ExifII*=(12i8-'-'Adobe Photoshop CS5.1 Windows2017:03:28 08:52:160221=(HH Photoshop 3.08BIMZ%GZ%GZ%G8BIM%pd ݴHb8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTDocuColor 242-252-260 PS8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMO= 9781782211655=nullboundsObjcRct1Top longLeftlongBtomlong=RghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong=RghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?Ӡm:8BIM8BIM!YAdobe PhotoshopAdobe Photoshop CS5.18BIM maniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlong'HLFrGAdoub@>FStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslong'HLLCntlong8BIMRoll8BIMmfri8BIM#http://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$V7F^/z| %5[Ӌ]\ٹZ""C_äj ҵ)-APN a595iA2G5:rTk~=:f333[^neTk8l6)U0Y)I^@ j+caAv}v-KlC]KdJWhúGE=,eC TpRM4@b7bᅲYfEC]14xTto%=K!wC::Ԏ[fycVHjKX6dQ!bfǙ**Ր=%S[HYRn VKr Qqmu^$UGOQ]_c11MKT9ZZIRh #GpJ&Yj% V^ziJ߀DuvM cwCQ`WN~I^V7:4*5d)ǣQVc){#|f2GF3IQQRJ39B}FR+HRU[i-R5y~` #d,k$$@rmMHWNd1_3\yH!m4V?HMfJ` 7XbU*M25Ur*jF.W'\儛Xoj-l.e] E֕5GJW:i.Gб> ,Ub+fATvPVZ1m+qzS5L" [Egg&FvfLigM;j*{|TE4Q\<_~NE\~*:dihj+5;FWK#ܭ=eFGWUV%-Vds"KxbUx{ً%Ұ!PRDZ4ZNz&۟+*# Np(RDIg7B o3`3ۤpC?F#RI@#X0IY h*x>MnЏa$WPaDHit!SQwHak>tKUVa]Rx@N=ڛ?X4UBdJ jK_x~3-w/-Ÿ+/ID~j,,#pIJn]n(I+WFZņN?^7T҅pty_2):'6}GO#Cf1.mA.F%,d]qsmWmIt9X(X^ *S+m,#*Fn6lȲR8zE1`Zj.+ ˈT}UMI(Y)p5A6 MvjfEQdfiƒUdޚA ^)UvMg.bPAQ4wˣM=P\Rzi8Syyu3㣩a#$ 3# 12,8n,=̓ۛ5mǎaOEjHPBKNijIGoK2 0PqFԵ81qO j iQV#,r3^Vy뽗shn^Oy$ty\uЋW礫vE"Wh;` TeSSM4u98}ܑգ.FCpE퐶di"*"TH*U}*.AET53|;r[bx :Cu(!K%UicvCjb F%?ZVF'W-x:QZTp}GP9S](5 ktU7i%[PK)8@8ucRK֔5+a5kQִ7fNC3;Xw6 NfqO:ϒ4UL?H"eۻo]U$TEGPҘ*^/PjVOm =Z4i)-b TpkJTK]e|S'IMOܯ-<+3AI:u(R$@(lܶڊ YM_‘(8'5 KpBrtmgq[M2H* I P3R'_VlWBԶZ/ tVo'avlG9U,+0*[ؗjmme~wS^"fYhT5 $`}k&|(`wF 5ZJH MA/{hZ!4˜CQB z*29͔7.pce.R;jem( E,oDx]хb-5˔nL ~MtҫGMQ=:Cbuk5m[xC4j+ F Eoϼ9X~!='ӫDKՍ:\!cP:G4LlT@0lMSSB̓Imx>Xk#"-{d(y 䟯 v??MKZoVqB)]J/= :uCGr9{^mػvfzy^#ZrK>)f OŢh4LrՌou1*g +.=z}.c,5?רRzVT4[$\~^ኟfm9ݵ**Mö1<HVF]FX|1nC(/^Y$j#U-PnNdCH%OR42#t fE848Ji3Ga^`〚(h' ZPF=L-wt|ͪQu74;Dt(s^\!MD;q^,a* OAO cH&رGz`3U 7$M#KJ\>V%xcɧoLue, n|uGi8׏^u+rx qN lUPY!Tj$=>uݣ_dtPؕqB nEdyhXa@}.WYr,DGp_IZih:<7k$!Ok6x,e%M ZI rkM2UOP>ۿ~>rx,Ԗh'rɒz$% O/DG^B7ܑ^`E4d梜AULvԣWoRfii3{LrePT@^C$zB57ʎ;woQQ#]OVձykREH"UH^G&uUv6E!H )>`Oy' }*`8%l?};y-ՔHł::lVҐԅ !f-$bt=mI^+]:}MpGW\ҝ"i$i`,eǮF?@{MA[g+v6R"RMIee5zN$y46qZ2q'-|ܗSHG@F|uFFd@YnY}wT^or-Kc/Y{) 'dv>ftOJ r'BnkN,U\0F (+tׁzQQAHƀ|YS=vBW3P;a$f`\YcoS!l 41 QZ<Ѫ:Sk҆f eX7HU'/ç.w8P4:?Xz?|I7.u昨6 _,a{~u/Wu. -L;i`#Q*G%0ONt+/sU527D^;*zjWi#>>^? [N.l*TW!JniV2ͤ,Zo`[b8w.8ۙhڗ#"ldŎ53V}cIdp'巒T->6qeG-Ço+s_Hi ]I1+#R@:#Md^? rKZd(ħh(I#O!E'/;::vt 'IM()ޝ9 lVKp[jSmٓ\mGp܊OABhnbv ?c *^YPlPfT|q%KJ-WJ.3?f6P`T}X\ܸ,|5i1MQ]QG[ t%2DU"DfͥqǬwvQmQomL9) 1 G5Je<R;ZGԼs >H-ZF|IzI Β\ 1K} I-U{jZӈ?kR(t5!<>˴;  Tp'obm]_æz-1ysq[["|?CI*TC=\(!v? ;NzIWNuK<$q5>@ #dyw}]+qj5FR;H1SK쬚PkLcI>LuBUK,utKëHx;pEɯu.;^I=Lp )"xxGY4F*@#-_@kd./# XǞӒJ<ewU=Yj]}.^ȖdU8m 2#M:Kt-vdo:-{if/V[q n઻tuǂq;-TbRΥc!5 5"HHF* [u穡vO* #COTQ&I:_ޔ,l>aݛn]n!`yg)U$I fbiN5;ڙJ:UT튝ƉڕdmoI!9H飝@5˻F1wvڴUX*@d␃S xhHv:DF/6`C(p1 UȮhI;Kt`~@QEٯ|m&/q3pN$;jK6 Fn?,$D"D5j'>㶤>?1TˎWN%EM[wI߭fࢱ#U{eVLt#>xPgJ M3h>Zr9%k%zpA w'i158IH-`|}m4biRVLm[ǨA O˻dG3ulǚ#˭]PɃLQtzsri'a:jNHu {iS3eo\s["H%ȵnߨ:CR.-ͮH0Ȥ mEIQÏ!FfUK==$eU؏Ab/ߛl#X}UUb(I*SQSSE RL9ҬQgrl_#hM-RQo_1,ySR1xa;y#I=^T6G$NqmÀÈL C5U,Yu4_R>c[ؤ!M.{J)UEJP?HZMB|qJ`'׵lqk v}Gwwm㨎Z <+}.Aǩίdw[xLr|:p:qqҨcX!G_ϨP}57Ћ5SSvgKzcrQf4fi!KՅ%6Vy!PGU{mj5*tIWYjxVצ'VQ*xeO<RS,e W\f۴9|z}Z@9gv=efZݝ %Z#; 6wfSb=ҙ}UnHV~:t;};*b(V)~D [W#,=ۻa/Zf0{eg+wW]nʙ#T+1{)c)ԚZ-$_ 8=uGݏ5Z8u>c?3?"7gdPPK/ڑ?;#Ac%V%,I,4Q:Xa *)GK$]/ )!= `Z#.?98?>f񴑑UHx:Jl~o(֯;kVӶp/&)0!>OS#f%6 qE m-%{uȒ;V"FF[I1V ~k~8~gXGLvُI,`IPE0y1VYu)IHQc#_ZK.^+XǯR]MV"6 %::GQYLs21+)qʇCq5q0#y.D+J}G꽵_7G$h9,MP)#a[#=]T] 3+rB0ݷ-,!R*!Zp/ˤka$ץq>Ef'Ҡ?Uyi3;&#W:ϭza@!TMMKJS-USΚ!*Ҵ̬GcچpK"p)Pt}X kP)ˣTc(GȑPC4Xmdi#P+SUSX5c0CO##Q'үk*0rMG4TKQDݬ4ܯD\~o|KL,|Ftȵh R U%v3}]C 4FblrLV7PE3dpM-:&eyd:UMݵ{#U72hI_t:0|e= x{EE\$JU۸/R$@?Ă~yl]˅oijjZVCAEP:XUeUXsn0}vvIMC:7H/m[)Rɔf,OA  4z >.:5[`>!U]|S^DQ7E tZ1F yHE8 zh\2/~vU+Ojz*dĔZ6FhdmfU!ԅҸ!Tp.j|c(= jVCQ*A| ]oᮚ9(sy,tXfQ{$̚]EmQWu_q%z}bJltTUSRNc;^'H%fxڻxUxӈ h-,uHep[.P6GqMJхQ`q[5~ٕ\3i`#?yJ29WK4F ]Xk" W}liOŃâlk)w0Tuwjh}0zm$&T`ƦiM:M3*\_Be-]FWf3WjiF.5j taeki( ^U*@>F+ge p0+QR˺+c3AOb2 s0HO`sn}}ᚦ,/>IYGUtq4PcXʒLĬdnjդfsL{~^eGi4Xtָ<7a63`iIj a*ن+>9"{ww=.Rqd5YmV5S-55 0n|Tү'GQR}Btc-.t'O#+MvM)X%i/ccRWkQőq z *2T#VK_X#o9sIJ85FdGLB>LQt^)rq2cwY+&k _QCzzTl$DZW9ݛ~e6Ҿme'U1M+FnO;*lqvy%\_M|>c :I[0i%p[AJC\`&*@'&^]݅w|MvebGP $y, Kc`6"3ΜsغJz: v-u\Q:א4~$#Y`Pc0':ԜoɅ#U4:5$ׇu(oGY]UІVV?܊ 2H~,uK 5ǖJ+-Rmj\X%O<}}9h)u?zdy7-Ά\Z_ iOQkm QCw{?3X|vڸ틹V[X`crj :ͻJԯ3t$ fG#R{xŬJ}|?.:\_E2V+?ٷr$Hx6H=e<&g$B<#S6kzٛh*ޞ<~aeltFYR 2Jod7nTEF }={o{GqCE#NQT0,洞6^mۻ)ix4l-\.J]F@X6pgȄRI>u:2^d{UWIMtv5$!R+J F*T 火'l5mv6ڰQw>Z"gwB jUE(нӂoRYȏPh\EGnxf'K:n4$ZF2j:zGgT?+BHU3׵Q-FVOYl/$/i6i|t p5зD}-sȫ|0  ~΂ Ցee!UPXLRlN FGov'Ӟ9>x!ro4Z`GWMWGY=QZ!%Q"IڬH]̼E6*(@:-cciKr0eF4j@']$%}]3E,Bp˶_1qhtQQӧo_E :["nաMO>(dq1gcbO7{x8}b>汱|ek)#9>Ƴd%O 'pE<,SnΥ}\oP .zӵիAfCѮ0£IĔ+rO%>6eA#E Rb|9tL2HA7uPtb6BOZȥtVYܴCiPk#դ}ެ59LĐ.JBy[h4c#=d&!K,3t2mTo AZ먀\[O,G݉ D JB-r@P9?@/og.d4&hS,ͤ\= C~b>;**l^;qﯫ+siδzv& ww܄ Ss }r"6?1O>Bէt>RQN*VT 9S=(7s㡉WL"PIR~5V[PY{#UUYF|oOo6N@hؑY#Ӆ>RTSF$d?j֭\ۃ/aji2O5Uہb|Wuxj#P4%H{CiwU&RzC1I°}UξhiA ;xCq Y2Aᖭu(j~%ÀZ@p+eٗ/48æ_s\,e4ThG$RC' iϕ[3ݡ**ڮܵT1?gGkoj7E }j#@D:I )Bݝyv{T QN<@1d$:4so6wT.>I8|chrQW5SEVqlW+ӪG2L>,$MRmÊ5ǥBELPRPBIu69:Ha]fmGghouJmA;{hWQ2Zf=OF!U"KGVDIT#C<R*x?QHd*'lJϳfC5.o"d(`T:ʰ Ht!wk'" #76 ὤUh j-WJ??%-&դ͕o=B@D5F!b&<7 $ F{/zVp{F;hψT̮4ɔLQ3*3l1 :5_Q,5J1ܥXS/mv<๔U-P -RhmCfF:zM ke5F.7a ڸD?Vh!uS*%J:}a~}eg)I( zdK~ =&+klA*`JyE>*B%7>OE q35Eo2@YVSގ]%t[≁4~*wtNg |jC28,>cFDM-4C4r-9 !6*ȥ] fᩛ+)A32 #KI$26yM$*'XD.HfdP#+! ~*JONH}r#jHX IdDٌURn-m}5SfdXO۬mg 6!>Onv"TKLs6,|±ԉ"1U4,ŕX{.vpn{o#/hCF.tD1nD/d$|?^CGU#6AՊ3{6$|~>͗Mfb]7ʹ]y,JTE-\`*s-/Xak,;x7)W! jcɮ=剧; \-Ur;T# &עڵ9[zϸ6ogMOok u7WdE4 f _&>%X/-oerܛJ76hh5ʺuSUQMOFMɍT!O.-MxN]6olm7?w,*kY$flu}*I*GHXrqܔRR᫡!=d9,m]Lu*("H"2ݸT sܵ$689 dB5%A2jUܗb&Z7`8U|Gf66DdN|ͭyml%~9TęZz*D 8oY+vv^/#Q-U=TZԣ])ie:QeaU&o[{JL[ *v#JdPPԠ?ї}[$A$xTn#8~?P 5UޘMreŚϮ$p0km`={pF{deTյywccl[B4`FaQa5xAjCxYWIu`A?P>6̻/;m evB(]59jhPhTVݙ0<߼mk蚭4Q{yȬۆ K9 .Ii N*@ +F%#U+vtVݸ~흓ۯ{}cq|%?^a0SKO[nJ:ܱscOBE N)g!ZcWSB2,P,GB; aoa+< >GTD**Ti1X g\rw[^k]Jm#Z~ZySa542QօhAoNcHr4FeD4Ur\u[0\go920R{E8wF<25UV^>LnޛA[zɌlL3T :VI r}1*?,TʰGOA GbESop+e2sl; 1BX"~F?!o>WUx?>-mه|! e@d$wZa 冇I$afq+VKoW~˓fu 9!UXC@uYr=9n<@I"`N,@jCZI9 Ï>l[tki,&N)fEGLJY"!_MC}%ݴ2!azdGOX<-cPRH,rUx/>>[U1K*7%V#.F{+~}})yDI, !ꫫZEFEI'˖ʶK񚏈X-JqI|so3B_ϝwNgf7-uZRQKrD4tXx[#$nlE _0}gU?o]C 5v2 >f$bKߖ-dPĨ jX j<A駟qBU]ݝtk@u^⃢ slv;bw8\}NY|K GeN_ms9$w)Z5&g[v4RV.&S]]X [L4\I  PDTd TnDTIaۀGV9 &8ڲ3DH rT݂U's JG`=<5C;d"2UԵ6 XrՅ6d?4kR?dMx6r,7HXQNA]T*Rj/p]zuUعhG 8R+tՔ5)i% U93B}ͯrm-{3oF_)蠫o;%=7%DnZ{JY4]pȚݜ1C& G@Fh0)bSn+Yd5cܥ@r+\M[:ϋ{|No=Aq}.*3oI)(j6`reY"jɚ!st;n\MI/f144NCcf&0^Z0ȗp,P>%1@<@[PiR* 9M{A&E[ϴyӤowEu tx؍=-TjIyLމLwdSf綦zLn;RHңQ@+A,nX]H߫1ls<4/l'TAEAR"GիQ&cn/' R?òEjS%2"A[tWU gS$,r4"Ti>5AIUV*)q**B*pk,O"ݮ7Ka<1;+xЕQ6KWWx{O,p2T-P&O$ܬ #ܛr<[ӰۋQǻ||SFK7e-$ 1HV[=6hh[4K,wEٱjƀ>1z'jyzld-C̳7d}+7;ؓӞZϹnyv:+h`ӅOS l#`$ x_-w-]C~`/JVQ\ 5!~hUC5FUhbJ22̢q(4?{699! EJ z*JL%ܨb?#+gv&_SgvяDQz#eXLhP@{s?x[n<0Ib_ :05agI\qSG lډᥪ sJyy]ڪj)7W0YEZm{-&*[25OpR|]l)#ǕH*]EP,ae^y!8RqĮ>>cIm@+N5Ձ^#j}zmK)qoQ3iILZTf:O6;lKUnm8)1檻`Ԛa3k H|u:#sG*)" E+D!]FVUxϮ8In$*|enHK^HGTcMTgE)frA-޻iVII/mJ"-h45q@AIPU7_nW/n(. jj`tȏiޕ(z3H4 lF#ԌGqFGL:ACW Qx2Q4N(nC946齯[WUM[}݃$_?UȢHƍJM7Ͻ^4Y0缏Æ_N}%Rb[TS;>Vk# L TjvhQ@ n5~}9-8,QlY2aHcX(3ks^%Dq.kߨO{IŮܣ: }@?b'3t? \-]}Q*iO++-}]TDZRK+렁@ ~#؏卡m()e^CGA^⮒ Z/ O\cuY I V05+^C˧™|@ʾT4'CZ;Srnݑ)W_AWIA[>/4~Jx>)inc\ jt lU׻O S,OG8]_7\VD*:: XY\Z<]8ߐWUhJG3c1I$lc+m6,Nt4'І>/[s Qu}\Xg`jU: 8qazI)15NмљZ8QB'u}¬Y>.nP +GR)4$En뎻MUsOb j$5DMU ~Ξ8*3Ҋ'f~>c6<U"5*xXLWՑ vM*TRR w+h]8ZU2Hxm"ZR饩jO]p#kK;itBBso?Bweu 8uE6ޣ%&ޣdO%cx 5\K}P^@Bֽh?Wqs9d6)OMJK$T4 {4cI՝MJ|L]ڙ,CVa*vgO!