA$ou2]f~{gfMMߛ?uFѪC,}$qc`vؚÛ6=$Y% LⱩC|ZO[s2m+bYDtGL?:QAihwz3-KQ5AN2Le28dF$6+[L19 뺌[-_xo6 ̈B)teo$qx`Ԉ2$WϜùc&$1D+ܠ %+A4'=(軯yd&iaAa~99ӾިUQFt3ȈnAkooI=Q,&Sfd;c:Jb03~y)VJxcBg ͚˝v$K[hݍ J4*"qBA`Amouhm!UFvQh)[hISMzC8y6j)$w ҍ\zm5;*|/Q%qg)>f#k/) @j~f9/h{+cK_znT(XEr޷e>ٱW[9T_C0i!VE!ixĶI ->mR@JgP>]M;*iF> -O'Yԭ㆗n'AY C Y\W7->ۿ("q6ivװd&}x(%lm i ίv]ǵx6)f,k)UTJ9#`^2( FSTs%QT .hӴb~EHwlR"J ɳ{w`S qroECG$rF␺(Y7 ˱6#6uovvGǰߪ([{>5VZb榮b)F4+b7)s]1fF*ŘڋAVj.nM.4:~X>`[{ U=ɎAWI_r1U6>hq5LaX7)Ueflt*al4Q;A<9۪Yj42UVLl#VE<ȼ/u#YK8i(FZh*Lѝ!V EQ:h? pYh (t|zMퟍhv~ݴuVw)/g/MͶ -@"Vzz1PQgW_hm*V쭣H"w+JISB)jmbUUTEVUI}iny؛r9|ܧR V1K(I]ACDɵ[ RS|KQ k)1TB}r,[>m4b3iT˪2 Ҥ@TG$f="ńff/M~k@xtqQ;hQ|L9]oJ|v4crVT9)H4Q{nbgvU^nu[S|4A{CC$4Tm~N)1UW^2TܕkwCAE$vJ jORa*0/*PBU˕gO[mBC_I$k+5/P Թ:bbFŒCR&58w3ۦfg9ܻ`: (mzVmcҽZȩNQ {?6CbUm?a泻wnMYM1x=\uO#'Oo4LV26>bw9ͅL;t(R`ˁ BP$]{5H#bVjaSH48=`)&ܒ{a ([gf=WIKܸvZ`Bdc@CAxnK+]Y-׻*"^*#hv:?@@\׷{+stG#XMʫ"6 ZTfrEpۊ fXfU(T` klo.&iXEm{5-&ZY୎L5D>) VuFUsuǙM.(7ͶgLotDev I+i 4U?ߔ7.GYʠ*ԕ% :WkbKSoA$eU1#$urm:ldŝ<4]<+%5>8D']cqIм3fz{F]fweOjfg(sTCWJa*X:%-~oIb_SPa"}JUxWStHֱe~*{h)^Y8"^=-禨鯩GKO#ニ-.+0}yKiZ`4ƒT$jgBg^̻+AI,z,$r) o[uhwIF e\d1Ԏh8\2pw2vޞ`vcL2cVMdxQ!vU K/utnr,ZVOqG`MmK t -WQ醖nۿ#ԛ'RhnAGS;ZƊRS(1{}U +.'AU 5^k|7iWKRR* ykYz.c*SD,2+.4 [fI$@#ڨj Oetm{`n8-^>YC Vg4mN548{?swNdң*kb0&RE2@V6HFXr=~\Dn*E}O\=:15Ӧ?u|@,@51kM 3׼SN{\ [X~B}{_½{ _~lz鎽rή,-q{y~Ҩ׽UAR?{#Qc^Mɵ}kO^!3ܙƯkiqճkAU-% +G7,NsC +JHza[!c⣭5F"XUBN`xdbkBb1*1d4L1V:Iy ,^%c\GJ㑘 DVEuoM7p RTxZz-vٿ{ Y$ݴ$WRӣ5Kgdƫ#Y+UyB:E 9ֺPֵI˽'7>O!Eb>2 4Ьʬ .xm-dȭ)@x "ZiFZői+ڴ姨h4u8:HhmU)e3F=EceLʭ2zkƚCPAˤhц# [T(6j?C_/>bgm*uXQb⍤G4DB#7%/rUm!JgtMq2 N]qiBD$W%YK)Ext.Fb$YQOb f֟+bV>KWjr8LR4 jvK{vqsՌ~*Hk6h9t~[I*q)J_%UD)VZoaWW?us!&nnj/6ܲUTɸ~uMƀ*46ycxY\.7"25Vȟ3ƹ[:Eǥ!KzQajJHbJ }.Z%D-#`ݵsf[T;A &<5c=d򢱑b7)pvs۠YP&<+JgqJ厎-JáB(q-OeTP|n@[V}عM˵NY驫1u-D)ii)֎`j鲁n}}亞NTB3>xeWφyj::ܒWVG'ErzkYGinbiOe2E"'}_ɦk9hcDZH cJ ^X%}??_y5tC~ef-zOk]_h}8^$"0-cy1%n)*Gr>Ĭ~NuJI@{pnK鸱HyhTF1ׄ0J[m'}+__??^1-8Ξ=Kyɮu~}{ 9$8ݱi֤_ b.wE'$_E)Ͽޟn<s?l..bF#`=wa ѓmݳ+e0+-DG Hq<+~[mܯ?ώ+\r&ZTWҵ>ފ_O>ĥ7N~ꭇ;]Ǽ;#tAa|LrGINY*JMOE%>w'tpxZV_-n鬏mPECkHҳ2^ :]܍h匬0]`P819&X[Mkg"uwnmŶN\&ϓl]FQI:xDQSA.0`iQase9(cT1GS5%L'àVL4 o,WG¤,0M@4ǣ/޴Y t[o6FL⠇-\6)RY"bQ ةæ_%y R:VHj< N"h˒ +aBjGUX|7/!Gz#󘒞0$Zsjslhb1K +EZ~zq`iUY[j'dj%SסH9~||Ykj#Q$fXٍʪ>eLbm }R6fxY21+)&r\#Ii6`\rQ UG?X3ɢVJhIaX~}ۻf Oy>8FiH $:]&^XZT;:O~u5o-}@[Goj|FtiZq_je y̏zQf&_3-)ר5$'h ׎(nCacSr}p {nlUP_ڝQ5c>2<.