}]u\bƚȪ;p}5 |k:;փjy|I[SBG tU U|f豢JpMS,S$@"q's:Lso,K'T#JmWQ aMϾsKٛ ˹49c] HP OeY-Erg_M?MM*hu܆^RNjͿߟf;hv7XaL *PjukS 5M2IL`,V99b7l 0|HqۨczC{ݚN|~ FQnySVES#NfgJSMW 8Zy bD9 ȧQU/d6S?餟iW.T%&@RWKFi KLI f8n,v`UjQ5+ЃF >\: bt65)N*غSVGx*Vfu?>HI ,'i3=9"(??$mQ6; ͎e*u<OX'ljJ8Nh) Qf)Jln*jz8!k#=d ~Z(~5B¢FiЀ{ .i"9>4zن/0S>UD<1ƙQXzqqb->͗ao_n>~fd!4 o%4085Y]0aW$J %hB;-ܻ4Ieg.~9ᦽ]Z Y$,e7OBLEf(k,%d^&T ĝ*s;soRc6EMUV?8b4SOHh<1Lu,fNh[J@aƟ㇡俸б)Xێ?]?ȧSH=:AeIOTOڽ9WLH֓BIĢM5#ƱU_:bM<[ĢE<醺fM!QQJHa3$XI-tb4l^Ks^ ѐ!_)=㎤BS%.&BC@ݷ,w?ڟ |3'VhN?èuaQc8RK!F*nB.K3rb4rJo?FxPڐ+ >ϹAhGK1ch%/^JFUԫ~0yŃ;o~dܴ2rTs&]&9*t~eۚ[j=5:/.rCyӧD0?ϗOJ 9F0:kߝ!}p{Uux^)?kLQwXKXY$Y#r?Qʖ?p€/ï?.[.YWI^SEm1 mzyc'z읥3͏ΚNd*1urԔN21G~?(XvpwIZmܣ*4Һw"9a ?oԙL˯FR` S~>.Qax UX az$%IU0$|rQuI; i} kne_j='Ǐz\뱒SakzE 1CPeL*&M5UE`$e>)2popCsf롪:wj0+棥P-> [b>Jp6>&nu8Ob{٧/۸3J!9ʘq>J,J娨/MM !ˋmKgf:u| ]#Pu4l;r=?^zQU*IJwrЙ3-_3v*Of͉tJ* 1Yݨuᄦ%ҖDGavef)ϝ*|5n$?F3n L*އ?R/'UjۭogE6sk U]Mw@rQO@C'+KI_NiotFЌ':=kOkֿ}-R+d_HZݏI j? s;{&;Hh7sO^S/ddj+ԡqgB}-iMvbVB>dSs, z-ڎ dhb/Q"A W}\Rvnm]냮dlĞt]CoњL¢eJ>q*+R i\{tk9SnsFvxoAa&30(T N( mU=eI I,lJC!0 =]Nr*OhgZ F^Dd[(MEiGMٱdqiedzf#vwJxt:WQR|ԥ7MQ X=߹kݺ-6Kټa0RJ fWVV!lԠ}sJrl#%|U.C,Zjj1Z[aa)ԴrPICANDjv9x䡊Uи%3kCCt}%MBOf~IcJuDjXՖtu6O+w }7fOv۝i4W,5p ^*rp:;Q.@Qcb8ϵ~YRx]3i# rMPyr jI:VBGZ (`4mw~_tO[cX"+Ji#OZ7ԇad WZz:(2;k1KWzw4uTB) hQH$\pyob9':EI K~@nwbAAB;XA +_>Y19ltN [I:Y)*bi`wfQ8e^ELgpTƲS2[I_PbZhr65HI&M+ lqɬP+T ʄy7^{+m BզkM!̌YXVVQ1d9$6<6=IgcKDXڒZq"(]/IPli<@zWP%m+RVK9Rv)m+ U`D5){T+ƪQ 4: ?NS~%\^X1FIvCJ[YJ(ʌʴRNB$ ubTKs T,EQ鮇M ,kL7>,Tk:6Np|@ t5.ͱ_pWG9IrtO-=3d=240<ې}1KUٸ{WqlU$KdI9.:<,%%p"GPgKSWrI^2@QM|FGM50p:ÒزdȨBcqh-)3XҲ Fs`$5+jbcHǨj{ D75fZiIT# G+1ĤȺS#sAnx,9=\Sqn+O$#SkR*kDž,ZIQdKo5]K|r<$GQ6 B *zYq#>oYn1SiϏ=Vatt;FDCLʢ53-qM"4? |5״mVXЩbC'H<)äVQnyR5U150dAYڍ[|?[@ J]C6jQ`q56ZI)!UHxT\osv}Ϲ4z ~J5xֈ϶X[4QMKWGAeg n.rM@:IȎEv|vcP>% A C5Ci%&*u%dZhR<읶u5 H"ڸԛe5m-^eTdqƀWJPMVRąO}Ywu~@cwdq"3IEOEJ$P$Tȼ2+WNHkEpQC͖# xs*u՛oŸ1QefplE%* ޡpBh' ti/F+^Z πe< DO?s-S6eCIWWFRDIdH~lp ̄eU%.UGvlz-U=~?7MT*C6BKG eX}W6BJy( 1Tyu%mkDXƷ6< {Yܐ|C:)GI7F.5[ZGlɴI HӐSAYik-x⪜t_z-rVu NjkZM*\F'Zȫ4jFnFG*?&duxRWCUכ¦Z ]R!IV))$idaא #h.n֐"֢KS>G֕IZ\D`N@iJCOgj6ċݒZu9EP+e}{WAcFE?Hg: ۭoW J\P08A޽OgUi!HR:(vlsC G\>G&m+(jrQCEK.2j$:)Tfr>`۝n-5 M,A d${r+ghv"3G \=݂p: vu(44@!,uy/2$PT)" u torϊ,rrlgJam L+MQH巒~n(ޤ{FFS-1xGۥە\DDѐ8ޔ)S !kI<O_b $[bJ7EN>]5<-ȂO|7w2j{S(+Cn2ֱJ#]l1r1An V_.XAd-kst._DP䪍)23i{X\yf@$[+Frpz!lU(!P-"3g֌ذ I&`MD!LHަ?oI 2Nה8B:5[FXB\:dM#KGſ{6?~*vx?&5g[ŕ-/\A3U:{e [jֲ+Ӂ>UdӬwF0sPq58j?oO̽~&7qQˡܙt6OݕؼPbqO}CSscƺLM= LR4G˭ɸ+",TuG\ɰkoi vR* XZ'<I\e:▊)dY+kpbxuVeڑ!Q%t/'<idt-.KwaSKJ X@e1HuU}U[@U41^F# M[x*m׊~*5 @@lM`PJf \KI.͛Ex .vcVz*ڵ&܊e z,uHHfʭIUDfeY\Pj)n%ЍʢL2P򦇡5zSbwVPoqTTj)*,5ݸUUR4#¬$(`ZEf]7|4yia7+j/X,fĊ +6W\hXp ??~<vٶ筈ep3Sn,u_piRdu#"Z6BO* ;@᳢ҹ\R`2:ɬÚxȊB)a#{2lg:JT5V*@qЏY \U5G*DSQrS&XGX~ yu|ۯ2m0WC~hXcz'c}^HQ-9=֭V.Up8D=\Q&?0 j,P{:pt+djV5dQ CTw#MA޻ `.\U"JTaRW)Dy.訩p=w!2I*%5A!Yw`jA$r5M[RM6_>?B?u_0=)J@ؔؕ5>¯&WG6zUe#JK+y4<}7,ށg!hDh; 5ʠiR4AJ?g30+b$MG٤icY iIYryl. [UQXl}NiGP-1:euZ)t#˶7>3U5 b* 5gVldV{jd|o Ge읫 wd%= &Z<yT wh$z:ULHVֶ<6? UjٿWgFY*Ӫ}OKCHI{(R!v9M,%>~uz2:(ʲ#c-JH{F&9%DR%!wGd[Ы--/E6}o= L M[ 4K1(,82|w0l2_qum5eaOR6+Qq]Z4$| :h9j.nz'M=Tf?TeɭK:JvIJ37M=v45UZ GX#2Hى-~ Mb--At`4jƒ.Q0QBNASݓ#66f$Oz=D[g܆g!H1Jdj)Lf3$N9&[0دn)Z[vTfpun:OwZfV ROAS-5m6v*H*:ȫ3~X@dG {K~mZze49FK$ayo{O_}dE},t#b}8p]P~uM@ V$!ep B梎TI#GSj7VJlm&y|^/bce1u-]V=r8lRADIH QwTР3L[~$tn,t Glb2[ I)ձ{On͊UڥX2tRXIjK׬ZI)TVP_ Z8/­\yUŽY̴~=kQڸ5zqKڹZˋ~p#uzL&g%5"ui%}xm }RA)i~U\~B $Sh",PHuxP&y;Ȉ(E@j?u.G"cMLM(է](yl,QIQ"r;4ɩ}&Ol+Sr0`Z2-L"4,+iO'WrYhՕf/kS㈩ySwje)4\Q]Iy Hdz񟸱vX墬\3NJJU^SQ80Sde?[{-=riC'v?:ZV |Cp$ۦvKV_ҤDY)~T̄ՍYm۴ٙ#4Y\Ee(*積VB|^I%Vj7ޔqӵ"(r6jb4ͮ9`arcMK V-LCU~mO.4OeOnN.cX:X+d tRΒ,-#kukvE"-'+b+u T ޗNx<[9Q5ZfnGibsorkDPdIIGYI H̷b폥ڛ>Z;~UO;7;cVE\\'#Ďtc6w#[p*}/^8sFI*W9N soDѐJM/[*̼x7[KO M8]T_ZΒ;UQ+}>Ncs'[BdXKrbTL\oYZ: lN:j\GV"dԬ1^uܼ!>3)B"=[St ]7e,WWQ_:z+eXӃNkԕ4PSУح1*ٱ4[U%S}txlOEϺѺ=qf5;6gsipXK2ݪ|3咋xm Ll&gVn^I"G;4p6તST#KIZsIiA$:VIv79w([WWc@JͧeO)xb&gAfϫ`WĢS$̫)3UIiʞHjkBֱůM&C#L;UD[PRW BKyuhVH`xH 537qӍ])KZt^8I?.y9qjF !VB㤔)s3- ??K2(/~ڛP34} v79R#QaiE,jDt5 I9bo&d5T:*J"_Px|tθSؘfv`w&>V'>~ldI,.IU!T4qGOE'ݚ|p*: _ZbP'lI] *. vYX|BSj %jݪH'9=w&Y]RZ p U U_{Gw%F)e65l#V5Q$nd5Xn2XjA udG$̴u{I*C&#Hב #KqqmmHYf:x6 IFK5$҇ة}ˣY.ѧ(MQA]E55+UVV>3+BR&/ A7[rYWx{qʛ#TMU4@ӆɈY^0‚Ucb7n[U;BDecJX.¤S>gM[Y>ި mY1=Yg^ȧlc)%f; jZ .ry#rNu A ߽'SVۊi6cF:uKc!UULvf(Ninhу35} ʁhQ#' 805d,Z&TXR~HH%cn;p䠬UQ \9%XJ5B V(QE94 mKസ*ʵe -4S5K4F' _RHZEM5}5<26 -?j QhRȗsFꚝ$f'UP :ZHiS@*C$+ǎ 1$sf9tnQٮd܉ꮲiŀ,FkCi.۰!:I'hq_JS~4sdv~Sc_+WQs#+0i1#JUP TmFv|4FY.嘮 ۞}w1:ߣ v4xjjcvGWI_%NhMu_Ձe(mEGP?H+L q'v݋(fs;SAO,kBΫ.Ef6RU#P\Rxr"ƴI:rȯH {w!%:h e`n&/3d'R-D(Lz8W)3BUg} YUrnLfmq/>|>~~vHjy4T(jz}12nGj"TTK bC*M.|͌le}}')}2BAG Ơ_QBc2ءt$DzA:dBdӀ$p\C+r4:hy JWD>RE$@nu Y D(|Β 8fɱDosI|@ީx{o&.m$ P͸1Id!E4I$& vU`Z5PkvVEd $mKY3kuJR]Rob }ܛ7 Г |sC̫)Xet[O5zv.2j+6I嚎F~uP4 rÏjVݕ+Sm%=AM_"yrʄ 0U!}xsnR8dX-IVsY䖢甋 Ǔͧ6]lQ/`{XhFrI"W>}w8+e2٦PZ|}K3UD x"ھ^r,;S`*O 4ӢEPnE( =syʀ[< A%T+FW)Akx!BԟڣV=ϺAW`SPޢn\LpÅ8sJjME;A$Lr򪢣{ *{k{mSٌuUj)\"@PE+ 1^M}'4\<r+jЁ@:Mqՠ&}dE)ũ~,O9AۙoZGRy*CG0zyFRXC ֫ Oa?F=%gg+G῅)4xܓ{r[Uun~U.U@7B]G9B4O8BFԣ!OI,a'Rv2Vډ7?ׁu/b頥jNTtqG,SmȨ!t&XSg;|Fkˇn@ZV4L^O!6]ݍҘ4if%CTŠ~"ډuu/Vnze0 o n9֢"A|6W|e9X=κ:?WOʱܒ ڵ=eU!YF>>@`,V BE՟?^/ j/k 6!%M9Ha9&'ܻP.ڡ@:4d2A7notWM~_g-8E1B˨&IEXMDJ|V&?÷p=h~ןoKfDI■#:pffDc]Rjw]˖/IJ3*vσ|=+7Հa\JTE%+ۼ'IܦCqCL4/SHfND,zF3-|_-,5>ErXmF:I4(FroI3,ux۸ZZ\^=UiV5_?j‡$&iD#m@.ee|յ;0[PԕR@KHTH|z,DWll]Fgi[:V_ˀV7,<.Ѱ?5o[FWU?݌} ۨ<{kYM@6bV\VHL~S"8V𘚪OԐv(O֋ӐV&* <Փm+LS*v8" Vn}Tck\^IIG T b2ȩQѬ,7D>0mR5&ЍZpqCґ, _ pߗ~KJy$(e¾O!G?NmDw~Fav>ܣV*Pr8CN$?%8 K(FwMf[6QI( Q5 _i]*OOz,]:hWz wmg(* Mݧ6kB GM䐛\*ي{V\#9Ixzڥn =[Ɵ69+*<|$c#z^cm$GQG^J`'NW-gaΞziRn12:j5R#j|UoyV 9X<3͌ژ 㖶q, $Ivwq;Uac?VF,}#SӢVS_?JJ;GU[][KIIEO5]UMDTY$}-v)TYeKqagBg\2'&HiPl =O3O Hnj)­zpb4팵6Rnx"eIoi i\"WU\O$ۯ{%SXR(cZyٌU7oydo g,Z0|Kdn0ocoj1JԪCL!$ȷi N: Ź8.7)Rqy%5|iE,)*pJ[Mgvخ."'w"3]@=˧ G3Б65nYg[SHCRIyӍaKG`y>j~gCOyQUQK>7i/+@4f,Hh6}?H"ҚtF]ZT7/N䣭ڸ,t,fG2~Ŵ~ EES3tn۶{ARYKO,6bYG>9_l);D%6#B 5ǡ%,vC )bWqo.OtRW䨚nuY{WIA8O9{,t"F@';ytƮ!$auFyS8Jrf&Xj>>P}NʵSdJo"z&?LP+J`,` ?C}ۺ[oubqe4SV sO*kTOQ$-U#Pz <޺S4tqmWFXR'=ZyhbJȋ E"?mvW10Nj#䡩ܹďMEugXTD8Ъ 6 8zWuS*UVV`wU4hHԓǤ:}u MNr ꡇ)s$lFRF@u*㘏ryE@$BkRxb6R­[WӬ%Ҷ43-ç_>#Mc?1o.5CWQJD@·$(,?-b,~O{7h}iYDL=&K"SW^PLH%[Qv6|MLoO:H$nyT4[IoT=(4PF {y|]xW̐Jh?>KHH5;^+;ԀI" K9pzb`]xL4Q*߶ycO;UxʰU1M5ٝZ9JirC☥GiK%Мhʘ;SLF*}DQsMN*1 ]c7*y z*6/]f UAQ8kmjM``EQU "3Ms lc*5f3IJvS"'XH)5F]@l5 ֝Wg/=wiIW<WBjʌD.)REe!6ҌӘyHL2#5|x~_ˤ&"_5\,1i M,?$ E+hijZRS.S/-u7CR,bt!R[|pΦ҄'AphHQ@M':vgZ-iI7FB,4$˫>d~|A |ն9I$=H҃2|S3OU~o}[Vn]VE,#Q #X*\H;6zi&ߍbUPPbi"E @cfc)ek݌#mRIzp5L-HY1RG.Vox; AJj|g{s;e6kFN i1/b;jXh2kK>OzDf"x$goݸ=כ %9$n*Fic-4]^6a{g\8fů:j[]q 4= 5F@cRsB8T+Not.Wx-E>^Sf \fgi$YX#ZEu>&vmijpTu;eKW\,e%D+OVs*%yQq 5HC2=Nf= mĒRiХjQ2hi盓C:RN:)PIhЈh7j\Qjq%^턼jM^ffp^ Y1*zijGvj|| ~%252@)owl.`xdJGpْYoeKW54C|-=iFɗRz^dFV*k$ZY"$UsuR{c} kwmF[ OX Ҫq֬sBA#+58YWX> I&TuqM&0_Y&̷W:P$jO@!z>qKAڙ_ Cj4hNN5a $/Zj+cۻ&LdxwӌtcYYM=LB'ConW㢅,8j_kݬ[UuҋLC\),Rq+}_?9f;v#6G.F(\uV>7ZZBZ jIHYtu(vVn@H?:yvIJ'C*x5LeQq5\OH#PBC2CXN}s7jCG^!yzl**<KPdbbDqah=COX#uǥ? d5rfR<(%2Waҽ]$u(b Y aٻl]j*{КrO3V}}pHA,'қyaN 4V'Wʝk-TȒ4R@j@CAѐ4o>Զ V=L^,VQdž~*j2wVbih.B4EIp؞'rWQ,5~?8urYg%R8!A4de!AI=\U5$Xj1cHṋ"-Kj݇>0 \,{qc#/|\!)iSqL3 d 6P\¨%͎ Mxt1.[0]jVU QUZV[mTwcfgx4ۡr$ (K  ,IFڠāT_&V񳱲Q=RSniME zOUA=M6@XAxAt!h! ^?=Ǧ:l[~pX(YU0J)r+gpKLdz) ҫi&m@e|ͳLV9Ǿ4140gq]Id^) 59!5 A#FJP5˩}gۓQC1K5)5@"(tزGm'JxzOxm x*\۝JdmSP1/~E8ج`0P. q#-CztmmG˧]qHUbH'"u΋2@$*~DQif\V7>m yiHr4._$ݨUFT ST-%0HEB˭IcƤ82YH6H|?`;'iSX"4)JhR" J9p0qLPL#V WHchu<} i [aֽlC#dg-CWLm#*Ņ`}nM9zX$ջhMtӴRn]fFid1mQ;~*N4LVk=J|00{Y1,PЊ">,dV: G{^ufٵ:-J\>ZFj=}BͬXS)U$# +Gq G3Qx]s_ n% hCDNT0'F}k9I#)]\Ē#U\_c1w}K!h)rTjÚdYDA4fr'1ǁ""Qz=ٶrtUը>zptz;݌2h%u5"*xyIAfA\S3kZJ 4AD1KP0wilDž>ɧȾmn۵qVROCC,#jV[\Qse4'R5JSc]H\pnvW%QPFsҿ _=d:g Zu2#J4w `.86ϱF k\ljxʤ%Dje8) T<:G-DUq,t4O*'ǨK{0c{$b763)R-7ZGhhpxɫ*Y# ǟ~hY#$5U4*@]U lGЁt=}QPlFZ,;7[6$OOA4 ѤIOHHS FHcLǴЁZگ,mەN:4 fij6jH}[^U8xk1B%IUQURc*MKfSQi'"Y\UV?qϹc[^J-W>_.y{ĵE*ҟΝR\ 0yj|9JzcK R+*Xipt&ǃTs| hWP?&ǵcz4.;+lE(D9dTO,S19do }JD%DلN@f4Я^;m,':ACN?>uFe/$?pm7ˈu^z8I e~ /{lT[}$y}hGn݀R뒊L'M3F}IN Hى((ikO!{݌( I@'A'CHoNX팖-Q " J$FPXኟ ,vZ;gnI u;oN1Op; 1%hnRaUU>@ȨPF=h$cTe|7?5 <*BmDh(Z"Hd%n@?Cu؋)|3S, "Rb-z)u5JL9;0EDR|vgTYuiF>/tk|*QPnM |]n/g]+:?mQSb dq;~n"flO(D4XphP> \箇ScR3ᤊ >v=cq(lBȓI 8xh.CF=ofZ)3ŸQGrSS~BSu?t6^ql=˸$EIڹv4\-a 5ewld12QdܓE].;)3 TjmO(~`ߖnn/.[ݼQX?دIX:$F*;>*UjOv$lhqYPtWB$+RP28_,S 18j:xuԕ,'NƯvȢd:qT>.JL$4zY*Lk7ߣ0kskG$%`Bs$_~cW]x8Pˉ^;-SSC!J/IGS,`($,{䤇jWO=Qdz bX⧒H.IPtטmv), X aS!4,e  ?*f}kJ̤ᆬuW?]!Y<u6G1棣Ii$3A P, l_Un F%M]U+R`gyxE#ڽ229Wc:ӋhAR5e FgЖeIJਯNiʠ&n]hLS/i i,M_ݵ.m%L2Қ /36H0TZ]P2侷 #GxWRJS]j{UfӍCSp?ێGSCַp,f:\CJZ%5nP,Aa~}=Ӕ[R|F裭n9zIA*aV$f:F,XC% lv`"PAu)5;-u^gۮHQOE0gʞ}Knm&wlVUc>XS'Jrd `'h(%bѲP_z*UVSOG_ 4F+IXd$;# bX|Q][1dΞn3T!лL` jT1 K4[<scnښKܘv$dR.JɤRTMfzmtsa*8wjSܫb些+Q8g/ˏ=ֿgfR NOneF(D=STJ'8k/{}ŒxJhiw^:<'K(Wa.IS>7{'E`SWu@:hZ՘D%`t2&pE6ST>ĨmY&R*2pW_Ms8YW?n3,jY8u$!}.s kpM>aNNG[,OYY6sn9Y5%C*+йq,OQFm-M:*3U .H${I{Y6%~g-IA4l hs|B%=k=`O4i!B *(ƃIK< .K+%Xi%:^$pn6&{RѶOO{/Y`!OHGChIYYWܛiR4gu;oj㩨a+eV}B0w K#|5hDH)UXmJ?νJRFQ8ZN'Dٝ={yUm{]պeVS+[l|ULSdw;>\*C=5fE-(ȵMM:>I&`Q`mٌUh1|,Q.U/#RJ?/_ˡO)=u6RZ(R M#,SI3[uJGMi=j0ۏdd.V꽭$@o?{,Vv1X׷_+Z6cB)Emn5blTU?AyX+q;;roH2*bu&/{jDR'i]GZD=¿/Xyf}5>7>GΙ?ϣnfQTc#i%/]D> 5M4[IRgFGC - nqti*2b=pn9=4+i:Y骿)U))25zLtN kJBb:=+` ˕[^ GYbZJcWg o<6ֲn ~7>Ơ"2x#UOr"7G̻Ri6:z*z>i4jiY<~#H-nuu#$rRSKUZRG1l~i*Vʁە(s$+"uG,yhH*{u2"F^V k(t xgt)LӶ 5$jҖI⦞@bUGXy|7GA(QM0ol F.32|N#S( ,9Ǖԃ7-졻$HLQQ"xĥI* Ww6ks4TPXFc- S3;)NZ4idd{+cR кH,9A%&~н\a^JYrnPda-BS>$k{ s dK1\d+x+u:5UhaWUzC$-j^$JQ?>+'栉ƣ3SRYrtsRǬLru8d Tyu3b$49<LC!DӹbZ_ĒRY{DX PP:}I:/"g%Zi nGO,ں|Qm!P $P/jORKA Ќn +S(d41bym+XL6d&`dJ劄4¢7h¼J^3G~H-JUjiӢhgU~WIպ '5(pVPɒ4R$3EGrDd2qE ?ҡ_^+, QiRX _-цI1oR=ޯ-K H]M@ ;J挧 ރ+n::8ηoWHKYTUTwWv%de"hi)zjU KOKV4t(=!0wlo"wc~_0 @թ[4"-N83atZ3Uz-5|e= Z!i"ZH秒%5&:x #jVqvK;]TR 6: %GH , UO]u\]lUK}'@]]x7GqRc5._U4&z ^Getj/~֓bIA_iDb`ª 1-%,ʂErPBemi[IΦQ\2Z ^IZT( jҙ^ו4A: LuT ^C51hDem@+'_gS.<|MSMTԠB$(Xf<{Hyn݄WMʐD{Ex&fF"/{Z@Kgӣ+e}m 2L#X z'HWZW$aެZ#ݴI+sc;E $!&&_jVZ^?!`,D)HbJ7oLNkb1iͻ~ށ~-;'-t.KWSBp:>)VPd!FFq"׿x6:+|Yoxki,^82(uuZ t2p=#u2UzM,+kɶi3_eEIwuZAGݘ$w`wfnWV'\eAyfx#H?I]^⋝wuؔf]_ yGSZ2״`Ot G(r)Qj3d5 +oGo>{$ҴPf)F:?0B7ar{bbYYC&@=54(7,a7AAMUXkc Q1ZF48 /o`^=] oc, DK%NV1} ]^sAd_~ҙU N-jj~ˡ2)֋ SS#ʪ*9J8[t*(eQ[!WY]Rx F/b4FE#ܟ>+\A΀tN~}1;!ӆU:Gh)9ޖ!&jikMA2Ke+{svjD> zG)&cfr=ṢXoXmZ-J-m}O]DI),@S$ruX]m`C<Ɖx3J-0ZH M0 =z1"7&VN׎(^71#ev$܁`ݻanre9 =wk*(74b}>_%.9c .gr˩ZL!oD1F|oH}ɍ8FF`tTZ8-b܉SCF*ZzCdvmާ1 ;4:N kRR̂u1!5FXlg䨮jZDWLTlu VXg%=Wg6Uj**UPj{@$ 6nДGGUeSOEo~\./&>)p냨Ki|q[( !@]sy3LM~좂ln:zddCJ:J?-&.3 $tMWWP 6| n.DSM̝\%X]L "k nKUp#,V_C xǥV *34Ƅ}n<{#<[&Lƕ3<44MѠWC-PLb{AO=So1yLuBP}tu0>7 f bQ~qXXHݠ |O?Nr8lCG RTQSTvxƫd sc]Ɋػ/)&x?`:o'O݆z*u ,d*cUڶ ^̺Mp$BuRVZbJShڪM*˗ZvS qn³͝-&RfSOTJxh,8iuRAIv~ᥖz*J?՘j %چӈ׀J걸IKj|"Hg)e+ T$(a:TWYZ:TyC P"a%-d'V |'Gл.(_yD?FcUI!DAf"-7}y}ڼkx3(:iFyeM*(j5]s%ܙ)5sGASTޡX^8pl^V0읞=Ƕ\f>QMGFP3)_|囥tP\iGj?Cxv*úq͇O=2GҷS9ԣH2;Hu .w)6{IP+<=z?ӱ/\tԑQR8$i/F EhǫbMK؁Ov0Em !""2U$!#!W]V/a}q.`]n ;t0zR x5Sq9 0S<: KI "hvmhmAuD-GuOQ:HO yU<α27ɋ"^G+ӑA|575Y=B#ېt~ܟN:W]!"M-cd%dӴԑ1:\ۧ+W@ixj5l7R;.YϨs4jP=1[ZQժ(]AƝR\M:wenEu-u>jhlI^4?AUtBKhSUsUo-M<uM V8~lA-KH%ETh,ƨt۹dޯ"YmRG#i:րx}zףe{ 8#>}^v()ctұđt!,<"ùE2t۸:hkjc-Q8A.{=n!5!~ ֈs~ٮ$ji~ctx:*D3%<`uU,:YߋdlmF*񸇒ӚoGV.1#%i}^R/WBxt#g7}]!0x)c9?IGkLI܃W k*tbxǏY樂8i4H~W>{I]AX3{s{dS>xz3Aqn ^sZf Š6#48ʂCxt^ϸ*ebZfE6YJ {DmIvKm.*Sj.6}E"c7>N܌MMO4ƒ1{ ~dSVS4HHz_Sˬ~_fk8}Őػ~]+J"4:x@H6Q b/Xvv@١I$?ϣ{E@mrgrgj{>\ٯ!hԬDp**`n,/`]m[vm #eBR $tډf24ɩY-${yvܤx*h+^ _3ѕҢWӣ3qO%Bl)jUNc6x2foԲ.^U=17~&,50TeImu*`,,x jo_]uE]Qz(Ui+BEĻ.fuuwH !џo{H|42zJ1|cSWhi$HRгx`+;lZʶ(=VUU&5bc*䎊eXII$uKh㋋#.XijN ţ(1&F1iGu.v,S+S< 4您;): yRֿ:}nr;%z`fjrOC 4OȲSDP4lD!{i?^o"]*k-ޞ_gT?/P^~5&٥:+kYP|dlMR}c.BYi6TUKQ^rh! c 2ZQ#]n%E!{m#ySFy^SHcS4B VWUrk:}@@{ ]):aJIЄD*K]6Us$Wn#WO 4=.e:GP(O\, l,7{?\QVmmEv/_3A%DO傞+ S9X Sx! , |_*qUj8q)b[>cwH,O JmV:z͑ }+f\=lxfCUi$xY ݺtQ ku⫯5nchnjh>. 4!փR-ʅ/)k6Ƕ{ %5]Taд h)$ZBgoXYƆƿY={j݁M3~=,) cA/`qdoO(Tߛqى݃ e6AxSj=))&fhI Xn&D^#w BtVLy~]*@2~=7QE+8Yc%IEdp6!4lK4i2m2W[B0sWFUȪF7MrW/,*ᣙM_a䶄 VP:uPAp`5*263M0O8i7.B-2%5\xʘ$Q"6@ /y_qV55Ԁ5|T?oJ#y@]Bn|cԘ)VjOAN#UM(h8^El=f2=UXPI^ܤQᖮ CST#y*ћ.׸{jݟtC"RөCdTcmٴC?/E1'yNfGxV2bJ|"ЮzfZPf:`EQ~#e+)r{pK^c|k3QCCSѥ`W5ѬXQ&bDB8? Gv#J~c߻U q_>NR(rDj#^jWcֹZtt>|Mˈǐ8^LZ$ I"W49sL/k aPn>_iS9h# #O>a>܏f_7>X9Yiph~Tt 43)TIQte/XOݔAPx*uUDW[[n/o`}O;vKX8?i7e3SPFȊi&(JIVeBV2}>qzW|_;ީ̖T0srѫ\\̈'5i# us[݂x,w+ޏy):FpZFtћh1YmÇڒ[s D ~#'4TF5Rcy [\;.OhRb3%Y1D©oSH!X-bȮ!.?LQXh/?o 7iRRi_#5hPIP@T qHx.(3+頪egzV ur ߏi}{+e цL ة"f1O []A|P$jSM 5ō#ЮuZZdhR@N &MmRn cXr2¥$IiTub6oM&ȫ}BnR$T\55*(2tMrƦ40hK0mcI"}X;jt,f9bGe*Px~"*T0'm>֦zJɣi(X< F]ٝuTJl14'KBENc3Pq^k\ f}z m{EY ˆUn U[立.[~^C=`RQ5ӥ;e 2#X {,s_QC_jb#cR#&jQ2ɖe* E*eRCf/{HM;ؠpJϧBIkASEgjkTP49`E4LPdicW•03,IeQ̕Pp$EeNOG[\EE}T4p()kD,;xL`"~Z^S*o`mgs j"V0u5zEC4sT-SݝAᜪ$}PmL/uоG:v ?dR9q񊙦 /C&DPT(kFL3#` Ĩ4'NN5a^~7%`}gZZF*3ZJqڣ)jᕪ (h+ yQ?Ѻ0 ~>[I1YXrE0iOj)i/<(awSCYXUB+ҫZּI:Wg$nsHw3$c!2zAmUqa:y4]C^fq t!EW}wuwLIk"\ta6Y_kYv !.(g--K"'/2jxmXZB?oH8ͅwye <ѝ6eOƯmgY(q=Q)^YiÕ0Vz"n--{HUiS.8,˵W{,P4P8uLT2A^U9XKRO,Zx$t/*'X! X}/oaudSbڔqTQZ9-ԘNQ2ak{WE?zp&?_N{{7hB)sѯS*{HP [C߽]0xO-}.;&)"ak)*Q6B-HE2+J$c# #*G2SS#yJƟSр$03V +vE5tcx֔JdaDΔqc6ٞ= V µGj. :QHuF A&2:(;'U[F#IS.?dÝI5e-=DLʟeu*|V;-?ϋWbltE -Fkbmkp>=뭛qR*kqvv3)KEGOzxDMNإ-&zG u|76O4huf`j$^$Vy̛ |9A_VH?_`#BL{{x2aR1ڵ*1\ҝ6dgOn-G[mWB˕!wFc,*OJw_Y%OX/=xJw5XMɷLAYFZ'ԵPc$Uz/5YRB4OUƪz⢝ǶdMzE B| Ro͉8\Sw~d)%ɮ۳I$l0γ~Tʛ0MSxUR[  j>pZSCQiZFRtۿd~ڴrV59*|MCOO..fKIA(WLXcnt\k. CQMu: pj`E~cݮP(aShFFzMY5Mޢws~_ O_]cS-C.")"ԑ4EpA!ZL4Gp*_:$zMvmeeH`Ie+]D+ yS5TWTŤ5OGפPBM5`Ay\O?ؗڵYL}vicUڔu,Qnydy* I[~T#YG[GƠ}VC|5oU +-9[K+xԐĭ*/ R¶{Vi HeAeQGOD@0L(Vb-ry<{~=UoVCm#5XbN(e8 QLP^k6o[;*I{Cv_V̳s |z|Gd|~3#]Jj8+yty?sTC.r)lT- I7$I|"Qmt J ˰`̤t1ZGoULq_OÏW`yW ,r9AAR|ϐzŹ id>RJV2Uq}˝TT5gWMܩ .՜b˓`k8%Yhq6[)fiJCOvfbIʤ0NҋE,uzC+ΪE@'UEԸ_W<r6k#qk2rh)e2VTFX1+ 2 vW5+wM.}(k=:(;wf+ |2ڗL4jڛWϻ-q潇 q%l~RZ-STUd}^*U*C$V/G(Uc3s A/tu71#Xq}ŒRaSQ"BrTV5ooJD>F>'ni]k N#hc[ Z}m.ޏze?mnVjvxqς8 j1ftʫ{+ZQrIRֶBa"joQn6X P9pd$PD28Q]=03E,^%zwWVWqqi;Kv&޹m(:n( O$1Kq|5LBzfE RNSuI}ڝE(lECWAƾ㆓jFڨaU^Zڍb@Knv{HsIP"E5bdD"C (d#YSQ_-ؠDeZ|l+Ϣ#mN[%/qv{~ ;aOU5=4>vRQS(nLxʕ9LJn<߬;Aw%huddX-Q|FF CS\5q*[DPjI3Hh4lG:tQZ/Cm4#k$UV\Vn?I]xc಍G_I0E #3RXm]~v<%FG*r]W&r <ҦW9S3!dcpooqoq^_"KEb¿I& |̱0,BxUa:zpUK4&oxCB*I@B9` gwφxdk訲i2HjlM*M aXؑAnttCXUP(Z)>IG~*U{J?*Vt[;q7[|sdQJɸ|Sr;-Ia0#hԲ{G O9H0$5X<_ĩJDAfbck_H>6!F5 'HFk" ֫N Zu eN G]@ˣНü9\^oXeÔVFTC"us/na|hd$rթN?ޗ)ѣ5rA>4߀bq ٗ!5aނj :h!a )@v LTlt'ig ۘ*2j20cVFg!dG@} KvMBoX(W_xwySðn3TJ3)*O.j7Ua1n)Uo"9ਫÈܬ:;ٙcGRnV?;bɈ -#="wHȲD%2n=rrOؠ2m@1Zu.ѓ̯Ҙc(~7|AU_ySjO80v# iaJcWɠifan cr0J)+Uג>aF%Ŀs* [)vxVTI UCYGŲQ ǀiQOJ}]5;=2=PGQ_LB0yfgR wk4NK#`6ZZU"5ELfgMJHBGe`bܠf(H$Z4$//5u nmoPk ?N"lo&;pF#E]M(HhO!WkelL*PϷr"nh xȹE6{bs֜k6 1\UsjZZ.@ºcW[3ZQnJ dBnH7rK JQƂ2ΓivGjd&,vnSLq/f!>ޠWVfs8M_UѶ*($SCRQ!Fxk`hz_S]U%~qY 1bۘUj(W3MX|jfAPZs"ErddHK([WdtM8q5A"Քy]/#6s%4w,o-=-':2Y)m$=i6ef>`0sTe4T[/|c!Pدuf\{Y m|fQ:J0\K1IkQN|vgF9)gG[Co}W]PSY +&~ }^6콊،S8\',aG 3pͨ:rƈPHGLYYoqYK2i'ٻ^XSϖt(P eP{yiq,8HFI$⦹(OC=7hћS/*鲞:|zYQ٘>i90厮Iޞd)<>hi!娱_j|ꜞtg(N&mb-%V6m H3rژ, 1AG,nUdwX#oh.Ix/juǪi]N.*uwSgfҪ|POr jUU$}7c}׺=>ۙU^q6:'6-*YbJ5y7ǂpUtt Vͪ.I> T3 EAR*p[H ==Q+E1CtmfatrL1 ;A8`3O@gm].ݻfj*6C&G  ]{siok<&â}dܻ/˫9/Qd'H aokyP"Yd%~73F4_/-U]ʚMK={f))j6~ufSFX B M&Blo#.hvR)vPӏ`+KYf|EipoZǵe%;4L4UzO;1`P0G=|ZNn`*SUȌ҄s)n6P pN5WV~TZׇE߳pQE1Vg"yp:AJuS#Q :zj sʺ&Ȍ#W-8ʌfܢzy14)i䖞Vx\K7.A oh.