|O˟'㠖S@BMtxFp‘"8}^yZ=/ڛxܮK6;98;O=mRe;H'I֜ƱGm^KLU< d'Ьj$X`kZ@ }۸%O(6 Wiv`Ni\硒%͛!xW>u. 2 S/u&s=TRb(4tUI;i!|{ rwwjZL~4xrX~+ lEo#,`pdrs$qxF53 jRpOz OjmHܼ>@>=+'m]X>_8}6{o7(;_xbom{($ajUȱ_8]g&AKd)bVw"q #kBaJRp %frP|xk*DTN[UI3 K[aUpG&JUL`ODBoxu#|z/hP^bxزDT Ws2gd`v:ɦ &h)b.-j>C=:_<ˮdB4* av24M%d$$ш7 8!UQW˯,H?'-a5]]\ď œPA<2!c%ENX饌4Ut_W!>쓄?קc.G*cp9ePU. Yo_=_Ӯ6]FVRn( 4]ٸ &fvpRH!fo*؂E~戹o A1_@Mti@f%\fD7&Ǽ{sk&-ղ6gg]~d;N!Nհ=DDj2ooqY,Sm-Ԃm UQuTPI%@?p7^gIs}qy?qJe)(s~ fG|iûco/?$uzOzo|>Sykz⒃;֔Q:R4٢8e%w4WήܩSU`,rSS#Gn2H3y9ir~ejๅ[Ux&8gGǽAʭ]^u%mVG7,tV$hURJ!жSktLnGto vUG&uUV(8dծB&6MBR}>Oqm=RnTLQT0PIЕm9RU됍MDxS>|)B?K~N~ꮢ) v:KI4V/wvn{7.BwP9)TRDYhΧMg^'ǖ>\i`*KWZ}]ƓÁ<32~ʶ7@|z߬bSќ{F5ψLMd Z9@i8 5R{k; rm}&w@MH vz/+X0J?ez󬿞WlPl{>3[zpmRdإHL:-t^A@uw?$۬~ȇ(!7wf)6;oqy*dKz]a{ɻ^.EnUJvITh.}at^{k|]{T]Qm ;^X\ j%<6W_$FAIK* ̝o ۉ"Um T\-V6#T˦mLN"G^KIM@{IҴ+epL?U {LSMԫ]4iZ1[SZB *5le0vD6n~wf7緝} ain!ZzYkj2.s=|Vq (u da@QZ {m/)<1늦cڗ+[ȹMve1F(x*՞JyJ]v%-j|Eh2+@OFFvjM~X|xW>ugn\N܊h76ymmȳl&:UI9 1WE$Ɲ^DەYꚥPNamdFU>EAW1"\544,PF>-s;'W݉XZXjQIb=Hߺ^~{߽u~׽ߺ^}\.<?ч?I?Nd?)o~ hKk׽V-SaOpAo\*xI$7{(yuu qZ&>_kUxWNٸ~?oߘǯ`sмb~ߟnB'"Ez*HE6yqkoG{&X>u׽ا ̽FN'}'--gVOoO\o׽Q'qӛP AM,?ůVҶu^Zu{߽u~׽ߺ^~{ݳ-j|%V܏e2̖/UFZ**JeսAF4hSWH)kAw"[bEhk?eˬ};iJ کu%U9xkTG%*+G#Qž{ͅZ]|m6g I~ G@_/xFOT1$35;AoBx +cU,*e_LWaQ"JHxU6`{R_ICn>Jñ-4544 $HrO6f)"#[0՚@pBfAԟgޏM6> [#_=L.lUż =ޗK*S,"ЂOى[LBpl}w;}u8Ma`'ԩ>Y=Zb µ3áƨǎָ+pT3@ gcu&},OGfN,n;UGC< WKKH*b`ZBPi#i$ULc@O5'pSm*b(6'ZQG;Khl̦?lqwVMEYKXIYDF&H+0T{ܕ6.͎8m pdaMSIQVX䎙,IgUq$hf5lB)o u-t׽7[Jv2X.WkPF||5\DRʺ Kanf)vV,gp&|Wq ˙C+M P(2V#8(#O8?)ѷRE|.5=zSA,fV:X)L^]"ÎI\HĎK G١ϸ76ޤRcp;pvظ*ju|iM$jVmMC~\xa,HI)‡NZ`RXE}:0>+.~|f ނi! %iWURA6\KU㣠Luu ]C?VG,d-M4z@i ibk[rFTJ]Xvc3ãmsM G Aɭ+?ܻ oQ+ JUdh{ma4NRB 2J( pvylMj \t4.)eXJ:jgjyhe"8&{ n.tV\ @0 SQhUx1J΅JZ^5(2F>4e ) -ع<$sG*3"*\C8`_ՈS*HYv(V&OvOw-%EK0ӍM=G%0 t,<3ái[cJ #J&i>fIR(ITʼnvc =CQfWzm+1uK\^ADpA 3IẔYӤ;-ȓ܃Z\mHE*8P:&+%l^4үKYܿq%|4-jW$i1u^[#lvI6u<mn&2nHřȉt#,H/ ҇֍x}E86iW_A6mb`$c3Z0d"9C2bH?[}s%+ U Zj^:Nu|}-xQφY]54?L Qx!J$NE]G[rdeY܋7I2)- LAlzLK\2 ]翻zu9C/oh\˥v#̡tJEzm1}a 8 YI"}&*6֙(9f1훡dWi穄1Ek8V`=/Ou#*LwdbEj֭[wM`dV; Hh#ңfsw1s1]{hݮ#=QFp.XZ3,J;r E3W5Y*v ^j~9 tEIg$*Jु喎52R4P}M{f-CV?oQQd3gqβ5^7Q,ղSTѶ=tu-. 