=cZjxHmdijZs~]Ek}*Sve pŝ x~^(+2wJj(3csO/!VlI;rpFlUCĒHٚBY-y\Ik{ m{l{egš>ug亘7w=>8ץ.c !M.zQM;2Hd N[^ֽrzC`*5b}W0xƵME 22O$L"3;xU#ٯvݗl6G,ֲVGw$Y, (Br I?Q$0OK2͜6GٓbƁ\7 i{{TQ. Jid4U9\qS $M}7m-5u3{z$\f[#IKIC p8(5hOc~[.[VTQcD5 =7y2TZMM8SL,paLOj棤jj|X[S-bGMH늢yKNEWi"HaQ!FGXŦOͱm}+Wu! *9x~.ݬ녃.^5z|ڴFJÊJVHgH1y+kЬaoo=ɔik14-MR|62ӱzd+rUZUc6{O71 (MBћO6+ᓥWXZtٳ;/ឬ2AYO:G U$vu!Q$=Nzu F_oOT),52TUc⪣5uTNBHޛ!INw6o0Kv y eT`gǢv癜HC6V9 $s|u2/'[SIS8z:UcҬIS)2$hqOQU~{(6[ms"6AsPSۤu)]ywO+a#4@'`Y]f۵Rܙ?u&*&:sVA]M+׼nGYE7G,U-SE(C`3v]/9rtE r8U&jB䍄a1 hMu8cJ:M@sQ USJ>ѬZCG:A>\^;^=C\WnF|ACq$iJCӞד!V9zSʘJivn2n\f09 HђM&.ЬzEFu˾6dr?sn^q*-,OG,dUh)\DhԆoRYC@t{3ZBܣ+ |HCח%7STtѷ_An˧uy̖&7(0:%3B剃Ft k-ۃr<"biE>Ga%Uty*RS}5MÕnxnm`Kj թu3|:~ԽYbKCUxwinX+2S%55p#EKK |S匌[U6 |[punyv(e%zz'O㧚a$'.y9 }TWJ*G&+kնk|b>f>җ`8T@&Uudjj&f5Q:@{+Ŵ<z~V۝%aSs٫Sb 00BZQ'/9mc=9TF4MR6 ||Y6"%hAKTy. ^T@C\ߞGb[!en1<9lVѥBBYd-4tT>p͖P$M&?ޜғWMQ;u 2-mS'7}uȎ'; cj]Q5_'W㦆~Co.O=e H ~̷1|9ʊ_ˬܒ D/Oi0]5JzLGQ43ň2,f7nUKyH;{3m$1n#ͤEzƀhޭ}3s`qa&x*/IݻRguO,+c]qc aAsk svLƟ1/71V?EF.~]c1K9}AWHĖf < 6@!WI7^l٢3lM;4zq"%u (SpKZXByDF) &|åq렄xaǖif5TWch@Jbmi㿠Xnm=pl ԛ6VᨊjSfdWZD]檞*YZBHm.f6]<8;QP\Z#sƣzbP*bH4EIg!U0P\Wћ$TW-O]Z=K73"zDib4z s]vw?yٵ#SaO$#4R:F*_$+6RR`H <4qG4L׎"0Ae֠䰵 d?Wul㬬lTf"HM bCNq5ϹӻgOѠx‡e $zc ǣWTª^)iHc)-kl ;i`>Md({ҳ$OvB-Ue.2j9##i.I.2 7aʛNzn2;Xp]gt_ëѢMۯFР"CNNyB%ᫍ*y.ce7r#F,[f6~2>R ڔMIT\4($1S-MEJUKzQt&7;ޮU~ƿ]7&i$R(] 8'}w Htzn@;^ɛin$gXa! FU%d./Q`FSkqy{D"Vgz~}xsL 8QDJPj:g:sZ(+b96؝٬ovL~($itq Dռv66HiZT|?}b-؟OΟϧ$^.(+0ٹg˜7{Gw2Σ] Ԣ+¢4rITEv3x : }i֔z6FD`pxR5Ljet.{~ZHpibcnSU7+njW=G peԳEҥ54,n V,O8tSѺm3i/kER&V4*9]FAָ{ҿ+=edhk6:5=0d`huKYY!xⶒ]nz=Doxн ‡#~~]2"X|RY`U9_*09bڬGDc}fRM*ـE-^;_2.c3Wجn7-7ۭErUHaVi<$CI v{~euY+8yUæ2ZN(GVG5#o4jh(嚞:JxJ٪ 6Է1imඑ_7~Os#Dn~]pҵUuDT<ΨL'd`6ٙ\6 vE;SMW (#ALtװl|8"5石RH$APy ʫVӧ"Pp` t&cX^0 _<{^b);Wqǖ%Udc)̽c t%9wmw3/kǕ4_-? VGsrN9 xɤBFuF_[ث[LuuGCC=^Chm&cZF P𲴚U]*( u $:W G^`)@?]c1y1DfVa?l^݋S:w'wKzj:8<Ctү¶[TJ4ciZ.1Bj{GȦ)r:yQ[i-nQkx*d#ۙLVbi̞4 &#sdi%OC]< d,ҿ ҟZ/'Wx~y R1tYo_nZEDUOE qRּ5Av(]{M6֮rc4tpȺbR%Q*Wl5#`+b e<)PIBթD@M+4z]ASROUHԧ ku"Lpܐc-(omxXí䪯;XjTSv7be-AFsV l^ڜ7IYƼ")ɨ[e Xw7Cͷ;syjd(co<+>71CG,f=3]\J3*~jk!73JY|U#8>#TVi9*"[L4DaٿTͭH麜L]qeՆJ;N\A VgD]&$𫀿S9+:O_0oϹKD nRAA~Gή!MSEY UTupKKUM*$M c9!G?{Jw;QCd Zx9Ds)j௧!x"s ]MޣjGeqqC+@H (掬225r8ffmLF#j_١OXG?Soqo {O%}.Zʘ*aPVDTБ$ѴвN#ѭGv10 *j*i^fkWЁ%Tj|5*h lLXY<~)&a<2@Po{zz~a'ߘg*jwݸd52 iRi455K #+dq4]l@kBs䒽'J@TI#+1I5pZJ "B'-SE]W jzFPWD$YgD2୽n9ji1jO bEV@ CX hC+R5mU6QBTG *0sʥ}U)D+0-Z[Rg%#yũ稄XRm 4zu)((|J{`LT ZQ (:@:sR$"".c ]%s49T22XIU3}RSԙJV1wG,/UYctL~)p dPi٧ֺHL֟*_,0VTF LUT Bgݗ|:M/rnYrJюY6V UV$:S58߂>\ap/"e`"QN`9ơ2~]92 C3WQJjƟ,ҽRGn||}Fk}oG A91{z`c $Oqh_[PnMVm卻f0Ek2岺O#*NL@Ƥju>ސccrnt6-0ǵ5MML2ESeƪ , )ے>k'Ԯ0 g|&`*Kzw9v2fJ$E$v(JXi% 5~Žs%I_HRZГN:='}ep9&,O_U8XEv 7 qjl.mɒX$8=v>\jG!![-j5u#( {rǬn<*`'&}FRٙz&G֡\~#%jhOVAO==E3fUOhpEO|;=Ur @;k=: e 4m%0x&`$Uֵ*X1Ѩ  \a]qv5OR DMIQ ,>:/)ݔ3݃/m UOx鮬wd2IQPMHzATid)zUY$Pn.CnݜڵXLЃKpc3q&]i1ZeT0Xӂأf7Mbӹ3jQj\OHU|u]Z&pʌIR45&@Td;SgESKmTBlm%H^iZ:9dTBF-krA-[3@2tc)gH'7uLb:A.4wQkP kGPT041IvU#,YZ 1E ץ71WcjUѵ$HT~ |*$T!G)Ց"QR: eKAoeӥ۬W\/wNqZөk Z.0 SPu᎟V58 y|}ٻksy FN43b*UDC&R&b@Uh$[JI Ӥ7蛙n?ymSFJQq/*x S# },n$Ђg!WtTǚ9A1 Zf* uI[+9kQI%c)f{+9Q7i*M$g Ňi{ry,. *~~ZD"Xe4z![lثṆ[d;vL-f2uTLc0BAEas]Ge*x@]H?h)1a~Yk%zfMI5} X<$Z)SWT5ҥ1gA*HK bGq`[+#i'hkSKhb^9EVdʫ};T{JVqx1% ҾZRxyөSyHEK2"Q]BT^_Mw:&˰,Qq5THհX[U6̈Ӧҋ^쁡$tfj-$U @t?y='^r< -:V+r5U͈Q{3USV*\LH٤:?JIu%[wqQ!1'R8ҼT)ǡ6= J3\֪5=+"05%+EJasX7ןjn4&-y48vAS},ckSkxD"̧ȭ10?- m+VT&ݞoI3v\880;V>]E |=&)]_yָ-r *H*I<ȧϡb>qcyzY+g".,rE,!Vص&Fwao~Y)r9z|xe..*Dh$"T0`q% MmR~TCMkA'79=lg "eiܤ(,*pzPL)$+eY卲@DbF,,LV*س[9Խ0\%RT2VzHMm-]4STI-U41ܶQOj 3Ţ&3#K Pd҅ 6{sy%Q+E,hM*kzN6&qN3]_ƾ'O,j竨1b0X%PZԏIU髳t3IonjC"21tfT) *=OkeO pV8B=($MHThC`D rE5tvޕxv_mFqt;u$45HM>Ev,Jeș 4"-w[,<5Y):g#ȏ.gtvSwXb!UWa;>Ǯe9) hC /[mb6.CQ_y"ԵT$Tyƫj;Y}^j[JӫV* ~c:gj{n\VQ廚:CSCF>SRcoLbEIu+q[~NU.49\?2r&[)SAOGs0f*cMPn:u*m%EVv]][+:HmԁAch'ʟ؇x&&J \m^?#QR1I-KHi ^?,(v?oa19Q E YQK:d - IaQ1Lڜ$'vBS’1t\':'d*S#ŵyWs9\_lF_#F|~TWSntt 2y#|\jtk4A#=߇*8\Mnv-n,ڮQpOQ>Op)+ղ֞Z9#RT.*hh(J>|c>[jrf9|L2Y<̆o\4{ csٽ6nxv^rc../,:`5 }. ȣ2YƳej_f -;2W.#p5.tV6̄h>]^#bZcdnQdvgPMI2Szj H94렂\7;+5w9w6>(*iܴZEJȘxLiZo WUพhABH!+V8+GP˓z{YF|m)G59ީckV϶yɶ-t4!GfK)]fY3}Գ|IJ㻶Ƣgcòth(qTm7&J,OOU;W( zu`ڭɴʈYvivӯS2L3JY9uii[=/)T?&i;cjj\yhK=BxҢrLد4,u|õkԕH2sݺ(1T4z}Re lw?_\4SʲzXTqK6`I O< r tn3oL^R #IR; Z̕MmULQG1,nxll4{+)]tWg*e4X:g 4 B#7e(mۜxu8O]R<XjcƵ /wvԊjNa~؊Q2&'mVrSE:5*)9m}*ᬡxl"1c$[5b@cQ$ՉJYĖWQ饙hyП/.|m ${ )bR`}Xq1Y.Ɠddh4!++4&REEIsL9{W[-;(eIKՋ4!w.Α-(Wֵtѫj^]O9J2(wâSas )j㪪a2Q֭`JLFj'K&"z+qf0F $.. 9TjxUiټtsf-mo:-X!vu.~V%{to)tm!:Fj?W/Oh?qzM{GSA_)!$ӥ? =Zܲ⮏vEdkQUn l~}6Hx\<մlP?s-6'`Gh{i**iz+x0-:trW9=:YV'hQ&(4J7na(jT75ʓOߢNz]!5A#gESu]TijgzzSx#!ݷTJs5:ZyiX̍qxv6aR'MHlMv 36KGdwKms-m\-^c'ͽH&⩈2HW 7/1[\vUID"h5XV奝4V8٥=Qh@=Cȷ<<:RTRe**ٌIotUc>6^ N:Jx?$xعA ׸flcKRnE:ƿ55yʕ@sLegQ'^aU{wuCY@R˂J-#)ԥcAK4yJz`dc{* e~.!]6JXFg(-y?:䡒q~Z$i`]Qc(1n,QOeXԑ]^_UI'G29`~~L |@3_r>ܢU6=cNj?Je۵Ub7>/3ֵm* %MdHMEkf[`5o,$Q*{xIJ-) XS ̋COjEӱRL~f3ՕGr\}uu3,f+9d|u6ڰvV05N$ŴUHa5t+Dqsͽ.w+.Ҥ9J՝tRJ63-@4զFM4!4L=9b9ΥݝM1*͓[Ii1z-cNWia)Jew4K! \Uʺ `'RC;ƫyPr\_IM^CRjZ6O6aU?B!En9E.Z$[sT+ 1,a>նf, ܇d.hݿY aon5'Nx 3͖9$6<.jxrn:ʊlmd&j xi0Xi[)Ur;o֥ty!,a>J=ׂI;["Lmi&e(VQb}k$GYQb}9Z85Ē륍τUJ5ZX`4zI W_6n[j=q۷yaCj1m>ܘܭEE[ $05(e)z4Yd '"+8b}'՟8`WwAV/z)Ա1&6h>5+ iVTi32Vj|V{jܻCsVtmj: /G`3Q}z3W#EĨ5uߝ\eP` h.(tUfQ0LRѱyәynWVXx~  5h{Ci+yNk$i.2>,Rf`GG鶆+~LRy&h~S7G )qφ%5VZ׬iJXfd?n%س%>e*ϸn14S6KE3v9 zh`"U>gf]cx;c갵2{~|bL./w<\u)'D4BLa}>Zڼam|Lx}ڛ^ *E*,tpr-mBk=8Z0GiJ< Ĩ_:Wӂ=8 f rv^eTY,Z[>\&B7VwlZ%,_}U1r0e7ՙonj115~x`MopT4pڙ)Ov]<: ߣ 3*j:~62uE?#*zThXɪ6Na5WPhik(6g2cMѐ#UMP@u"o^UB$ɕKŖI%JLLvE={MT+f6Sv(-C3j(:5Odfe>~}?2GDq\wg?O,Vj9^YCɈg)Y\vA>&aY54LD 9vjJwwIlx 8 "G+7wXk较oqMCEGOz`BzC*y%Q:3R}4qR"iL, ƆtPm]MssLpIW"%8))+40P-kN?AI4glbjjrA e+P%*׈m dӝTO_ӆ5/_jhSUP  -pܯ$妸5,MX+**\&sP*:(xb@U8UVQOSZ#ν֗Q} ]Vtϼ*g}r:šĥֹCJ]4t CIޙ Gzj>^aBĴRH%dϦ%{i@=Vpsv)ogUdݴnNkh]j <~GɉYuPkwƤA |_H>;:ie9LAqK-?<: iR耐/rKqPگ8yO*(7z ^"p;20M#ͪ;L-6CIKC6F*s4VI TYy1qxIjjZzX#1.euԥ $_iuKPo <\/#V5jiC~~}*9`SńJ<~e^ SS!IY`K>&WU&梖#mWM R9S$=BTa{xɹ$N[ym(30БFnj0%rt$t86TjT 2ƾ=>cmjSdkF?+_棢WMSZȢ^d4A&UM*Pk?CC-rʸ,U5Du^:v))hO"lU؏gVjѬ/bkTVQZ6AZ^P]ړ")T7>uozfGhX|_Kn-JcҤ4YZ# $l*t^G}վ+wCPq\a0J4t֧%TEP#>oxeTXWD`ԵuTdQТ9@\+O=ύiCĮr|N(i5Դ H-)wd>7L#hl>e|NSMOM[R5hJlEtM#f.Qh,Ms]Od[G#L`8ƙLF+۞:plIODȐUPK ݋2e07d:lnu :ereˍEd9K)kߐ{-u@gY{N"KjKkR Kv?WO@3}es{aã0 iJmАqT]+/閜~q/fG6& K&rȫw= WuiӚڿyB(O]8+ipFX~@Uu>YzKWHS% ]FZyiVzhM3%mH6ak{2er{Sm2 ms1E2 .3m\rƹܑB!4Qc(Z-xWOg}VtS}[-7.\E~y(eL>ia x2VY1-r m=6n>'DDtu1 2n X-,Pg Ux(~]E(WU)Zq5c㫰r/HIh_7Пftʻ*JqӦ:i$T%0E=BKkݴŽۯ0vm1[w 쟁ܨ])yRZ= i?X K x5K5 (,gW:|u˦j$4uKK[-R4k1!6G/* *.ع co| Gsf#0Gu-kƕ>\uNu9FTd@+kh*jkjii%-C2-eXqmρ#j1_9 Ci*N?mL>jQU==6>O}@ce"[v_u5[SZ0ڹ:4cG+ :_K)w\{rV\!µu A An۱-~dbH%Oi`^9cr^w&c67k q,}\R̲\,=i̟Yx0D@&,u~. [W)w5>ˡz|n.M_!u,VQRjr2$"Hyi6n4pcڟ%19m,!Q3P]m͌ǰ'3[ج2mzMX ZS:}RUMoʕ P?08^]ѵv}\F !QOy SH"$<)j`mp*l>;-͐LV7-WPd{9i%Z:DYLH*=qZX˼K>Rů O_?WK3wGTf 'h۩H@BA}86w9k$Ӑo3RZ`VP$9 Ii1/Id tZhUt[iU />Л+w^閥wV9GUDE7㫱 :,Kvfv1WWh(?oJm,e""= yqץ|hUط%'^?Q>+VިU8,F;?vC*2b* =mMTJ2R]^N*RrC{w=s~ݶ,q( biך#6[nTP[7%MwNK!F)ȑw7, #z|>=Lwuh*ڛ%L] N_gc(>[ovԎu]U՝%c?Aq!Siɸ;鞱0Az4Ao6+y,sNJb)O$ٸy X8 Ti[l/e˯4!e[k䮀q.s5De63T6M>?[tm^KoV^ήNJZ ]EAd(ru]RRjUdZIF u | RXp:Zi Px⫫ jNpq-\$P+ZcKj5yj$}Ws?_bٝS6=B97ܦTTQꫪV4ARX:9-fk²5?5|],?A7NԓUU PFKl6݂a6ˎbzvSKnzh83Pha*POnܷ~[3g5S?k2em4PsW"K<1<,pRU h(iQ޷sd#3jȾ NJC.wt=[ntPVKKNðt39oJzb1ԡQ sfc,Ya+l2\^+_BOWn<]$ .n"k !{ 8JJUskb+F'fq%ETc֠\L.]%Y>.n? tQͨ:$tm_/З< Q GD#2H,G Bۆ?}>Pc7_AJ|mTT",o&ک!nE-/+)TJMhΟLG0&<A&mL!IQO AII)~I{ⷝ}L޶E%[[ԲIR6kuj¿Ϣ+n<^m BXݍ-\4 W6ڍ?`B!M# [+xk\q~"qAǢkpYZ׽SSN$SKڕY[@8;gwvNo<̔x u=Ui[K[Q9NK_Iw akUc4ӡXn_N_>}[}˹5̳k Hv\dq.@彩U%JHb|.ݗ]#o&4j׏<.Ce{i) PR/W$v/z㗰mjj\h0Ux,,US-Eu=>/!}Y1ԯA)5y)u0)ܭ;mdfSZ@8d.iG͔mU*>75Z 6>3qVWN9E>/**OӽYYە;%{r%E [Td|LU5xX&VGJ{f$_s*Y]N"\1JD&~]XxkjiS_tMW#krm,G9]SrO_QWU-%7X'_*CVA7 ;u}33_*8bΫ޻a;O&;AM)uM#M1Ԕ`fR]vͧPh]N~ׇ3ӆVcEG~αM$P!8aE%$# ԛWX,?~ J|\ ?