7i?H( $J`z"rR4-6}ZbҲ4*>}]ӜmEF:|One7ZY)/ "j%Y$,h" 7~RQe x&ݛO[IqyiFX!27g:HY&$g#ώBFI6ۈRXedm@|aA44?,1Ew̝'3ؘ̍>75W6srK[ik+hph)jy'L}%N᧡~?wR8/'WU/2=>ri(FǕ 59M.&[u~)DPXޒɶɥB[бe!H۔ܭ.)SU@9qi@''Fډr8>wuXb|ɅWWwVUUrTMTŪRh$fU_ V{cbL^ F[!Sܘ<^6 dgKcG(S;N>M c[a,E&);8d;rYh"y#zڗvo@552*uWc1.]kC򻶳pm]Gkg 4O4xe?HA38.~7-wi7]޸%Pdj ]O𷤟c:m^-Qa~Zo,ئټZI[Y_jF4e`A}=W IjKZFQn@V C*Yqn/3pwLH7KyUS-TF1Dp濕.N=USk`5̥]DY Љ"*VzXHP2<}dbςQ#J!Q@n"k-*UsNmhT̫)Ԇ Tm/,U>C=vs uiiczT.Y&jKG2! +Se2U}y,w`MLcmԔL"4ƱB)@RB{o?~ DrU^6MSƎ^y ]@__F˰jmG0k-ƇӧeNK;%ep޵ؙ %V\1[3r̡!HH{u dr9Nmy{N'-T?6xeT8ԏeVBi>km;Vmm~!ezwYg)$TѶ{WUe&є~JDܻ.81;ufkw6*<Ͳ+_<uש!V""&0 ss 4zF)--N3 DfM,̌!MuQe=1e#onun*-IS87-FO4!NKͩdS/֪͢(ņP""$Z!K '#5iZ⡪,uDOW*bm_񚎧iLlxέ~WTP@*! Yqymd=Xě]J/˔L> Iڴ/j&Pt:>V)^9Hс(oT,Gua]@k0$G64f $QRG2THOif`%I{ /ΩbbTp;5yЃUA^m)R=.P,Dž @+tRQ 1&֑q q{7u_ |S`( ye2cs5VVuD\igwZyhˉ51yy Tm* iB]Lu-Z1 "G :5tu<?ڮsWCU3VZ Mt}OM o\ZRg2v]lnJv%f;;QŖXv:b{T~ѩv]BKZ8j0F 1u,唟rf`}ɾ_\\ԯ,aV[iJ-V30u IUvʗSsawjH*寗|oXh:jaZno ũeu"GX3ĥMKh3mV/)UBygZl|O(vT9/=Žn7[9#Id> Ȟ'LF\$jSޥVu@ nWI8Lt]YL{_3X|ݦj|eNsn/&t48#JyjV8k4B\&*?a5EY,qUŸxNssqZx[ xrQ$uEU:Sv193eqSUjXy7sY-H|O6Oj@gQVOmKlİG-EuޅrQWRQM%6 bFS%Qolypm</nCp]3Xy5?Ɣ"c;yʹw$n{Uyw(Gn0Kj])h'ܭF.HĦ?FQ*qVz-0{7sPJ!sR]gII3?r1WPf"W*‘5jDQuG_j*Z|Q;̙1͖SRfhM,eG-RHc*̹l>yxAm \RUfCo1:@I,Se𡷺V)CD$1qbjw|c5WhJɎ=M R;!Kn`<a!XxlcϏ?7.Kۥ3ovVKی;q5˘TTT*4Mv6pT9NYOV9...^9SxUC !]y]r R*Հiqˇ^ Jer{K+(h߬oˈ| *ڂ됖bu QJD 2@ 7蠹۹(佊IomjKUUI/^e@^I.Y]aVu2΂Hb(5ObLm*E|FDYE^)c$+4Jx`[z@ _4ܵ5Qn_YdC r« "UuTSTG]-EsCQ9B"It)[,u2GF3?NJ_ȯJ,.ḚhʚcE5UA՜1Ҧ5\Ք/A*t9^Jj$hUb2fsޭ&**TV7&Fzf1ZJ ziTwژ5ϼطvhH,L +VrOߍo>jܔ>1ƑTiBOqEqDhŠF"DNQ{0#'~RÜ vumaߟ|>V__t[޺#^FK{\:O7H?ӓn:~C{f68ؕCç;Qz6^OӀHy,;zi C{8eڇ}:x(\-~-zz׽ Ak m9M2Ju]gJ|^/a㵎RI$y?n5=8M"rbF0+`>1,[P&ԬGh鈞 6.SQ2?'^񤶍6oTIDҢӫ^A0='όU2DUL]Kյ5i(#v+ʫk5شUrb!|F͙mY5eC0b^^5k*Gj T VVNX ,~Ξ1;\IjcxzgMtTȖ}e6 "RKU%Ze+Es#8Jo:aps˥~~U}>Ffͤ(/m[>'vbjvtՔxRTGQESJ WdH"7܉W tE .+ƇP~~_aI ғ5at2,q4RAP܂ B?Qe_jzJxǴVĵ,I1f#^[m=_ٛG8ңׁ=#K$j;qjuD#TN 98 H$m6_>y|"U; ;QYr *M$t5eroz7HMH}z^`q:L::j䧏f}(lF?KTp,y<)$P,5mt%%YCYWD*3QU5*/Q@,}.9#WzNsn鵳SHdwBMe<$^bVG\ݛƝ]Je WP k+ ˶2Ks#HdH-t9669lC+S_a6t1ͦЪMRtʡ G1SfE;G]#N_>8'7_֌guRo61&?2oo{9mMǑxeG I{csPj~ET͑/u BV6koW@qjvWԐC~ JݏqGGa@ T^duc%TzSpZJj>qWŵzKtdhl^_{퇮[Z|0gq2*Q1xp5*2jϼShO[RgS$8\%<-"Qq~b# k4[6|#љ}MǁϤ]$oKMT&>AGϵNLyVuyn 5AC5cQFꁀ:}6$m^&d/.ң$3ϧQ% 5yW۳10}Ӿrx6]ø7JC:FS)T vy>g[]!,ۻ3nKr}w6W#KArC>[9DQդs'ƃ]jnN5;3OQ./n>ۖؓB<})/HYN\7P NRGj}2sa75x]ɒ`[ x! nx۾Y.1k;I!:cG6%E RMCJuVp48} lv/|7zdGhɴ`nᨫ/QU=T$R׿?A`8Y٬V:t<0z~:|ETy'\c㶥s mU,0S4RLA" =Fy7W]f_] mvrho-j12N<|@OCUIW3%Dp!Jj <ؖahh@+ A5e.A}Fh >ϋsp;C[wX/`5FWnnLeN2C㫫:Qzu{neat?yl sa gĴ-l$UDSTY] m+ydx界z(DFBԂE -.Bx)4Z?<]MOBCz28NܝkuίKZ|ufD+ 5=3SGl/*O̷~|^G09lLxmY$LR#50XmW9˻fgpI:F>jNuZ,B?@aٟ$ ýi?npKynwc_ʲTj>#%7p`&rtF#Pdv&~O-e&BZ+49YilaDA@NOg[Yv~iK,Lʄ2dcRphHhHڑG̞'=Gw_gϔa򛨾\Uݵn듗Sa\++3j$GvLRa/Aݿ̿fjpu=|SbӴida`^IC0rBʺb~iT{c`IܰP 4q&^p+gRSOM?zaZlaS_`6_&wuoIϗ|Qϻ[Q>K+YDq-rxF[h߆ ]ѻOvST2֢\QDdЭ$qVbNC) w-k k@51A./bROqk~%Pvs۪cl~K];oKR=-6 STV$aOSUD= {nKQOnD-^@8ƊB㷏A*WQP,Jf LId/'Rҹm ȽG`tTGN}u~׽ߺ^~{߽u~׽|+ZƋ zk?zkenꏸ_Ҟ;k׽Uo#b??[…,){ߔOoju>0m\ssa/+^9S@PHo*JO5JC*׽ώĭ߀~~۠@œ:&HmusK?<{ڝCW׽؇]%jH%m;.}@Wل'vj묛?{>L~wj9fkM,?ŧN}?[Һ\u-:^׺{^{{umuYc:~EU5"yzEQ̡Yc2H֚1ri ?ԋsʗ i/G^zi'6^ޥ[ۻ~}U7]M^>@ ImYhJbf6/3Yq *-MJ۴0 +0[h 5>#@p: 2# 5-EQ yU UYCVܽ|L jx(+R'lҘҲ7Y 4rU ?YO ݕ{'QSe6>%V:T5{# |!jl-.IlkDtɫ##SA,eXVe,@'46[ʌyI7xЏv{oyYKݴy l=8,LT%Kݏg.n!VV)&AC-efÑ^5ȭq_[fTlHʴ0H)ib`ވer)EHQ1A LXL1Y|F6 /kTBUbOsdC/JM<)˜ :M} }[px3>Bj׫ZiqRx!"4spEXͻ]jh10mLF,n}ĕ͎)#̓$BV`T3֖pG1;r)k02 h Jv*"Wvcw˓b9jmnj3P/D@D6k(+Ok\>]O֛CvmbA[v;QOG+TơjR E]em{msJQ bE9Sti&%0AF$Q2T_hn,7r&ESE&*jq )V$hQD͹z=&Ь9W4#@Ā(,7&upBSJ(_,Q%&T /u~ޫ\v3#^P#0In E a+|̴P==5=}6J'Lrk e(3H%=yoo岉 -PTjbE =0jG!XiÈ"GC7DaXKU)M,0RJY1 aomD߰`;o#OcfaWqm ,1d!4D8Vw2?ȪE{8OZp+s}3|z6Fy*)%M'G.S _ߕ0k*$FDm0EG1U#<{9svi:[kt ?pVx#&*fyYH$\ݞGsrFWsU3G"9! &yO@:ʔ |Q1.WH *E`8][2ˑdk$R@jjtBHʟ[ېlMB@nGkz.5Χ1?s߹qXh iRT%O?Da 2yRG?_>߆*rN޿3~tY׽ߺ^~{߽u~׽ߺ^~{߽u~׽_U_?Oi=žӠOWզPS/t׽8r6Nw6pFO??xOY/xt|G]ՄFU +)K6í7VUro:x8ur/ğRx oڍgSDu~p9~x6Ccjh'{ʎx68<|=>__ϭW_ϯ{:%ޡVp.o.iyyz{]_/H?gW{8_ 蓨nI'3Vl_rZ\_l_d{Hw^ۙڭQQK:KlU ?fxRTǧUjs__Y ޭ1_G;Wʠ1|\ j$T J2`r>7on-fs+ ZFJuJ (Ձ&Xu~Yb7b䐜=mzzHPIJؠ^ 6,<?|_c5c:kRQcj*KT hsG '3+G}uuQ?1K`msgEk̕Aj䑦SQ^o9$XPjqdVɨY'\h)G̯%؁n,f'_e "cxrI+J,Utr%U iIV9IV#mg},;<:!f__c>@p";yKReqPA=1Z9cJޫ6 $؀?ڏo%ŏjjW4[9HiDӈfU2?s뒷QfC4M!et%"M u/,q!nt?