|zzddeJ$`%Ka%,d%* Nxeq4< Z=3$5n MW6 CP Է3Ga?.])T9sC {Hרn$y6{JW|?0My,Z٧~:IzxCޠ-s?8풹njJ^RyL=?PѼ1"A%xۻ- w aQkO?1:K&_'8Hͷg1OqPwƠf\F\Xn f{sx$E)F +?}wmi卲]%Qz/y}>:zP`X|IOIQ$ekWPuߨt'Z71e*hjQF:|xb -hS>kiP~ৗko"sD}+A KvP4t8[Fgb㤇x̞j|s笈 mQ Cۦn2nw, iCآ>gCoij+PO)L`r ,ȬtZ]?ob\;,k;=^QPd^ /ؔgt1ejhM 1W3^"Ა| qhkղƑx:E^7xS:hYF=fn3RY<ĦP$$vYl-ɑ-1c V {~!xRu949mn~T;UI|~vZB+ZtWn%Π (?jWxg&su1&BVnT!TqX5X넝B׳X 0"**)L&Zu-bTr!I#fa&z< ;5y|'A۬u^oJ\0́^.5r9{zm&]ڵDKE6n7D}g[΀鬔^&E=鞟[mȋ?'!yR ~/ퟎ1e0٪ Q4sj .nlI7|n{^XSֆȾA^ &Zez[g ru1YZNڛwfVEY<=%[MP6'->!;UuH[J`?GpTSZA@*Κ22ۊpSEzlr7\j6.ԔPap̾\q__?y|}U&;?+^yo`teUD If߻YsU^=tL'[(G %- D!~ƯPi7;y9 vӓR))px&W4-luNu6#fA_gZjuux:r| a-T*ظ%rS_=_.=5}5iWY=+\PN *z2n,jP]Ca J,h$lrVT(=+jXOh Yl\ ø֘:Y  %X pAQIȬ-{Xw9E{ C! F>!hrT NTBU {y#X!b#跖UVƫr ?J.2+Z]G$WQ _PVU_|D{C+%N? 8ڱLNE| cw)ԶG7uMHfצvIӉ4R)SF:J*(rܹ,~,o2sj ziW)baRK$Fҭ&7r6Y 1V#O3ﮒE(VB'QCTqdJϷ0 "tI BL"6CWoukG#&߹g姬T8$uϸZp=&JR[L~Hi5ZiZu-ko}d9"# P'/*Jzxi`()H`(B"8{:ocfyng6e5\!}SHc Ȓ.Njپg l' RcOZ\z ͮWB\\5A'>@͞MCRTTKQQu2ˌO<'O:XOݸ}۟ \̒r><-F;Skc ZH+#(Cp qsJe1^6ktu˟ f>EI!C\5 }O;_af6奆|~f:%d-t/!}%xov;Kbv. @ u0L%cP*C7Q>7h2[&7I:N/-`ARcSP?+˪S׬sedvax$l2H #S#4f3r qmEݓ}v0όpNj)i-JKd <`G^EY⣣QsR+i wyh&Gc#Kp#OZpzfcC$qӵ$ $sTH uV96omʫh)>P :}R7bԬq$TyJBDF;eHAJq@8V`?[7h23] ԜTcS=:V"MENZʢye֢``HWh`6,PGj*nELHUA%BM-D!%P#vO$'PBI[e6IiJd T` yj{Wy-\j4H>Qx Gi:yj$PE$16 J]؟v[Oٌ;U8^&7]GuŤީR5I<+ Y^˻2F:LIcRJ D3N %/tmcWW.tK>E*گ"*T8.Nj:إjfj("hJJ5 D]CI*\2莫V,UC3|}ssⰶ@"5 f0ԡJ1$GGaMgoH5$rL|v?B <)${~4CsQFhZ50ij+VydH*)?A,|dVxXM2882Q4n,! *JTU=AAUL.92MvothmhD^X5 0턫vr}+rEvQRO "L4ƭ cG6Kvk=VVYK:gָ֩Liin%fbQ5P*|}z)+M.Z]KQSi+&.jf+IZрT7%pk[a*_ L=fBGcsr7uvƚOm4TqJ ݚ@Em#%<{#ʝI.'WFo4 }VwVlQ*OhF<>@$RT:t`yS[nF51M:I`4E A8%$Rd%>9g[E`RŏwnzlJIX\E56SǏRfiTI_SJ#YRvmiA U0̡O05CAJ i8XIK*F ^:X`tjN#$h2i(2PS4EZ@*X\ɹ-q;l؊#3"Ǎ!IL^RVӗ9!-)Q)ΡUj&eg9EV&P_1@zt7,grBPp+B j |bvkW) iBfgʈTX * 3ZvG-> 5I2qtxx[DN, \)>]Ou<2H#WL *9#?gT]1`.o[8;qF1WC-PQs,$q'SGrG$[rTm6FUIU]ZHqsyb E}US$lP_0 P+Jg˛V;;|f PC Ptػ6 TU9y_&2̪TDc{EHg7 1r%.d6.JEWnc;OLa&7+49<?lfBxKK<zY (q1fjU>:|w} @ۻD +*HSAƣQF0:yI6f(]9y9S)dmt0nZU5#.Z}95n4jKDWS듣[~`\ \AJR3 ^Ba m1րh3MZr溗z ;nǩrNH&4acR@:ƻdo͎KUjL|4xzew&N-E4Xv\>Gz:2 JZ“٣N{ңP߮[s%hM.@]4{G}RHqBJlPZ=ETiJb@lҥ z?P}wd[ѵva1㪮ZٻRaEUoSX+}y']6(+A@WW ;%n[9 %ψ&tFѺKU/A*(RԴ=%{moboWmcfjdnI!O.S⚩j-Ưk-`eT%wO=\-y ՞/VtWy#8IfV;d*%66,@v݁] vBQGISFRM)㧗#J&HU$wmE@R,x>:vѤ!b- ([ P!]WDwS1JMXSI]#*X jYdBkcǸYjRסּ5SJGm.еqPR0-( {nc1DSO AI7T)h~T) HjnO0lR_#ј5 5rGa#$cs*@ RLRSpu}-qk~5m>FCLN+rVb2t/O5fc)j*)E1DS,տŽ|ndX-*? )N8]}Y{QVnvj3?7lIJ=Z%:)ʼU3,nS.}Ru,sϸO4MLxlɭ*ihVD8Ӑg+W[,\[WZ4l;2!fԬ>}LPC"jf֫xDca>EeL&#aᨫJL䣩-%|KQN)od?#cf;ow^c41mL: > |&?4)jj4O2[ehBYigԝfE5gkiԪ0{|>zӲ{eLfvu^neg/=M>ًs1u5.'&6kr))eXD ~oͳB+궺cqՕfu׭e/\}Qhj7AIrV=7&oV3!dJ~#0(:F>!ӺJ4@:i|,׫™ =6drt8NۗWL3|՘2AfHrxg"mTdM0Իz r54!Z\5Aq3{] ]5jfaS1J_ Η+e55)WS RW;G&䧦lCD<gk%,V+K'CVY#{~<@pP%jFȪD45ww*JG)_: v`Fnݞ9vgukAp.l6҉7QrD^:Ofqǵz*,J p  25)IT:Ņ ݍݹyt D!wui U^_\lB[=xt ^"lN1'4D-c>2W % ,OZ|ߔ}VTg3bnbjL6 GBYHRH9}ݾx@ҪEXHu>WE0ɨoʞԓ̺Ǵ;S,Im*x();Jwxys[s`-?ImS*ߴ29d #@bڙBٻ }Gq1Tcsq-SVqؘS]Bz:$o%&"2'S%^)Kζl7{j#SC%@WNA3":X֧J*Loyi ;ّZW3NA,c/o"D`@hx`8 =4UuZ-ttSozw`mݥ9=WS 2 We¢zd,UGirȡK'np{,===5e} jhezZ:LnRVS7k/G`hǀJQr2ƊPKkP=K66T5Z*Pg=#,|v^c3WXNgʱMfYŶ)^}I<`I5FK >ma੩*(X )W7 n[q+T+vi!HЊ&{ veU-WGFSm^`*Mɵ-5lW ?g:ns0UC7pə g랂62{[f,6m3M Z8[ۋxaI/hn*vq!Za`Q[I@tj<znR⣥.nMXjU8ﬡG`g笎H e{܅Ӭqq]6$0Iv&4\yJX->"ͽq4dkqUTxVD/pPa][/.]\jUR嘈bEb@j:fKXX kPy=uUڭ>\VfL+.쑗RWc`#Դ2lWddf z}M0WQ9zeݏYW--fz0૲(mϪ>#m|QA-U.t y.;ORJG4|i&R0BL*s1 G8t3Pa4R9ъ41qłTzSBGR-տ^Lv!C1۲wR *od0_|hq4ՁLCa1f۵̀ۅ'г2;+j,o+1U'ۖ YiiSLW0>9ŵ]n> q64Tɋ3$D&TVH1x=E#[F!Nyi_\<0l eyde%Ա~=*Q,҅QOv }Uzl޴ݲԂ+ OJV fJX#}[ovALI-G %t#@LUr#]K}7 Y@*bc4]M 7mhX-O-f A^ٱ1TuxLtԹ*LMfεdiHbI7.'.rMM%DA13S,YO67C^0ۅ`g1j/>Y8D,Ɨ[%$ '7a jP|)%vh5~Ϋvus-ݻ-Wm]4rKN+efSC;>ʧr]h{oVbL QC@j 4S\yA8He\LC(R7PTiXR[Qe4G`BTU[T=:=ѿ+xy}VNenV!& jMā{=h_>|~ৠc4)U;)4GM!OkL#&I[ߠXͽHj,VVv @*!P g,x?/^9mw<y忻G46~1 B״ +Թ2ž撾Ože0_!+5㮟5MNYbc1C!$]`JNۨY$ېc' ҥcٳj#eV% rwHUR5+OȟZvBɎez*.[&.TG&*&PB"B  FdS회~T*7>䥪kQ[s1TMSoB* 6kd|)n7vc*UV* *?o#E _9t{/!voc[g!O6Z 58g6+Hj\`AhI^} l,.e#>DV?_Z_gQq^m5,Q"'I@f )K2+7եXCK܏(g ڢFł"4l\qFXgc:P4V$OO[]Ip,ԡg[;%G|^K:'oM4s:31-`lDfWpE_Z8 ԲZY2 s*WrBgx= Q HBb5OUzeO*֬Oq5n xʬH4ʸdy cfyxŐ!>oqڧq=y.ZHI_OTc 5aK-I*E{-g6d"@b$ `tQmkrwRx.+BjA1OLϱ{+yhA]%kC-mZTRҢ\Ipᇴv7gܲEMKWQZU }=;5,̡v 06*/smݻ ,W:X(πIrMϧͽUd1i%U-dEND/ǁ;~m{[vm9|81U5(ZJU+`pI \7^vns5JuU{oDaAH-|-S;rOZqVCO4pGUO`W8QCrhjjY۷uu4DS3TR"a(ZBUawR1C_G1;M3&5z]2LkG],/ GA`9 QUP)ӏ4* f~+5@?'αaiLmZ8{ oP͹x:`s#y4l#s)PivFn=T1_y"TUdʅP>X{K4.Eje(db@4t%-ChMeqt3db \ZI1詿fJ '`{S=Uu`f| !gYeU7YtHsq3[۱Ku~z[O/XK rZO .U}, 4&)w.:<*s<n]]b鼶W6F;|̴ܬd)s5bjr9!\U@T[VۏUta_ܹzY4PVjhD e!J>Rd{^3UjW%Ztnm}NBW4R4CPΑQ{kH7ɌZx+*"4S3*i.Fmqn/imoQ? ;{-Zsi WIm(2oG4a1w*Y55N7 rgSFeW,\~i1S0c`x5;IrTj_jS.j8Jt(cZ}9_eky,[iO$#92*TH$[\ݮorS|*V=`chkêRb'HUw ~zj%ʂ&ı"=BY}MŅnyRL#Jˤq=|SCi럻$i{:wXJJ)(>5*MV(d(!C5bk}9{7 =q5%4|?ȳ31RP^??y-6_ jV7E$:LJf$i7olڵR_BCWEO[lKfԷoIR-r1Ҭ /@)OߗDnuPc9>mJ}tәV%]4ފĚk(hV{Z<YOO iƲ+> kx!n@-߽>$e:Qk˥b}Fm8?#ҝ)z![j_{h*RES$PNYij!082 bǭtci{žREf&O,>h bmb[sHfIZ*@ k|5C8'k^"6 >pSM6ʍ"Z,-U-^ ['ݣlڝ9O.^<.|"q$ĠȘc,'Z (Ven$wl[$$@IPuj*ը54g-rI-kjZWM(o2|ӗs_MM"SZaGQҌµqON gu"9x=UN6Oj,Eu9“IP*!$fnIu5Gա> DW!ikR=JZ|"DQOChPR5A&~=;yvp7&B 7]jT=0KS:*>Tb-ϱm,7oʡJaP~XNop%j O'=厣,8Z9I$䨑. "¿G+養o$ ClF? !z򈢩.˪t @?6 ¿/>24h$_.&TR)~Klj* .#Hc#E7QZV6 tYjSغyE$jb=NK8Ki>%:F[k.rnJc磢c?usm ,Tu9je2xu1M߽/v7_f6Q|YmgG_Kgj~#m9luUޚOҒFB~]xƅ3xlN&5 rkTjmLJIԆ\:9Ó;l]5ȏ>}?I 9]#nn\cKun7=2IjDt2 $qP=qwY`4q糫E%UN"|&hM}n\H’@EU]Z ~o}?3g+j*>?L,t8q-DG_,̐@EʺIr}ۗEtɻ-Z:uv1ԇ/^; E(@*ܪob渿Ya.j4tV43iX܆aR~և?o<3_ʬ24k apT=Go~;٘itAQSW[;QO41GO !c)b~MfAP^Aνug ?GơT*Ub?LӏޛD6;yN(XjjZmJ#2`F:j $  ~Hp724 #>K"΂W"XHOT-K.$v#GPfn쮛8n*uN~Jͷԙ, >m_sSJC܅)d+q87~k`4Y.#Z)2𓏕3ѫ :U0S}Fha)LBw"7BĮZ( o-n n2G#W! 1n >VVZt`tEG+#O>hq  jN~A~x1=0:]?=KA8fIӡR'խ˰km>l4[{10DLrty ld'Y)+T@kh 4_oW<{%+hJ`bN^(+Zʡl!ۏv֚aK_-YY]!GXe$#};ߨ6Vbi769xJ’յ>KSFd!{#UV֔T6?w# 2њH/3GIx#;ah!HM'ٗ:գ#(-{{)wy]-e*Τh,W".[kY-L>#MtKwՖIӎ߷,K2"50c[[E\1p$BOcC{}=um%ODV*H?ϮGʍ͘?!!ukM*/m&=P^.!ZVEgBQC)I?Wټ3z+գHo^}{ugEcwl=Փt[/16R(1oGQt)QUDdYPxko\bcV|'ut<LǞ%]ծ:ra%d6'Hux$ ?X߇Y1b0Tny!cnk!C-r!!ۜfdHQkj`?BIDHd)Oys1 \$P*H J1Bll8Xvv~_[9 |TWG%:Й 2Q* VD0a+mPXmq,a~c]&yf,S N*ĮTV V~G{ OEDZ6CfnWѰD1\3$9;ZD3Pʋ&ON_vx"2E)ZT 5ҦW6QiK{ֹCYC~ fn [hclmf;%&B`4PQKeR Zs˹mU;2t? ӒI,/?oYȲ}-װ =O}l`vV,]tz9ic9cvkҷ$`nK!Iғ!1%JǥWw"tW'0`ii`~5yX*^9|+1U  |EֻcL*7R'K]_W]r3ʮ @Xuɼ_F aiDO_k^;49W7F&kGYIr77ԇ($e@L>|E7(~oOӴ2yVxR5ι+uyF]):GiPjS t5ʃVb]*u-'Z7W˹rᯛCi<% nnyv[< XA|S=fGIZƦ7jkGYo*AUWpZy,fVLu$Jo,UkKV;+xq죓p}>!0F K>DŽJ9a۵E%]$O[IS/ZB F!HTYEurW[E ޅ[,"Og!X^pj"ߟk:YOrd LkQݣXgxbQ1$bΞ%<ż]jfa3?oۣyӨRAH?C=)ar<{4s/nl͘j\wk3;-=>1m%p2Ȇ X{wtLCp@5G`*xq$( kWֽ#axʍQ:S2؍W__QJUdX*\`rT*(*7+MqdL4J:-|4QHZ0Gs>HԨr5gpI-|xSpKy!SwIa}I(H$ *ۻcmnj|2GH DəsUTT^ bM nٻY JPHb }<e#ݽ+6l;hmf٣U|OlRA=EC4\U@䩭7ҍC:h3.BkOΦkQ6ni)qfwD)S]^JZS dA{bkC <vvl`IvJ$ʜt(#¾11 ڋBs@o4:fÌYpG?g5t*92 ;[C1Yn7l\vN($1@Zhz(b˭d hm-[<$cX)Ymk34ӉQz45faM4Ua8KuPRmۊ"Vnd aYlEmA.%{tFQ֣׶ VT,|Y(>4ԍ24#9֣yxq=U=;Pu_mgj(RJD͊WQԼi߳ \09Yb04O/}("" LHSU 3BF[ 3gi᧬̆!K]̔s 4r m m/emLp[Ǹ6vbzTEPĢMggw]GH#X& %Oa-SQ8CwwW{HS% iOdU츊o\Ki{^9<~8a=O]fECY_/eV{k (gT2ٸ=p"2~E8d059+P:%[+%45)xWk$+$E?ە n9y c|n*$dIX1K/6FZRZ9A#`(>l2OV˩fm$HXuQF+SS+PKçbȄQEc{@?OcOuN[ (hFBiVF+5u%.[ACQV;u F]lX(8À@k$&!gR(W*1*@龐MTKT:U$c%wսy?=VcfWQ7dᠫjNL>TR=XfDc#G-pՆ9$ITD)iR6<8m gP-=F#%4'N Ȥ0L֝رXAx;7[\wsk %{W}v1&ZzYFbDŘ(+MHjJƿgEiawS^^/e\0)AVI+ ZZ"o֑t/J,,9>~QÎsbk+yppf%#Bډpͤ =a 8QQ$^~u[:meG-eF褑ⲒT>$'A:A[P{9Cw*dK c`U.<I㪂i #k*d .yRf`HJ\ghDh8WSW9 bFz%=K\Avm*fϒsҲU"7 C& 3Xwcj*bZcSd,p= JHY%Y+caq1%?!G/} M ̲ѡ@p z=)G#WzQm W]~Wb)dZ<,\vb IZEP\_=rH! E*V8J9 [H]BiRA|c3T9,HXXjVS>E|wl['(W S 4f8PR==e# /ntL8-UA#Q]5y/o RWR6N-E FzMnMGAIxe?ePG#/ 㝂$]jJPm,}NSrSRU2U&.*eg5SLes2i [$߫-ᘯSZIݮ$RP(TTPqSܞ+3xd-Ni< xH$_*>۹MMSy0۬.FdFM%+K+ƪRm.q=~#S,K(HZVԆ8\Rl;BR',&:ov\Mu\|O ES uQ,.RŅfbJtC&>5\Vb%G1b`Tm5rAn E"KqdzU2+U[{;.?