<7|,k, ڪO_Ze4﬒X䛟fP,vP#B -UU8#JtYq4O.rIEZMZHo/t C\p }?S;uT( 9%Y#bu3Ivmwgo.4ؠSN O,HO3nE}|1ZRΥ]uz\.7$Rt-<44$`z}xi#itէ |L~'~kw,ycӬcOΡ+Xf6}_OŽ­y&`ƞ:HT8]r.3m,ʰ6eu *G-1:s<;M f*Ͽa_ŵ3[aBȢ6>F pqE"j&$Z%\w *: 7'"oeRٚI$Q/Xp?vc><:k2>m_q׾ʒ<C~nu~yʮ}cW  >oOo}+`dxQ[Rd滘e3A7uRӂėې-n?{uO;%ȟnƧ. m6a5S\_zw1:q(ms_?_RO!ThKHǨYÎv;\@ )^1GS[#1XEW""n-ž=ªO$iЏJFtҀ~n{ ]{XHZ%.j|Lj?鏟^0mZ7'me WLCc{lZT<[ j !յ çaGм$_& LZ'2 Hdܝ(~sbG"8p?*[7_jCʼ0?i@Ƿz+0Tgn,oc@^”B 8eVo~@ ~P8"('рCZx.WFjAj5h^xdyu­q\^rJXܓrICsg5; U G,$M-QE\Cj6@aU>%_O*MmnKZ>40JDbPRSIȤX΀Z4M;IՃƃλJTUJ_\ $(RTI }>bϏ5IYppğ>anٔ)j)jjn<{U 3*(?)up7JG{{~|Ю hO2<ǴzRŴ:\}H/QjNhםuKߺ`/Wn,#-GOǾ?s|偯^݉قI6$b:{^{Xmvn#'Zo>n_/ϯ{ыr9~x׽*9:M?<uxto&_ҾI#3~@n5j{nO7Ozh Eyu^BI!Ac 鎼!Z/^AI&'{{^QŴիN{m&8Dڜn_ ]IK1JC7pQȩ {d1ӤOT;y4Mx}}=3A?\h$tcC4|T9x>AOyu d p5:`85<+tJ OYMS:TO %L "YLv_qb$X.bHLF؊-uJϔg1SV;J )$F€PqO:yu*qu_=e*oim!DxI-&!iǗU}=*X*1Q*DeeN kJ<87Zo,82* ëԩ ZmY͇ aO4*mkk2A0ɂ`〢 "Ǐ޶g$ _Xn#?uMD񴑤l !I4kׂ.X7zLvC̘S͸Vŗ᫩i,5x#/P$ǰ<ZJ:i >t8#׫#=B2TBZ%xLQS;PxVq[%隚=I]rUrf$ªYK=n$"H!hH)LDuPeP$Ih14EUk,CjԦ=;uVw RB&B35>EMy[a*) }1cG_SR)YXjE<`J'TuZJ:ʝZK$XjC#󹏯{pԵ7qE*'M-WUƛkĚ ia:pn87vw0qM: l ?'Oiק}; ]]y cuǹ`&qŪ1}{+mezJ P+)%k!jE #s;_4x߆R8irBc1"@Ei<0k>G.G3|ץ3b#'Aՙ-И654~(0*ͭ8k+o}.~{Z˽d;hTaddY&E";H!N^sLZ{3"'Q5 a459*K[C8Bx ~jV ힹ6Vb|w~kc1{g?:2.3O⑂ykGnj"Yx}ʴ3u:*(θRr8oyiIBOrQGi_S#r4.`>zu0`oz%]{[vq4X)JZk/ $[9}YZTƚnH)it--4sr*QaG"vuJ.j$A3I5GV:徠ZD]MR/{}}ESU155QRM%(FdWkzB`}H#/*iO+BȨA*!y~t|)䕽fKOM[0M6UT|tkә:TSOش 1vQڥ޹CjɠFI$҂0-) G q_=,:Ln.\EAG%&&k3švf"ʊɢ(şyO=öKnf_%r Se7ZjD쏥cS7Lݧ7+gft$MhA*+to 5Ȯ|@7%\/Xf{v6{lv6ȟfX}%^?ҷ%S)Qu!9=6gYWf:qq0u9?Km~A;wqA"HAV)c&^<|%ѵ\A%Ӳ(jPivjjQ L;ŧ3d̛-.Nӻ_{j_sv=ESkofpmYAj2udKG[]u3i 5++_$;?ڙq@HWCLSPM9zZVU6 ik7aKpԟq_3ֿ})r!i^xGmn&^\~fs S.:)gT_EEn9%GqV͟_Kp䪶)P59,,4E&7 *6Ve[a^T_e EpOMTpsF?#\1G"U]Ojw 5;KaRT &Jye64ț'_)\7xnT:/YڛYҝeͳ5,uTsdC@VNdƿw};^h&(C¨ QF<wQEiZO_]/On}_#qnsqBprm 9M*\DM@eQE-z˪B^XmB N$S*ɨ"KfI5F;(=/+B5ZΧE TЎA*Yu$a^P̏!'ՙ,}m[ZioaUء6ظ :sMCJ`.N Sh}ݱ~~GyǸf75o.ѧZJL3^Vc" TU0GG^ QЈI­qKG *:rm60N qAx_ۿ{7.ڝaWl\oY}~񞢠 /%ޒf'$T??}O.};O|oagd#ȓM&?U\T]hai5^g g/o|xY]zЎmM[eI)ARc! رNȑn=5̌[Sco=Mڛouڦ P0fyS_ph{ƻ8 *Iw@X  T8~}UY*kmnݝ՝OS_?9{oԹQQSɎ\D:G4}.*O?vSm=Jm7fdS/ޅmE@R GyY*MOZ(gwMgʎj Fu׃ exT߷ִ5?eOm٘auml-յ}%FW.8!i$A@&&$yŀ{X=7ӡ]15Ϭ*USH֐ "{v{߽u~׽ߺ^~{߽u~׽\Ѱ{Blx8|7^3_3-zj^$nnX[w\d^ڨQS^ʥ^'׽UW< k܎=鴃zIF0X>過VN~|zTYozij)W/^ bMGOh4^.8PݏW3h \u^2u?NegeV_G> ?]u?ͫgn}NmK_lM,?