_*R `Q,~w@H#\I:1H^Vh)s}ktK; ][H h]I˃RU+ąkZ}G1x)!j'Вr@d[U0V ]#n2k`$9\5Dc*99 eHu`RCmA._%쐫z~O_=*عoą`d2݌"WVY2IHH7co|6^mLyh~sP ,~J:p֧نeI%sL"RSetPCytM$yC{`܌cT5+•fcSף+Wѣ:F-VF ֠jSyۙW)9zGO9P1vU0gc+wCGn(aeMߒ )dF'nu8e _fFmĊ(M-YGhnF}.۲5Dz5 cMOlMVw4%B0|k>%Ūu !+8´>ENG+ǚ91?a+U=EL&)Q"&7G Z@xny +ՙe 'JhhP P]N%RD`_MuH[!FrS#wh-vbmŽA:#&㧌> ocl-TpjH֞##n9OԻql~ە[@LvkKʚZtt44B|RRP-oH |D'~MZU,=ۗ/U}K(E[C( *=*)~޲UR+OQ(E2Ή4^i/ Y9#uuTY=j Ge4@i5;73+EeZ7Ko6:5*&RFuQ:C[;rIsycLrqJiҥUE{$a>%'CE\# NK|5נmp&#L,I LinmсS.؛3 Y!a:9*hRΪT) \7R^HO`N+ yd´Fl\Sf Laꌕ 4`}`Q)uJ#%7UҠEkJ,}Dqi~7ol*-|;S+RxA[ 1I I%Rƭ.2}YQk8v4Ӣ덢{҈nT,7i]VP1 T0'R2M@۟IYAơo{ llxUKWD9,Rlmv&gQM3: 2$w1^ R!|/w/̻LGz=C&”u' TccYeX̑B$Vs}J,~.ltSQmtPeU5y%0 V%7]1ړݡXA.WRm\Vµϯ˹eZYj{@A5"ACԗ!c<` }PsGz⫱;dᱻʒMmkw7`և#5O%<%bѽzwV[.{GJB d?+?^OX`KZIcQ-UE R $V dU:]u-l=n/ai7&Oe:lnJZ&j*h84LC\}VV2ʺ5pr)H}I*@y=Wao$f;g +vNt݅{"9l ^۸|L-{T D^TJM[3gUPP,uF7FT8(V>;|~-w.3~94jG_=({IH.%^wWV[-ӻTmz-6['yț Nu4B%I'VS|!!Sݭ쪹\rjhHũi]9v0(̑:X:z^ 598uw6ahl_ixc3r_EH 3d,KOJܚYL&V\f_-϶8͗G*ʘEXݻx+DAfTj!%_H>W0HᩣKZ]2C0u&{L՛g26 ߡ5C!'xr0KYRM 1FI}d 3H`BvJcī4rI!nQU([4@$C&?ŧ|!U;48S!CvFj'Q؞lmn[KUO z/%LmĬY*!M>qt9&ȫǜu=FUej0-LX꩚;$sPѼHR hmAf"X%>WӐ+BQ nԷ<ʜZVz܅-~䊹q4Q<5 9L%(5.>'Tn~Iw&V7fGN(-.ZsCSD@ڄK!$8RkY7 , jK>:E1vZ?Ľ,_AWy}lwt"t(2 5F5"8֜$0qt،N3;4uUUDr<)jxe|cKmrm{mKRpF".ˆ%r \zGӮ6޾Wd2ٰ[hg0R6G+62,VoZi+cjfztfU׻*lԯ6 i8V3,_@plߵEaty˪6DVCBзcRGjo#ď7]. n풣1qURmܜ SAJzDO(K$qB$$P NJV˔;,2MES5$pXY ' ҆un\* ԱGWTc$$S(Z)P@马d%h+Mj>*3K;vWgGe9ٽR*(7&+& u%qSd #+H)R#q㺩۬łcxYf0&bUčsRϤ }-8f'n&㥓i9(6DR1--\edRre]RpIWJ)ĕrhʡVc3?m%ef]38iQҴx9%t0Os;K%n.YdTximEF$ JxM>c]d[kTlŁSmUmF3S-e@\5\9E@EK2%/]W=%E>Ө[+mhsYX;*zʌE&H,$3iV+絈I pe`ĬbRhcVD KMTt3ӖCqOO]7b675]xix_Ij'OkZh!XKfzdTf \bқ**,iՃW%$,**%\2XmI|UhtP# qjf\!%4&^ݫʞaGOFs/pvuobUWm3e5MVfl^Q$"1j65Fro<>Kte)dKzcO2B-EH [MWfH |Gx aF@Sg,e^gmNj]ky|>l+TˋlT_WdcU8i^=nP-z)6Vu[?]Kq56j.XE3;Ei \\]WY$m@#*-Q֤vzl9',A5m#]Aud'm:c`csIEELRx vڨѨFq7J"6gH´~@&W4It0+9g'jfRIqL(؋[Ih9e*SS3uxM&%!Ri%A$8g1ӥc:b͒zm$|c]y^z8sԘݷZ*֦Ï1KAf$M<D$ieu?fkk*1:]YO%Wm)]67n䲰"+* s<"I5|VvHP:##].]%b/۵/P,r4#3#)dۛw<%rPt5rGO.Hfdh:3,*6>߷V)Q NWTr O8`)FMzRB *Uǚ;:/}zϴ(cRM=ysS.Oiiq/YXޅ㖊! *TRf6~LDF莢uT`W(V1CN&yaYVB+6h }AAhh Ngr 4~i_5kR&%FWSNPӠq]O IAM33ij(57ّ֥$$F% XCџJ;?[S6gbN({z7$~tݧƤ1Fxf5V#gU p}7kb2SJхXjV e*f'ۗbP[EklwrJō.WVStmE@W<}:1jJ%T*j# #VU[bѮe sSJy#*WKuZiB! bޢgP.?20(˖']4#NH]zQ5P$@"gI[YM^}> 4;B2£6<8 4kY* (56}W;w{6of$= "<|f\[µƮ$u:G-MQē4F6+m쎯}FC,ldLa#kIKdɶF!^SP,O' =zv%c /;ƌVŷlad!tTӢJE-@r/ZsX AS&]hcc~Ztq(Y\ikۆ~Y7he-u%ꎋ\q H*yuBeJip45o5.CiSA[ ULHz0{15ڊ϶ˤ 5s9: h@H?U{vf> UE4p;p:Na __qǧAfgǘ RCNʿxR~MFy4-SC[K QQC-Dfj #yբUR ݪ\rET覚TY>^!f]D0́皏Iz{^.+ixٙ|e] 5Skiz$QDt+H,=%R2h̶•n*dE}nkU:X1hu+pu~@<9oqcEGn.+=DcIBhԦ"~"XPUyubԸͽpYjYh 9چz* Ѯt:SNӘ;PcnIVKʪȁ0m,TR0=&@ \I>L; ӉeےJyfZM~  (Zi+)q{~yz\l֫]E^#JJPyoCnlĿ}C4')*t]#X+÷'0+P5~fzvRMJk ,:R  mum6H ' F$SWwr=߳&㱴*DqxIQXWN⚦Y!,pA#Bvfܞxs5!VY㡯zyfP .Nu\Qc`Ltʚ(ӰJQi^3JS)2dUSLRJpƤfyZܟm_R,}M8"fV֕ǕY haMw_g9fHTU8pӕcqDMDW/v`m3CSn#QP;0Z䑞*U'-ONW!ٕ$E}wm %6i4]zmcӃOQI<3t<Yll.M֏A Pm:PF\rщYOgnG?;fȰ^kC]"F&pd1kWnZA;k$X?][~ؘ^xjwh & J>Zje`<*/k`@ [vh:k(Ir3  c,jԪjZ-V4: ]ٞߙn[+p[;qtZ7Pc)n#=cK2?5Š}͆ɝӶkjruXMLձڪQ؆oZq+fċuDo6x1cv >i"m>bP.jW˫P<XSY:$ #*/,cdz_ 0 4U?qSTWZHt`kSԅ*2[=7-ea&ڂ#2iO5 jŒj8wl̚di+M0|Ƒz+[1~PǵFᷮ3e‡'.$Mzit*p˦i뚎6~学i(:]"BVFn#ٮ2w2pSEt(YHp828Pz,z˷;xVMw5T{33Y&}qOIALZtB**GcWS-FpPTdDkGMLK#H Ć6c< _PWCԁk1MDjVaTt j&b$5n n=)LINkh*穘A𢋟0;{yse.A\^YO5!jN 7Sor89>E-FK+Y-OTO [mIx@Fd9>C%:*x!r4d(h$"ЉY^IPXMe׌LJ瞵l6A-:s$cRº/5[#o֪@<Od˹ =ߎI3aHTGHBt&04tfNL+5f:T纍xz"eYDz5ޕ=Luq{#O}['3-S9M| n?#Pb$~TH|ZuIt;bn(AMhUj+}Vw)k(BU5c%򼑐X aVi> crG{Wj9ꪲ8,eVI梖x7/Gpյ>˩E•46R76[*MW GPIJYXVcM,HRH4˵]ǸΣG:P҄A<8oKsg֟g$:dl5Xݼ1o)6 k6?7뷶9MQY(w*`YTE}l}u-ndUeRR d\PLK,ϨƮCSFIS$u~.,*c,rsЭH悦!GS -2T*qhYf*H$}2Ht3Y]°M;"3j?Mn1}~_TND#$`H؛[_&ݿbml7hrTS.#Ay-"Y_p Yoi5oEr2vD玂xUY<.IL 6{-߹77OߏU֝;4:F܂Gysf׼Xnx2]C&4IV6zyʇO68\r$р\j$v՞1ʒd7_o=N]OE ԮyZLU;(AG =24xƮٰ|dعtz,.W/|HP`Ғh2(⊶h*CXث8^ v'jGi}U>(fPZQsuu̳FA>߈ޙw4"8B}b҄pVGC%rx٠8܏c}*C$-G_$XKR 'UJ>*;{_,Edj__t㔘br`Rjn8ȍ;; wt.񚞒-NA)jey1:骫tXe_>"u]}^/,o.o YVRI yz\dܦSnvwۅQǗ1\ ap9{ȩHbLfަRG-%DRu:[^{̢9+4Oa(XS~۳kl jTXe("2 XƦ.nT &=T/w/YPG&хVe1i$sdj}0ѭB#ief@L,.68p32hc÷y:E;4~tb}s[H}@uR?MFˡfo6*)m*'Td'%X{^Im4"M$Gcƃt, ?/HSZti"A'87|:wv>-׻Q;kplMcifi[EeHD=X6}۠-ș_HG(P~ڂF:5{wE#X|cS<"w3:\ѳR==o>'e=}d́*,dT'&$A\!%-$Qa;"eE%ٙmM_֧qmhuH/UZdiI%Ҷ[~8ǓBݱ_sǸ8=R_rmz8AҲIWxU)0#)'5r\ڢƒGN9>c9.my *cxí>X2Vi<G VzT{kfGah: )2-` 7T dfB$>uir((tyku .H4Vhi/5LU4[P [Ć*`o>KEAQ]ɊCGzKMU:qsr$lq Vwud$d*y+>iz"/51=⼿uT zj&5}~\56k6?Tv!WvZkW텝!RuP}=kft b+Jå؅0QĞU'|dkqҬ}H㮅#E)ٯbae {jý;/U*r{BIO5BO^8"VnIbM{fI!Xv m 8miP #7A2*S9JC3S2ɱr0TtS3Y|kZGTÇU,"PF)b>L[1Aeef W+m+M-LSZh$XY&1$\;`?a6ݧVu6JV0YL>ZoQromLIdi&D̻ MHPK@+CK*Sצ)zH)&2G$51(kiK~Xo}QӮ ?m]I8-H2)4T`bybk6OwTwf_PɤB=k`s!@p>.@ͣkE"_6Z9.(5Nn;A4x9­1buE"7_B@wQiҳTΣ¼)u n|d"n{ )`OqI8'2DxHg5*E/HAx 2n9< e}7U&2J/NZh*S5=\kYYթ݇YQ1 ѐi2}sD[-Ճ#8?>YUk5R⪄xeF[+r؋$}ݫe=#VRø5%l0Hi4덕vSնg[K( PTC1=mWWFH?#QϟLy XvD {E 8'kku6f(r -M蠉*׫O R$mMT s0*Â;ѕ_JwpТnFϹlG0` ⇵A:* (:RRda5eh˩eIpME7mM&E +[-'kkŔ+G"!Uw-ae &mۜ{5ğ35VTS ?h՝MM)Jޢa%:AD9>>6OCOPM4L Ơ>Zbml-c]78FVs#i4 >p?.m3XllmLCV:[۟MYÖ>ne+&.++GM mc/<7c^/5Dy(s9MLTIM;OOR55Hb[f>` :Gj֞#:^q u@P&HqL>,}TZ4<1dx]`JSOfiPbas4= #5UjXtihE**IJAmSr ` Uj@ZyV=c%2oLtk6SMxҚH̐zdKԛ,FF"Uxŏ`$RI4>4ꔉ)Z֝2eoϴ$V=jeÆx㬆xCe f'XvП-O:bH}۔һg:=*gZ)XנE4f"2(1jL0S@+Z[INфoFW:04Jdzuvm.S|V a23HQlSYikvXS̍fAWMYi"HCOyPIq7(d{ƍYu|yhT'_˨Iw$ akkC”㢇{k֎i#pjk6< zvIĬ)$ʧ-1ci+OIcpB,#X5 ;pQw-*<;}D%Ei@1J' {7[$UIfIC[~˲gijcVSSX؄D%7[z˃[Fz2QCW YuZ?g^Id:ύG!mZIGnt )AJ \[xd-61EO0`Z. oZ{1=?yj)(ksUYK^5M)+3;1!3\=r1ǺdPٹ pX}KIw!e4u g sN{HAgu=Wzv -@mȶZ*XY*ߑp]?{K'1|~? bi#f+P@$ѩ Ţ'Z.AP8߷xMgc2bPkݹ~eD x0B swtPu~⯓r`+NrV:(IQHMfωSQnjszE5CUhِ-.g!F-EU bUJڨI 6-ߏoE\@HPKgȑOjiMRx(gXjuYc`VHPU PVCڻnvca1QSguuA5Lt25SA-bYE2^B.QH|XZP$<|ښ}p{yCUT{ % yFj44ڌ)-}Y":oe$>`1j@r0G4xi*WF]Qh"$S7$&i|mJd~^TAY=V!*Pc'Fc87ȸ<G Bkq"Qf6m(A$C&瞌R$XIL@6Y@OwUu$jR?<٬.IbBW^ V=B-=9_/y&$RؖT!I?[_F<=?pŚSb s=BQI?_` PKI,A1Y".SB$ӏJ{6<3jAju!vQB8x8$̶?Tv,@ߋ훫`;#c>gnWQ,y0Wc-\qʶ0i8I!-ճFoҌiu##9ϑޭ vѮ-Cc2КBP䂢X%Ts A0 'i񖒫Yi>+1_e)rj''jhĪ^GjP##}rppZ7}.:-<)M9l,BQ2 (4e`@( ?#Q\tjij]&Vi HBX]MI9":giA-vT%ɭAZ KɨFUY@$s{nxzQ+E,{rBZZZe;UĮͥXts|L_??oJ|B Mt{1h]A_1ע5 3ɒ8&!S%MO;^O2Y񫧨 6h#H`"+)`ok|hՌXp7 FF4҂r|,uL9o;~_sK44LpJx3LFwVi Q!`H<;k[%KK\+* lpgVyRgȑSq;撇sV&\vg{a~m9DG-%]\ck6׸p`st5Ut2k?b2Hehq3^S{P0o 3?ѥGjte9Yc`po~ ASTpR5M]>ݭV* ZYhXL4T+DlJڥW9IT6C4>} kL(*#ZTc!q5xuD{49]D[8a8!dfa*EU=~cgK$JS-ʫLN`Q%m.ŻN*cvҴx}C;>HUXf#RwiG-JSkT7k6 ] GMF-QZy憮,]BYYc T=+,ŽѦT^.߇SSq$( P(xDGuZe0 rH EPxu#b~-כjIH2j&J-Mh C,SS#Kz%,ı}%CUNTWqg7$ex}Τ (iGe8j?fZ8ёLv`VK>=Jia}^ EІDtJ2%$PPÇ@繸y64FUJhu(" SfYhžKOMG3"l YYq.JoTMR!dԢ8cu_@κS/hhxa5YOu2NlNmD*idUOO[]J*QI$X x2 /QSF4o܏o5ےˎZhe)F~4X]iQ7FMBŰfmrA"! znӫ2;\ #G|~[soxk_2mE%M!joku8*ةw\ɐPNZvS *J8$sDH2?Uy1.쟩j5ȩpY *>QUom!f?a!ǤhdksWEO㛃(U; D M7hr8pN>|K7U5-S~0,ʊ 2\=f;Z0a(B% pWkOJOF4 EW; TyX6rWϛǾ !L.c MYgϏh., g^tɴFz 5Fb;۔6R]U,S1Jx\UKD̒BH29I$R{yC2)իZèi)1){tMJ <6Ѱ`==|.R]ػ&0WeuӃO$̨jhgȈ+,ߛl&lD :3;>Hk1 ݶܲz`G+ ImE1xh9K?Abj+8Ӑ ;|Z6l.mwܝU5~?xnclFfe-CNBTO@ O`v{ټddw~8v9Z'/RI3:䧬J1dP8 v6ClV.;QY$Sj]VaM]%ot}aKCiׁݻO]۰aۗy6Uy j}b ʳv4?JW]ateb9MEAP_N6w{QUj+/fȪvk]Rݬj%vF9:tuHjSo e(r Z-Tq4 >{ lbBP"J7!׋B1Uqh2)pI/(r8oX6XqUۋ'sdi&ˊʆ`! oKm{kb*/T-+#@t#R ]OJ< :@pvUUJvzʽG g)v FY%8V3)ݛm~l#sxF_vU4Ja%4n:8/ ~eE:\mD:hF =J)TGpǨGHd[UYfnݼ~6Z]g`n̶o ݋Ñ[juEWh\m\:jV_^˧4To5]1UpE.::w5ߛBӈS9h7d VmU~)WJ4STeM_BQJ\<%3gs49kc*pۯ*\rPQ` ep\˥V')gjFn] -lqn~ǜ^*1K&ٯ&>zBO.UZw+ CҴ[#rXQtѓR]as18f"Y= 4SB% IM &B2Sp#Χ(ȵ ftX\jJFw#;-RZ%×|^%7R}{lCW60DѮ- PE!z'+Dn]ژ TPE SFV=WdiD#QZp(n(ULwATsJϤ>omVCv6܊ ] OJ Zܔb/>fSW,QG,unOlEv1ͽ4ia˗nوJ:\ AvHv"WdfFʕPapQL~GI'َוzt'lw{tdž6UD8Z-Uy,Bjy /ePe 444b)H2M=AfHI${,;jB*1)&zOu[*SPlf_3yṼ(3o!TEiR;;Dȑ*& uUm2UO#Rn.Mh%TIm(!c+H&HeORWYW'JY&IWw~~z>gsۏ/Kr%gOY2Y]OO 545 @BKϑʮYxV Qᥨ=R4 XF}h3G~"f Q;ոic@l ,#kgwEUGP"`4;{8ӳs2Q׎ód[*IVc1k[RfEa{lrL8Qj#Ee`R4(sw"B,(I,|CE볽y-Ӱ÷/oWuaguU|#2 T4 j {"1g;K|[y5FAMM0ѕ3 ZuJBI&a!g\6yz4VxnP -^MqǫEڹl6Fl7f67Q M*C^mB6جMT@F窥l+o Z:|uvȊmVVq)S`/5Mc*9 /f&{YKi]"vQh7UI6 6xStň6+oPz) <AJ~duXjUrsoCsٚ1f+һD qCkYe k{Hªtƺ~-Ҏ"Nj0TeTJUŝ 5"c#!>8Cf%"]#C3fz\.֔[bF[];ia(r{xdVo,^ީۦUSd)'\^ QN n KRq窧޾HjRE:8CPK ~OygXa+) Ruv4J'K/D[{# vn +loagl ǘ]i`E ZJ̰0 #Ҭ_9w~mkv՞c;'n;ghO5| )9L{FߣtΠ_O7^5Ӆ]zh*@ǝXygFOi*6T[~F{m zr,qXibGxy"^ua/-\OY)QŵF9$ĵn>/ _#kv-mn|M-<& ѣQrHn^X~֡qt|>KjV~VvR@I"ZʚZ|3MiqŖ9!cubabUm3_5oJ_gi>S)kn[H>i_Y<=:fD8A~+{kZN?.r.ɻ~]܌ y+$YK<~:#F_Mצ<qmfݻכyT2VANe$G׶X]*+H:%.qn}Kyȧ[:t`%zX`_7]~5i"v+Rl>J'?L%ܮ oy裔E3V1K#1*ƃ}|P/vn7+ƕ?ϣȱ%S)jAy\~|It{m=EժvՙOwYp]4TLG& 9iHUjz[CXje%C~$)H'ٯ%'0mשiYNZڌz.`m^"O_tRTbYRMt3MĴZ^EX\"}m=[KGN2 Im15VE %X!hv Bf~[ '|&03JEV-~χB=n # jMKSʓE, < 1Pܓa۝g6G:jeBEۡ؝/A{YSV~/Ni H_pOԜt`i1POjYd* j<'A>#n=f9an:z2tThThf`JXxi|1pcAZ~5Z0%"Ustj6K-%<K316݅Gh̶`{dvlAY:j"v!Dy8Y,Qw뽱$WRV TW4= ". @|gֹuӤmǺj+Nb|vҮ`xXPOC2NHXvٝ_; wU&0)5R‘&<`ls,"!BO=3a5*Se'-挭r2IepBamAq)PIܛׯ;gtNm̆Ξ FR)hk9窊32Ε5*GJj g8=L.+=C GPUFLJ12ʠ%][uinɌs5pY]wx׷vf,Go09laTERP!MaǻO Z\FTQ5|S>;tUL7O"J7>{[U-;QP((-)9vKqx2Om zC1E ̎;&{z|Iޙ 7&bXymVk.yg|f$Ĭ̳i!A15Թ,M4,[c)BBUhx u&mpmkio-E րTdzAЂthni]T01ߍ'A*>& S)6adFc$i5 m]I-B+ml6Z7rUИ$iDMY-e3 `H]媡N<4_յtejFRa2ϒ1-#HPo$3+}e(jjV,Tb K6J%,r)Ei'PRFXsc,Yl [p0jQ@QiLR=n;suZ4#|.-IJ[9 h2e &xkhh > !ӱN?zPø7 VB\CKQ/͒`LՔwM%uCyWd#$[Yob=W_K]]rtL-JTPv.Mo`$y%`,tC{<|r9_ |Axէ-=GQ߽oq!8>tah0{JQ=%LPNYaf]&z 䧤¦:KcU*>01ns]]]܄ЄгvԍDK|C4 4 bx@yt0m82sKSaAiISk϶߫|d2bh!𙠒vX?>̶]B@9Lz([^Ѹ奸˧NL %c]qWPΐ#OҪ <{8?:z Q nlS-==9 bA+[$almF[Kskd*HZ5#$tv0P֠p%0iQ_μD_oJSm9)NmMCW]7VN T8ҨdbVe-ۧkVs+IG]_#-hVF+ GS]nWHAY]@1WHA>lݱ˭63A <1^2*$[j Uvݢ-v,-(On*F@$55WAg+'P8RHjתplN{Vlml IXR4$tfԚU1t7b,+)PYuDS52֢,F1~x6`ەaǴ ,PD> ui:w?ձI:epsR,yVN8fihD9RQ,Esf,t{0`&&pO#MrI yUR nj&%}oTi֌iRJ֕'!cżFRªus ^5Tl|ժAAE(GU \飝"#}>FE~ջ2`JcdW.E(՞F]|j}zt?r BTTWKt,As^x842y-;{kS']Wbu81n|dڊdAu- "@U.MQaؒs'rWo,nZ&-=MB*y=tHmsmmU[x \KWaCM@@?ӆ:^d6.I(VQe}BH`8URN[AwhDu,tX"IOMIb$Eʅk{6Ͷw1E{|HeT!x^$"76?Àu?eb?a -$ZPV£jmm>R(voPbU5]EmD_u4.?ot~c qՑ ESECV$~zPst\6[^oц~3MiDփng IcS$Ѱ)"kRP*E%~c+3i}sm}-Mj͓>OrONIuGG.;lkA웏!2psҴs̉˸ Ө$$H ၱXkmD1qa0c82c'GH%:Zh*pA{zn3\\(;q]Lo?ؗs_2Tl¨C2S!cME_ =pKU7IQgA);GPW!9P)yҸ]V#I_z}uKf*hj#FVO=+5@PڗI{-Yԙ GR@(k09<Ŵ+Rcx`]aVVMG5) E>2r`JmbL6 7[6CfO4bw=-t cA?􁂙YFS] ?D(|/bھ3Wڐ h|SîF(r l!jAA,|!ocO e[i*3MQGRIK*ՊUdIbdOc EddM\/o?ָEpJMvFO7>ܤ,tW} eYE?.@Yx[34˽3rխLLrX*,U&N ]q4 U&>[v Jh,IJp-AN2ʴQNYJ +l.[o6wSEL[qTdIBF1$o=Yk$vGEUf*i?oL(ςh 8jvŮݵ'LPg$\}lu0 yL'Q6e{3=/ݷ44OWSOWAdU4f%cZM#pgQJ[Аӣ_ !t*:ƭXTۈ}5 px&pl%.B!+2/``B%+L˳59 >F$ J FhMu!ߊrs(XjF~CGJ,ܲaJyR CFE`Xi B)*'z|hz)K{!=m7E'ɍ~uo3F%+ץ6)OتJrAeX܏#ܔtu3bf/ږM(1'Y y$7PL}ϞGJ>uɫ6\n˂p.T? 7Jsp8UOX* UV9.ݴڵu 6sVPF#) lCQ1GEoIb2I,nֻ0hZkVkk$YXRҾT9:xYhb[qeRyU~I}x%;OcCKln (R=Sֶ:I<)[],ҫ+os= .OYr_o?z!{JO/ޠTF*ߦH8=6_}x-7f]ڧtj(j-ѱ!SW2ԚV5AeccޒklBEթ<9h[Eml)GXhDRE,HTS)Ta :,/$޽QEJ/_'fL-EMVehU0G, T]l7 C wq'VpxW&vY5qJStߊܸlv[Uuz =DnQ{j]S40+"]URRXkq.xʂFD2@۪#&ޘl%xU;ca$тI$( n~ʂ4ܶ֫s_j6;I I]]cZK?R4[f??]u#=؏U5>0PX[HP{=mo}}ʣwE5U4R&JqL4BP׬qp>d=oF`c?P)ǣ~loUgl|FVc-Cr,$YY-rw];Wwϙf jc69)68 jZfG +}ˋ褫L#e(|u]"H<nhSOt-xvՈIE QO,5Pq~\?>RpxԌU~o Cq  n3G3to y#Y&j "95hUYcEq nXKDYAe0zu %*OzP/ϴkn5kh{{nm62&FP˻+6,eiيEK HB܉lokD2w*ԦSæi,rm>ƣVQijrp,T*QC@[Kpϲ_jp[a*-J9vj$ 55LHQ>3Yɾ_dO3_VDO :LJZH"0Z:(xcaafC8Hec]{/tm*#Y[%lNkr@MjJ0[/'o7̪-ㆮ)}y}nA 4Tkh?o_-_ԇjy'1D*t+䷍4Ko=+M.&biiEp )7 ]P 5M\d|iZ^Sr߳ݾgo-$Oo흦1PRm ,L&j)i, 5 ]mn=ׯq1\uXV]EiLڼl\4܏0> vW* @@~K/PԱ:IثèYR%n8:HQUVݿvNm48ŋ &F\\0gfWVjWлpnY-tN%@?>CR">B \ݪ|Yݻ*L_eW8=_j>n5IAR„,=Ɯ;TR cG\ $dւX/#NI]{*Fx_%/5GA>Htx#MJw3U/YJjw*d!U*#D}pyXMqY_y]sb[!&49 hI I QEID/nJ6$cso͏v EVZETQR@5 584o7A`óľ'-{`ǁ:Ij&"Kj,U.#M>%4`)\K@yӛl{O{rS.FLtT=L4&(\05iPE@Ow\n񶊨Ը iƴ,|*jhH-uA$/1FSp?Iϳi9{gd#SME6Br*:5D)M\J1N@NX4-xb~B:SpIfT$W5O?F>[֎qn*J,uQC448jH4Z/48<ݘigQ+ZiKYQ gUDHupöXqHaΥ?r՟4_q7´e^t}'Q---4pbi`2^fYd7D 0Bf'4Ӓ=볻;qOp⤞;3!$ ATLY Ǹ6]bb5 >u =@ރ7۞kڹB%k2OaWI4PEt4՜ҵ 2(z#jXawг X33_:QmYȕXNr8En߃=TeѷY~D*>4|CH`i(h/QNwnlZ[Ui!ek$PX 87Ŭo]Y3X0{Ľd24E٢$2[L:-~Zր##a Z]#(xtzսI/ nKjrHE_&MEwW#BbH'PZjHxSfGBH3#_6>]Mρ 9DCy3~F.3[=Y *sVټK\-܆tK#0`kPEu IƘH MIE$Āi,IvBjNB0SKా:LVonTZj"6.TwOwtPՆ>r{on! .ԥc х - tU[_Obٵ)2ԔOUeTXfiu:Z5 *y"j.jv[P!QOGA{[gg@?0ޠIBtLEHR}"H Xʓ]Gt[wN WvTYrMpc0S%z3#*kE QB{v5lr% 5I *TzyW>}YYOH.5%HF ELVR!DeOy,oZ sdn}&{lD*>瞥^**]D|KBKJ׶p |)6)ebI9!(jUPRLɲ 1vi[Z T%XK t<oIV(@(Nsʞhgר"<Ѹ:݁mtR/|sȤG NWse7/Ir#۲)5EV5&'Jum=e 2=EO 7.ܸ޸t\S U_=u 4A_%!v@}֎{'MMXTaK?eZ9r % xnE߰RZ +^EJa E~%gI8xtiqAE.#Y}R Y$:&o&O{1EA+襖ēgȢhSTB]K1HRE}\@%)` tbF TZzV*oHUC1J 21O@Gsl͑Yݨ1qO 4ޥ{ Adwf+1#YMy掦nSAs7:LFBJZ3DtNdb^QMxҺ@Ni Tlo]h[4g)EzWYW#G{zlP,na])jаr 3 qFvf=OuԚlVl)'g fZ[$*h$GW'ՐsREj:˽l9 ThJPҀ.NzLRM !Q*DE*9Qkz=*vwʅ Bm+V) zQ#zs^;tsnDЕVU 'p:fT|`VV3L گ/fX\;"ɰ7n;Y:HKSGYRx!%.F'IMZ>'5B?:| =~=0l[= m2>ČHQLJgKeK„rZt2 ZB(5*[_4QSG%M1W! TToaӤkE| p{3Y_4X|^] /,s,Ng2`P:{{ዛX TRTҤ5<ʀUz@$s+?*T: ;nU;4?=[O9͵TeJeM SDP@ݼt(3,e峰jJ ܸgiTOE]4Q,3GCjL  Ayp [IH2L>xU$|LT-=J*b_GrA3mWgo-,;A&rh(r{ǧH学VԍT:J*SnM;z퍒tcnkWo{[ٷ>guCwc<:D-&RGS!(^9ٝY_ocu&~[!m6g-Q.&⧒)ȾLA#FȠ7ss4Xm%dq7ESOLs4#&+kqKdy=O ؑHP[݇=L-r(TK? G# $QA4i%7~Z/i[lFs6T=c3)]|USUc SpUVjUiehG j-16f|Vc}q`3fipCOG8[#xT{eEcjX48ceF23Btj=,qyuCQbciE{iV Wc|nn+vz`7Yfbres/-e[͹kDw BEqTF\6n#, /+_W;={^r<&}뵰OMP254cso:\6#3PY8ziO)Po0TgX03TE_# ގRUl]&I̷xLc*ʸuGzMpHըm'ydpo STp>}׳y*=HJ7memv2E66](SD%XO1ԩiv=>\`pmu*GJ4+<<]-D ayu1>[6ۣgfIHS@+(Ԯh:QZx4Z1;#b:`j+rF\tM]==USaZ87i2%\p`Dzr8:"4Bjr`v}&«sY'$V5OwrIfFsCqm ?,$ ޛ7ԨGP JAIore19YI=["*\j %wb *-W aSjĐBg Z*w\lQ,ܴVު$:V<~KY: D`} )ٶLVڋ|k,h5Y5jIG)WZֺ~Oϩ{:xeh0TmmdWE hf'Vjj[zǦ쌴pO2 i4)ۀ vK;4BӧP7jjUB]N6["tM+wm"Sa7#-U4$zc 3-[F2j,e్8SU -]&@+"2kf)`>ˋ}k dES 8(û#@8z7y'05QǗjc"JhȮm6@QRh~4uGGldq#k0wfun#EAT9,k%Pn-L|QÆXj%OGz&ڶ*pL4OJ3& ^@(Zc7yl;ftGV\sf헷6`7:[r|vwRw$ռ)N$Rʊw\5uy_􍳪&J`mü(jqa2!ۻCIw)}I+jmS\(M/rpM@@ӧ ADakZ59ᯯV388%?ZeR=j95ӸkhbE":2CU'b<Ҡɟߝϒ̚MOmqPhhM,pSMS*FwX)2K]M(ËDb#BYxӤN01O>,Um}3n:5Sa3x ]E}5JJbJY7b`WZzFZU $%ISQUQÖꍹ-![3OKA,HIrUo&sEŊ,E$D֑))dU3* ʟOǦ]K*3vbJ{cV ÷)<%7zXT,iР ߉ =[/ }V.tmv5Uy+^,&Y*N6ѩP*E^l#HJKTH 6n4Vo;I5> B+ <hZǯJЧ[i[AjT_5-Ej1DUQU ۿk[=ۭ1$ :]$0f P- Dlca@j?۳{ Rf-M+.wQEuZ !f̅X)\uݝՐuQZ}AC,t:Xe>* o{/ƁwK@ĤKIo3XJC'_Y"{B&IX#ed`xQaMry:|dzs9oyle\L;Z]ZK54rYAee:xWG ?VS-DGW;LXo4PP4=qR Yo-/52R\*vhs$}[,ۊGXP?F:T,uw:Ι4~;=f5ͮT0DSQY@e^{873y}׵RAۘl5YDtԶWOSӡ$1_I{kΫ1jJ&4s"Y# }(.|c#Zϐ-{skόlGrv3\jG)*J dQ2eF![I]:oG;KY[r*&+mXBJDbE{mg5 nT8.%C5sOQ #ˣi uu #]1:sIL} ,thj%$$Bn݇h\]FVXs(D1*[%*䫰ܽYnmFCTNl5 2(5 4ΚOVO\_j[RWqdjUnLYii}U*f1NHF2U}P3~0QTb4FgLeo0i}pn#{u5ϰo2mcG(VU@ƪphڅ)]^]] L-1ZBŊ׏ qXٳޢ1锠EjAP,&Ԣ7a{1k9%ɶC SKQ O =f02T#`Evh#Xܧ6}ٓX4]* .(I)C<igoyncYicXbpCW4ᎉG>d%YU\1yoO/+BL/UHلw_j_8ݍ[>?fO s YQ4oTf[~,}=pHV44>:95諕.e,cK'N$U+=?˯91쭵YV35<4jX)F:G8hieEWT7 :GܗemwG<7 1AJWX#Us2pv:Y<]J*/+V8iG7 >jdd)kG%5n7/SԬmuYcf Xj_qswv]xU,.P*: ٦#Xt1 MF_1zNZOK{Sv͒b*/Ckʥtm6hArLcUI%ei5|)' >w卫cya6dɂefat*b`+Z 5cHUJ ~qoq_CpRIuƊu[g;VJTGh]u)*d=Nt um6枂ƐRep*050}=rܛ6m-qi+V=5ZX*3R4EBIZ)pZLd[sbl}-<4{#kQ=CjT"JI;H;KY,Of71xNbIw{@*#ɑ%MR edPT1B9.bD~q\(֪jҀҴtt&*zܺN'Wۊ"[21m`OPYWӤ":;JSJjF{{ CAmM 5$cy&tuN}APfnI.eHYJS,Ha4>w9%c8Z4yuD{{;7n[%8}%du[cCGOQRK*V&HcF<=Ywq3⦯r"d6j'jq52ժ#k AQadż{Lq Vy' z1zsoͿP(p=G5z cHc]h] ~'#Y3ATn\dim-yymeSkAf}at]O C*(ԲluoXБevdu+jǝuyq)ѵ h)R(O{?h_'ՠc*)W>BԈI>5$;-j1Y 鑐\MfQj b=!kk=F”!GaP]ƒnR"CY3ޙ<:w"uUζ={ 궟SEMS<4Q;TI6bcwO=V#9d㠩AESM/[i "HLmXI$&EuuF 1VF5y gWMΝ5pIIHV ~sxF{m&e6R;Ii>]qym츪|8LU9J q EZ} ܃ rPChһhHE `hAW6Ċ jтZO54ďymZ,FgKEpz̅6zSbn:LTn}8UArtyr%Mm4O2ȥ)yw>m;Hޥ^T|ZJ!Y 5ɧW\] VNA|5m4dUG< I;)",x>4Vu`qƺF($ }eddq`ଡ@A.bU~'_Qƒѳ /ӧsq&4_#Қzh_P/$U Dn)n=f;mcq5ǥd41-U%MM 85+*U؆P=mkZZn\! BU* ZX*ԊD>&jkAb޽:5>BhNM@O5u;,eLx4uIe'Y8 Y^6Tn,Qp{dXk%ގJjr,Pzv]W90Zd +JրӸZznWQ{ui3;o9gjR]bV wJԕf8DIP8mRP,'/ɌV;9.ЬUIdR n c;A^Zghq}$<{%7vko';P  Bh :uYAuJI%@SIeaQZS'MFj:rE5:eݣqO&4j:1;̥#D@! = .PTI6NTmSI-v6Ud$Eh̺r+ Ks;;4u0$qMK9By(f$ҧd}j=:ʭNn%1,H:Ȫt;GbN#oϴco<͘tQMKE\ӅoGjCTDK6X`fwBҾr2xjхQGp9} <<FEiaT%NsRGj Z'gUfp]W؜MNW-C++f d45SK̬ݏ\}Ѯw)QT);KRswuCDd6cUTRntS(_ eXӴj?-+1z|\Or?