ůJ~]oWzb^~{߽u~׽ߺ^{>}{{Pw._]CQ"K E5]D,fI +?uhmO:U\\knd5M:ӟ<ĖwkߘTAZ\uW#d:ɥe<,tȡvŻMJ1">3W){ӸƛbyUz="J ^HOǕ?Q͸$}yRWcVju5kzf4h?q՘w)!w`*'4#,C6nSsYiFBFَ̃9htEZzj9j  J+zZQɒmꨩ)JQy!Xitx>N~kt۠@+hI ㏷ˣUp}uH)>ޞ+VIb[T+0?Rlͱe&,O _Z} jpqd .AD$0Um$s5-2 l+^U0u|_ztՌ]wz' sZSɦ و&'2 k;cxE[% ,XSVbRЃ$թVŸ$op/bvPWJ V}k~Γ]o)BS:iPiܻj/ a y\VB֭RDSzK+-q.Ú" QISU2 6|.HSz $4M+) ˳(is$1Z4hWRl-9$ZcӢɓmI|}X'rUE 5VgfUI_[Hz^ Wr3 %U5r#W pt!Yfe9w {FvuUG.?%[q^whcF()tӍ8ף'G8GAY%dLV@Pk/$[F3[mⲹ " tMTIM>J(gcS[Hl{n$dg"5Lt[;8"}:iaffc4 Ddy $%tAn/כ>ykKnPQ cAijEbV8Q`Ĵܥrv`G҃t}()Hv+n*ƿhNոW3VLja"8uI,,_U G5&yV4 R)dt,G s{v$i]??.eg}P5ЕQ4(i Vxoz#TH3Q,Kj}#PpW y\7r_caD4crxT sNLu}.m/=nzuǯ{u׺{^{{u׺{^{{u|85RW?t<JJ>:gC8Pwj1ox35^G׽opAY~ϬsmVN{o%OYʰ@p≤Ě1+#.N'|l"NCpǔMKSV15PKW[T8+90ʼn'&3Q>]/jUFC=LMPMiu^”!O˭Lb)̯_'T+3S  @*ccvc+F6jLvZ؎iU?hPt$:պwEw)D. ~O&ӇBnS1xfG32?XIw^ls=^&cDW,JKOa`G_BEiXϑ,\zosX %+1CP)_Nz 7-}>)(4U~J'&*y*P/-ϱzsq1{&f"X#f;]}H 1Od6+$+B%+צ&-[AK&WnRNشc䎥ezzH RfI%l2V:qq?C"u;M Ac, B+_?P)NC5OaJ< _bխKFԠObJsX &Ȭ:m-.*z{jieUԮ5qsnn@p4Tt2--^>">&Zz$x#x00n z#O:uDLFsMW dYH΍GIz|Xje5^&HRLr,TKUA?ybz$X7lD1.ުWu>BP`}wVwi[o%z/҅MO' l*,c:[t!Hة-Xқע7Ҟ܂̋cXX?Ͻ{@ca&ny^ԑ${{Qo~=+^:T ~A"Gm t/bݛ֚H'"ne__7BFV벊Fcn˧N\&-Ae(q/Nh񌂤K =yyfnQյȒ $|'Z/p*:럹^XônsmpbE%x֝oΎvߛ~l.K5uCsÄ)Uo>n7$AJ2+8e_vIMG#96O&HȼMZ+6%X >]na,2gY$p}zroScoqTHκrۋ_=˰6ʟ{ Xun :48l@!P񗖦DB}ϗU52]2T֬`S]~\K h|i'4&O۝2hnM;O!Rٛj%UFWRѸ$5=4h(tb`[6>쮔>Sn"3Ne!@zmp ھ@Ts-M ]uOqItIwKߟd5 >S> +zggΓQu`u6&j>f)uU / FЁݴ߻<0o6Nj=z~")8~K'57񗔰Y>E [Bf,~d$:ɥrjmڿj\jz}99?ѵY/JبZE{/C-@œEUS4]T2*6ڸ5׽{}ttdL]D%q IM4 Ҳ# =Opf+q$6b(Π*  zcw'C~x*`Wgjw~l]ek\9r,nSpʴ&(<?卶ۯgrc}thu:S=k&Hh!bbojGF1J8?޻#͖޴kʾMHc| =.{cd.!uZ/;T}:wRd0eZSK%4SJҖr'cv';/imnY= y1I;  kƷˤQ#kKܶYHwqM5!EE*InoG)Bwko襽#&:־}C?;pmםvrL>#pӚ*οmڕ;wS 4YI(&s{6g .'WtZjsxj\܎EiUrʠIrGދ9oϺmZdc594-{+/c;RڇGGmk{'3vufj!gOm a2ɔd1Q}&1)'[(;7Ǧkn\%&U36E)/s`ȖRP~رwkxQJSc^ϫ+To z~}E/[txJ&b2;f q`<<+hd 5/ n)*7ORxvw7gr$O7>֏;h6A=_ufݷAX;la#,~2c8])htG* =ۇ}l#=iv13}Jqas烟o!&ȺN~Bt(PQo«Pi&pXxvMc{ߛϤ.϶ Opg~I㍜Ec~}~m;oT {={P?C%X jFno[?s>A-O^Q"ܞ$rOy59}ޫ"%MW^vgow{ѵms[8n]{7gmq~6AkFw[Ӑ=O^4Fn-][= p?ӷ~ֿ۟4?9?oZz@o;rWh?o6=Nnw^Ӑٷie6? p n֏ӐùoZzz6ۿ ;Cvs[G=O^h_n_m6=Nno^Ӑٿifv"E <=UNSy[if1o᭰7j>%)kS׽q?zޗoܤ~uN "_j &ÿwN?s߿m?칿퓯]gMW^߀kKs~~\^ܺ˘_ȗں?Θ[;ZoJ/G^C'-i=c(E+$R~?fadκoݐZXdGR8,sQ$.BZStErIsCOR]bdyf;PQTFOM !FH]B!b>@$؉[ۺ;7|CEI_[Y(s"(4ّ S]/4\{+}Z[hRčs5@ W]kM^U8)aC xP#5o_裁ް=-6vrj.Ȗ f~ y.l~:ɚyOMM աXupqi-$7[(UŻǫz5?TuZe YEI!tR~tQArkĆEO,O#XA.97`*;ֺI>=nX` Q[DI8i[\$(ϧAb@qUcuI SQ-E H#>TEswEW.yb,y$bhPC0#^}a[h)D `9 XoЙ;2[@dV[kՠ<ěk|>t,}B/u:h!ߕ@__] 3DsHFS^gOէ^h,FO}sUV:( ]A_KE{F?6FBʀt |h$W(>Zs/E}cv9A'ulr 2m,u~7ˏ-:C'O?mO^ O;[5_pp%'M[cOX_ȗں:`dczk ~3^3Iez?/u}9a~ jO[⽭?qqNm4OdKm]{_X_KcA[޿m?칿퓯[gMW^3?-~/~ \퓭[iM W^NXks;8ǿ-7u-<9{3P_`2W7Srs~_մlk/h%9aBO;6~>\-{3?~쵿헯[eMW^`2wi'w3ielk?hȗںg9aGO6އ߆εdBD׽ }m֔oq^4\폫]cM F׽ ~~@dmG\Sn8 _8/?O.?.O"_k~Vpw]~nm;CoZz:62vN?ݿ4Wi?s}ќK#g/k_kF>朇?mZzC@ta۟[[N}??{ѧn?i_s}@mdU_䕷SwZӐ%=ƟZzᠺ7I?+ŗVϿ";߿շo7oZ_np ?O= p?ӷ~۟3/9?oZz:4ݕۼ܎6w9WNDf{ ѿlv_ӷnroZz_۶޿5m߶ 9{֞@gvc p?ӷ~ۏ׿4/=q׽ -3/?g w9k>C-W^P=~;+m+??N{m߶u5?=p׽,OKm{ p8~ۿmni_s?~Im= t߶ 9 ٿi ѿrSm;CB?ѫn?i_s|ᠺ6`~O-{FwVϐ׽(.<9 ~~ym;w~朅G=O^7~_n _;A1ݿ-oi_s|_&vO5Ng?is~ ]?޿ [o"q{4E3;woNC7={h._m?kv9[>A-O^(?N#h[? vwUӐٿi}~A?˿4s[G=[֞z,ߞ1~?呷ۏֿ4/9?oZzр{?ѧn?iT=ͿO^h۷No~cշ~۟׿49?mZz]H1XiS$l#R/@uyo$ v$* (^f'&}-EXDQ*|ASAJNBV"}$Xʕ c{..7"֙/^JE<\nԟL׽vÆXǷ`X؝J^G-p Aك ë3*u~_'Mi' }?k֛^`llͩ@6JV=]d|īuO^X295^ }ynmν[/z >>|+9ʫYƆKia1*u~]SLTk7 xjHKiYYOlcAMDg[JlqVTRfղT4xQ1DT$opd1[Ǡؔ }kdrrRXƤ*!UIv$ .FUG|S`˧,-HUO])JZ)rybjjH4bK#Z{=M&1Rڿ/gJrd!U@>oj?թ”47BHjQz I',RT>7$ZT/ $>;|,tt8-n~~!ZT5 #U)iئ$8R>=l%{5$L Fıi~uTR`()ed-qebjac@WFRI/"(ӤNfR yFSqpo[lWH$43¼iMȪOH=8zeSd5gId3]"P]nO~w~Fi֡ܓ$e%C*z}Lo j ȹ([`ȄU5+|ʆq)RHI6@j dTV]x`TY'3m̭m55+OCj!_=$;Fy6_-́IЧH_FI.zRQK$ja0vzdH,tQ;me|;KSM%֍iU] HeH Lwo쵽廉38G5xLz\(49/Pf?U48j`=LrF7]yci*.jOڀr>Z㻥4yf I\`X!k@XPϵ=D;x~4sSmKPAV .}6Lw;Ҁ<:HSf(?i-S-eg+OFtWfPyta$N)&k?SNoc8H i#Ʃ_#׽z8-K(č#ģ8W:s׽zzq΄@Sv?uuxJBn|K~H Z֟>D[QhFlu}ӻOe,RUQ e-M4SȳAQMڇʹ|wZ֮^~ ߷?-{=J}A# @}ݾGh{r1]i<g?佹{~n[Iu;ʼnO{_lS_d#pU_]s[^~r7Q$z[/ljmgOx]yWnfKݭkka݀XtV.=_l}Q<l[^w/{~{(^܍Gy5[o_d7p]r:]=#wcz{iο]iY׽=ځ?hIv\n~uvf<ݧPnn} rG֜Y=q׽K]n{W~nŵ﷏?iT߷/.${y;c)JݜHZ׷?w??us/?oۈ׽ŗx l'H$o?Q){{q-?ONq}ne_{'pS;C n# ~ݯ-?U::}S{ ^ V<ݤ7ZiOnܽci/p5wq~/^G׶@Okm=mm?X?&}n^#aoEl~캰 Zn?_u[zwohd_{B{q˅<=P6ulpҿe>o-?OT>{Go^U copMޟm #Pfw.{RpXF󏟯+~=>nu{k _Ӟop0n?]w[::{B}k ]y=}ѧVGf~x,l+{uLOj ν=fbEgoȟ>~ݮO/mAiZ{Gn?g^ߘ8.a1rlݙU|+ ]ej[pUcȜ]FII!D4+Td:WP+ď>^s;eo6)W *WGYxz Woaj>tbX0WGKk4x$-ǟ~++Ք޽:h0p/ߺ,}ݧ؍k]{ۄ4TڀuO5NjsSWjSj#ݒ2^R{ ?Oa+OxnbzsWLn=ZUqm#N>{}߽S_o:#Xi?׽EvXHX=jԼ`/識zy}{O|]HXUͿQ`} ::59?{~P|Ǽk .HsVx?N*9q׽'~DQxޫƛwcO?ζ=y9O:١p?/Q}4DZXI[:s|}?׽O!_;ME7Ǖ?_uo'k^ߐޖKȭjh.=V7ǽӆk?oL?%J:c03oէx'Pvwcr8tP1W]Xs857ߛ}}=ʶI[zbjx?G@uﭿ޽?%@oxM4>~Fkk}2G@uՇ>ߐA-\'jw?wcJTͷ[}})+%ঢ়c:?S}'Tw`AqNoJwc{3cwo#2[ԛIsǨ_2}=VyboMT{l+HwFWߊolbl{c־XSqݛEN<'=X&ysmk/^~W'gf[H~m7 eެ=;_^~X|<齁l~}}߽-*:3̷/׽f䢭tc|矶ߏ>!]Zo|}c+%{,J:{{ u?S%iW-$\s|[kA'qq=_eyjoM}=+-{E{ ʱ9Z *4UOr;(10Mk`SNR{MV8{|߽\UM}Q'[o}=QAwҌ>|qn޶?SW}~~~.W?/ gZŧSs{'ȰMzqگom^ɨqYz!Ø?ޣ: fnޥ/a\Z{p{?Vo?x+%(^~R&Sc 4{{u%Y/?ޣ}{Qgy 7V~^ǩ+Y9N{Ny?׽(~Dg&cE{SIeͽoǂqeUkbz'^_QܻHǏP6P?B9?oT_/x{Sߵ{+݅s S5^. ĔG1 ME3S,ho-nO)q|,r~%U¤E%8.u5a^ T;̼Μs^6/#f1*䅡-Q_{,:Oc6ES]?{1K1p }tT:0äD-1׽FV5@Bl?{n->.xy^4W{ oߞx?>Ոczp G^&i*r(gyi+(a%=M-D 7B [_gKQFGSQ"0R+Ӗ7Vsݬc*J:G Cj :?T; x?W#ۖ/mROдs?r?u[zj7<w/m9{k+?WIՀ{Sٽ-wU>nmS/puf{Qݥd##j{oοZ֮Gnw^hķ'n85_>n29{kOK'k-mmc.ſ.{jC˛_?W^\_pG7.{|ݳڠf}A>g/nt.ҟo?p[oOn{KldHoAk^MgGܶ?7Q_{ovc[{ߋWool=eywloGx\#~nOj=}ښXuj_/-}{ P@7P\ {om}'Kr]iHV>fw_{jK}ߴ0ݠi+=On5Uv П^{ W~܏Gsvd6:az헷 Rykl֮{w//{}f.k#W?I؜?.=um=GQN/[+wm=E//ik߷um4kF݄oO.ퟝj.|7.{߿l?*vX6߻I?[՗SOm/mc:q=~w?{νe.?K~nU_nmuaxsmn"Ӷ6}^8?w{sy{mu?^o]Sr׵K{C,Wtp _.\AujQwˮ7^hAGWOni}kJ;~_]s[g;I#N77ܺuox7/.xioo {]5mT}j'Vop/{߿ҧi=Woy[ڷ_l./2= u׽Jݧٽs&n~?l՞^u_8׾gnf&v)kX?=܊7.c֟[p[/n^*vNj~w@^=ܺq9T?&v'\oޯޗlߏ.t}i ;e_{hev(;r~ZRcmf]m=c6^Q7؀;tOU폶<3_?W[\Opx6~W_{'iv3G Hm7>Tm4uk/?%ux[P3}&,=uͳ-?WNq=r뮿mqݭ^to.}5[څQ(H *0EG׽~&𥍇 ?ۋ{b:"{mMNAQnEK!`z^Rmm[@_=KtTGIaLko6?qϽD{=5Ǵg+~S #0B=7O:dDQ I}}R_d$qx-?56/Cnd NO^SOSbd)R?_N_Z ln?Ć ϯ{AmoOm1xZ_X%!noM巻t &\$᪱,!I ` 7Yo!cTWP ӏٞ ?[$Pa+6Lt,eFKN$ u"?nzM5`AE_YL@x>EUo\mڻ=BÁnklt %,hbM<{~d6R(*D9+a"^^$v&pjMN8R:lN?M+)$fFO,4M<~<m={MÌYdpQƴX-dp]oz᱑t+v5|Q zTRfѣ}k,g5ұ4[ٔx))VGWYOM+%W I䙵EI)/+s'=ظ CI!N',E 㞐ibDpUFjjJ*F@[m\O Z!aXљJH5~JKuX+ !RBTH =.o%3?WdFM 4iaKi{~= [*j)3RΙ܍fJ&HUDfnvJm/jҟh:H-9QRh("Ĭ ~EƦ?ԏϴEi)i(qtR=(?e1 * B05bn| 57XǗoN(P7t%IĊ :RGߛ{7!qY jx'J1rG E=5D_"X[_;Q"S4ȩk|W}GRZ'yc@"qp܂?n=MPmM\-$kMMD chɑ0^7"]h|ZQQIUS!4,-YG̒^N{yukj5x=RًTz>YkY~=cGw,dN֌Oèr<~8̝JM-$y%E1yR&y2!rr*<^c?Y$ bp5°c&]`- r^ ͉AS%U@g{ >QD4}8gN(B%\S d_$ÃS&G*|FQ=IJ30_yǹO+A?X6pFt ' SʸMks+ O&bK/v.Y#G$G7Yc)):Z9^eNS}kUaxݥ[zcZe4'/E[57$sPtd|F:-]V蟲}v6eֿ_x{TKn;_O&O&EsZ?[TvY;? |LwOdG;OE>{V⣙6/{m=yq{{v5+q[j=͵W, k{- DݐOvFo_Uqfퟹ%qoB^]{#ҝlOSvIw!?܊ccjeڳ/t9q{ EZSfx&em8n_܏@֮]ESvH ܉rE@ǵLJ2]k[{F n_^Gu7e܄Z܎)ۇok872_]m[:s`uq$c2mcr ȸ=Yv/kl}W s@uq{GSvP q=