СpVb~*n_c7n߻ۤhd+ I) c*SP2 H_.{kk[X"K xZ};yӌȭ{݊z$֞9OFOneceJPz}%Xkq*G+_eRg!G v'NYk*Q HuX؞hbO:m+p:b1x?JdF2:enC Un|3cI%*[qy@%4:>5uʆFLȲRŸ{fiM7LH*Ծ4P.I 00! gf^>3p22TINua *qՑh4*,%䛏u[w!UL\=&>gjdQqUy ,G--'G/y]6<2$tEjOv*n'o![eXry覧ɤnLVBኲ:nrXH^0##~μ2Dž=|On}41YhY`uE㨧e`J3i PG=UkP ݘ_^dd#<E:zV(Gn`I ee^<*\Nh-BPb'؝W?hwN Ab)0.R8BLfc$.ʶ_ݸ3O:=6$χOG2G*HRYH?[[oG`mb;> KUNjIXA< [KJ+n4H>GO[]??Z3 men6,T&^kR p. ?xuJ|cw-.Q屔RN*lVDӓT~@d2F- U z;[3JPE({[55yGCCΣ+J3ϒ!+#(EI' I'v;+e']="F*)LG0Z̨@Z*-b153yp֞ɫ>rU:dhꈫ0ԐBERAVuw17O8R|uUd0Ltxgy,5Qg)'\*(kHiݖ8CBk7ħTap;^7łJԞb:-,8y\}QeA"JO}o߹55jJSHS ]Zi!c5-4ed]9 \k|qx,s*j&k4oa&FsWy~oB!GXYA? bOS7&.ID#Z$1d)4TG@X1NykkEw4}MM'ğclVFWO\J<ޝCw_x}6b;SnclPr> >|lُ!GW3!U@1b8Kno);h/?fo`(t?43<#4 1FD}e3iR6e @?K @:G'>x.\~\Q9 ;IR.N)JW$f l 2vpi hӂxt5!>C^y[@,W'?6}ۮÞʭ.lwa|$:jT0VUS"?mDFcF13fGeNźn{6Fn0Zu (5yij=8kI~΋ٹM=oi38|=m m_цj2PVLl`4BHъ^'iL!6Cܪx/٠*mtaQn. _Uܛ;sꞧEؽudIj鱵φTiU-S@`K9٭4z5w?[`bt[gmv|Xz8^J܅Rm>c+24jX{*ݿ!yA)嶡?Z6JiᅦIpu=rV4jzFci$Le-xb, z_=yVR#8lT2,< yOafۡ3*F<\unQkHь\UII/*}+K!C9`ĝ Ivŷ%m%MDʲUU^(:4CװQĿCNxQj)U:oX}Xc,dWC&Fc;HP n]P2'`N#ي-{NG`y6 :QCD"vR[F_twwv^9Ǩr#IY(Md:WX5\ /\5U#(u,A$USrOg_zki.7r쮋PcJɳΥrJ blzWE5eX1۽Sp…#:p9Y,=QJ(K|#;TP:ЭM'➽O58@*JsЁUĺEQ?3vuG[c-Y+᳻ZM>/EAIIAK6%iQ+7 Fvjc5iFc$+RQRtSR+=~TI!Gm?ϸ)&Pɔۙ? GN 殏 ] gt"EUV"f eJcU3GRmBLs#-D(Vjpo`BP7ȍHؑvIclM0B)DddJ|bũ @ִ[ct[-7Ȏ?^M.f! Pq4OOAH,*g5ԢK"QvH X]L?O}V窩8ܙjX0YT|&Fc!V=*._ͯotq֪ƒ*08|}ʓn miP]@Њ:ڄjϠxo\v=txxfB5d4rdS?Jع/=ݷYWVcoSII3y 300܀dMhy T3uҽjo9!FC@S: Np+uMMכX%pdjf9*nS\~[V. .*1QaCU )ZjlDY,T`ĥBxnݩY UV_*-r8S#_s73nw{̛y.B t.iB2z54Е OCr1x)`ֳT+pAp[!"9lNU%2PTL-GE{g׃ai5H(NM89Blo~yg*TT~pE ׍+@##ڋhWR=4%}LEUUQ EIYUaH >S32\g9ע˗kC+~AG~(JJdc\MRHUB !u^afpۊ O5CDx\*`mb$ T(=j}_*m7 ncmʅF:PIWlwv GCǚf%$m 3BQ7<{ͱpX\>'v>?=U 6.8+h'4R/s"m!vlv! zc$1 _!շSwKIH5`;@z_悺HǑXْzZdQ3JQꈏM^za6 .2xdF/?Je'YJF)J(LSktDFObc֑%TaO^< '.p. _eUJ1]T3.ɀȜT䮥|F$SDSK9E:d% iB**$ 4iw-[ pE^ 5ّ< c i>g}[&FE0BP@5a"sqn>^Ukr8z-Ɇqey>RQ¢Q>!b-f.,"ꮄ([:iJ/3iv]o#wk$X8A:k0=ÉGAgI4;-mzi/'ZF %~[1s[)ܮ0f0Z zaJT bJY@ P- ^$`COzmoZE=r͝ (!jsQi:M)ZCpCz+pyOgG~GPlJ ;SM*GKy>8#T7-ӸyȰ*5( n~a6[ ]r h*Q}E;^/SX2F (AJyX/;gn \w=F2HrumQWy-QH+绶er5xg%%5$ʱ=L4RUK4.|f qMGfGR׸, 4F<=C#PUՀHS#=Tuj[@o?񛂏uQUXMHqU4KM2%D1-B9kz -R%rx,d[ͺSE pO+FPx)N6O$)x lGY6Uy,5Y۲j1x(j$줐8G􄽊}YU-ePYzXwC{)D ӴT':x%k7_u[@3z\")I3ɞҴ~^v,%AsUpe~\,[IOM:] DId[L(" :%w$Olq1t;m$UX (hPOFU``hC0vU} ~O+jM@靳p Mkb dTtVtu ižBDeTD8` B3G!@޻/}?b_ُܽOMoqV!',< 3{pI-4zdq{(Z8M+oi'sjI(M@G!`M v:bJy2)SE=Mn?}]cW]xlc!ME2r6j*Dn !a83FJ]T !~cʟHv)nIcpRN""<8=0l>WmY*]uXx݉}D >ndZB3;{ 2_k$ډ"1騑[sۗql̥\捚y}EvZO1cĈj QpY::$QϏH\\A0rOj{wf,.J0šC ~&+30,Tb%^xT񿨧{&FtjKw}U[ڹ"^^yjZYdqkOON=}v141+E) <7+eVH֔b ;W`?-O?QvNbڍ(;acglG1`OKy(hIbw^e7M}1*1t2}ԁ$йѺY*ڃX7nqlϘ [H`_y*$]nױOO gd%B/ϖz{{kvW C-a27?PR*H4(XQonuewffACE5m)\qӼ 3qv6}+腽ô)4hլkU^d9UhjVp8[t "6>bUac2=4*z*iꫥ*i *8C{ fsWb]ȒZ tƮb_.,D}B ;Qpla'U:&x8ҫ'wozt]DAVA} V-h9k+Hk)ihEkcMvWa#-i8t{jv}QĢˑ7!TZrɥc^ DžPLګxПTwk8MHO~].ڪ}2^K3!&xt(i$Ӛ^R-@AMRSe2[س{f9_4@9zjvEF*pK ,UW6zn^I9j1F+P.JfU~Qd7tYݳ}f'kkqtT%]R氦e2IFTkzrڙ ;p*3Ϻ3Tj#JIV7{l.wZV2<'hS29T`uMMW*mjN9.c_do>K`>QSn\W#->:9CFx΢OˁtVGK=so1X_ CmeO*vQLo`3]^rmÔڭ,ݘSW+$Xl? d_#&UxM.|ʱYKUN1DU;i'U*EɣKI%LIVq(M|QNwyA ~ P;׻VB5&lB>峴y4eYI)rY 1qt҆Ge R9XeW^S~3!=͐U;}qTc!mCnX%E$;[/`~,y$1*UXhK|Z:ƥĻqGĿzievVO ʠ.r-ˑ8 ThbIW[ȾOI.Շx-4OWFT ^:i*#]*ѹKKImghU'VU2ë&VbHpIcUh}:Ei=R >Akv4X"b+lv,YX@(!6. Pqԕ WiAyjt_1cH[d-`q ES?h' ,`GU y/GAdE%%382$Fx:lYz"6!MB( r'͈d|fV*jPP͵e:*Ix԰`iZm BDGjWeukCL|- ha iaAEj?vvn3p.s.CrysKL;7Lp顥8Hg(&y"Pmbzn6Ydxc9O  R|tԮ&@F*y7wkmgHwt@$P~~ŭK:Sk΋Տ<=aA9৮ݝ>76!j~[xڌtLO$25T:3GXvC1ڔQ١ 5Ply ˷VVmW賌NE:Uj`Z&~FGp4OUc:w&ly <9WCKnM5^VȬcMRرk w{dTQcsؘpSV|HU\<j?Jhm7 Hgr.E m_ GuyRH,bsJn\|m6ޞ,~.(igM[%=--% e\!$z|wݵ45T=bVSm24 r-϶&lQ: ݦuJ3Pɑ /ao͵Sn5=)_Wߒm59+YK spn3ݛhgyojZip8{cQH`1ff!<.Z?FF<ۀjd:*Piװan*#C[ כb '޾ܰvҷVFaXi6>,45o-Un'' 5Y1%Ij50>7xkTG.,0Qb .U^&:vd6VJ<>g)to9L^j IւXKVTgݛq | ꪙfau8͡ 4fFUc6;q}u^_%+tFnFP{Yit8GFK>ߎ6 Y/smmSRRu1{M4MNe8 0,og?OhXAN2EJ4QEk_layn<8a_ '}rԲO@>/|n-ǻW[u[+5Xz z Sgf\N3CK#CgдrRWw4[Rolvo90,J+q.MF9PQ_fʞ -[ưX$Mr2ZbB\igdڬQ4PiP;zÔP3]}}[]o17 Aa26ꪌ Ta1ѽL3K6,XٌJ75LI2Y8W BZz̶G%RHNM40&JeA,%u⌻s37VU_<:hуJhXzzuyF;#+X\kKV[,ӼmS$L ;M>z)W3U+qX<.|sLn:磡Édfrڥ =&'Aw;23!OW𓎼"hexcS`۟ySPih%SBJ%fK TdBih0vO7-Nц@SQwre$JiXPĀH{lKcJP72ffc׷:~7 UM?oR"1>Y桤SE$YG>"\kDK$ ,U[Wlf3m|R ZͭpXۻ=MEKUԴj^(Hӛ)2٭DRػ3(ldy}:r?#N~mZNj\-F&4P| vK lõpKJjI䄮)d,I5}ߡtըNM(ŎO!y`H" UxT 9!U h9墪#B-TD#u%!njheY)*1*Hjz) }:^6pTr;~5RpݏzfO’R?;f_oMM[ ff F*ieHd]E(|pyrN֨ďE5x|jn'r|:7.ITn!3V],b(j֚8)* 'Q6,3Ykdk5ƟϳսM*v'\KHϙTIPi1:vAG¥!s-k$yvՃ3W)I"(J&ޡ{ ǐ:hM:G< +1[m['Q8]\2 q|di+KR`GOhn5ME>MOO4xvh7į2My*z:W/61ꣁTNSEBLpٶ{~=.HV,3@FPhEqen"4EEs@MB1uFr0TY 5IK6B.>"FrCH%W%.}[sOض[( %BS=i ceK}o{~Cڡ#:ʍgH:C1m4|>|mRhIՊsHy~]۵: Zu9FhbzhX U@,an 2Jo,a]T"IR9{UeK: r*]n7@iv'RRd$C-B i}QJpjiU{y?-US :}u$&ۯнSB< 6 ~};"VN-ֺ=zhAMO &,񴬪e$>7O[blm ܬZDh3! |i&[n-x%Y<E j49by1"pz"`&:4.[VS$dX{\eu| pvԔ*=猞HI ֗ %U1kj?oNQ-vvfPG\)[J24ՉGp=,awCn$jII4jm@SӠş3.y8 EjGUj48D>bMK6s\6값nz8S8xS LN'Uθ mpx-Z!VK_?$ %ī4`$G7sQ÷Y9HB5#PeKcVhV~1Չmєf0 di(eMO+x+ lKĈ#Reedw=&Q677rQS&A]4y)%塚l`Sc_$b>UΓK5[ŢX~TUb58ʀH*X,&$>Ul [-1?jvΥ=[$ФT?`ԉmKƷ@=ֻe÷,8p&M2 Wu}Q5@Ə.nm(Y Q<ۡo)X,FL\pՉ,N(3Ö'-J(r#o|` |EKMD"H`\rQ_C@DnUzzp5pm-s D~!SO\qӶ騙G3Gs[-8)M vBTqbo3y鼿_qf\4UT:Ib 8"A):TkQ̱u,~Md,-b RJBXj Eb+Kv]JTApljD6v{|O6VKtᱻ3#l+3Verƨz L 9_Uu=U=I)'pUm'q2[U>1΍$2 oapEx1H#-RUC($,#Z@7L@?*SMzJ8ܛQrED]USd*emB1Vh7R_cF[)rgtcLU< (4a;3;  ś;݃m;$ CYX'5SLtMP<Kqd2AqƟT ڃ{dgndqy+OL*3TF dU$+sϲ)QIٹ)_ yfRrx4XTVm6pOuk̗M5m hY|o<561&hVftl&SE6+cH憩L2B$+0<}T\UvW>25TQ=6&$½a A bVQ¼ Ahe{U#`7P$\3M#5tzRYVѨT@΃P:`7O Ye;#%w,0WJl\o nW)LMDǞ(R PŚY\šxko04d e9k~dׇX#At* PO*Y\/M_wXRTx)_ysmoI Ef{ic~٫*))epu"K{zsLj3Nd0zǯ ~^]cCW. Q(ou CE40⍮u{!]^&ۊ MM4nbmՍ3+^ V I,eYe?qL$wMPʕc5Sx[}3گw'+> xtgj"y$`}PK"O+nXZ@1~a1IgkJC,554K$=5cNFtSܗ)srvݦZYӍ%,tTt0c :[N5brȰW/{ A7.GjWm xq e<i<ȺHmK\q͗;64CN=̇?wy[J^hOyu"gcWw'Pp= ؽ_#v6Җ)-撽\ÏVv|>8zze!E`R$>K>]e EQUJgD^ .k7H #n㪷K`MGZ2VPH䐭wOvII?MJJ@Z 4WF g5dkѮMI%} ǩM_ rxgTOk_ݣNJRb:q }ud%]i0Az5K|q fVY>`ZZ8µ|A䢕U57Lx^Yu\=U0eETq2멎r-~F/[l0n| #_$KIW fbT c@)bwgY7G5&G<했՟EOW7rHthrTS;C/eVloFܭI`hhg5W!O-+!V2,"]&6s˛qZAQoIx1˵1O׈h^L 5|qNPWut1iE=DL@o*J N{r*c?IYWQFzb@IԨ@&*@oa- ;6 'G(xzya=)Ǣק7~\`HX .?a:pcwdvoCM GW^!bj_ȁ1pCUeRɡ-o76Xwx*>*>"oBڸ!"cpHXj=I:_-ی۔jQe&_V:DK]rPJ(ݝ#Mrg١/@2OɨRhB^>c_LRA=DTkH#@ q1ƾa,xGsamͺZg?mjP(gWb%ij3Xk! IX dܭmw_TR`zD~dW(ne7*ګLʎyRUJeG W rFH`C2X㤖#^fħ:|LI$o 'K1U7Sm4@uy +^":ΕZq?5Tck-BhxES/MH%g'[j v_eY5uF?w)i]z9i T_TU`f.)^5<='BrR4GxJtO^W&>pb/4VR4?VUe_[X|~,A*`&nYg3hO]\ B]p5 ؀fX4iÚ7:WfD&81LK(FH, _& V.8UQ>7ƾ)0N $u?Z mPt|\GcFּ45;3|ߖ @UiY(U*E.=Ϸ>T>CG=GNgPb2،4s!gsMU 0ISVw^NΑSfV*'A#ێm6SumY3ov aiEUoYK8ԷL%^ZrV#hnh^ O+PUU턱r fIxZ7d-_)[?TеZr_|:} HÃxVE~F?KsS~1cs7tl$el+Ӏc~$)6N͆#͌4rʬ5beqɧL߾NH~q[G`b\& Ňd_o4ytRD}A*vV@E+_Bb!qQ:M8ӀNV q.pg7n-V =6_ԼW^h)tf$*b!Εb^-E vƵ"~TVnLDr+)bi_av!] P)U`ȓC [:E^;n;rɌDӉakC#ePEPܲ$&T8*ǥ7-8Hq/E Z|kR4R#E".S .^x%хQh?UL( #_~߳m% i~ښ\0W r2܏E%!;z%)#,EeUK2p' E4OC&uFWr/mk;_Їh^GwT.,:zIEX#iZh.Re>'ʴW rGE_zе\/H B"we@c`XϾ_҃*%jaP 1+ iIitRjX=W֠LU[Gi~_#OiN'NiOz.U]|;?=tTؚ\>;G9/["&LN\JD݀?giÿ+o"&! IP@ $ytN>'yhk:im]USCYRʴ1,I'5!6t.wFU\?zTpialkj@t5yԕYTH<ߟW6Yg1][s>잊c)5>I\3+X6듢I7HmEX;HH!Ɵ5fI'j]4ե^c'OzHj+=sI<#*=zckg.vsiFD/f+jb@RU˪i28#-v KI|g<-mR+o@ SjSo! \oIq[ڧmav[mWimMԌm-"d$XR#ץe?lm#IQUL3H_JS=":hC1zbCY֘R:ڷjh(0_[I&SRîvb1)!UXwWdV-dYMMzKBOvz't<$F5_D\alc[/KTX)V) @K|C'մEӝ9Ox]ٜOY)Rspgk: 8#-UPq̛0FUZS~Uޯt=vh-w EY8QJ0J9bNOPL#rWTbi&ft1{=`J‚Ɯ,MMuv몥kTzS)#L}˰Xms>Xlj4VRp#PˆIbWan yٺNҝ3(厲6J<tZ2l|A>[X]] DT1]?m+z|+m4+]PǨiG!Zp |^J$D,K0]DO==TM,}KUSMj"-EzUx#EOO @7+ n+46{Y_p/L1F&H"<sݟmjpS:#Q3T0SAGN# BNU&oex謮Cqqq~O e6^u텖%GSQASgoUEYTI_Dz!{GlX)Wna Ϭ&,b/Y5#,ڐ]PH%5=FMQ~R? VNmY~; Z*(R5'oHĴJKi5m&8[OuBY;v֭ƒsԡ3nDdyR肭]Z%\p55C_m j1y-tV}˳6^;d1ԵmS!J0bX.by+ۡXI_*\S{#VCI L*rZx⇬TTR%TQQYDI:[؂=eI]@8< u4Q=GrK+8fP$W$R]=V?Jf]=M 8UOz-KMWI uJX&$ ?ޟ*7֫|.ܘŏTQ;DzhKiV_qm;zFz|xzș 0_LʽcѮjbjj$WMKDYK"PߟGF ߳)j)IrRTdMͨ1o2ҫs"='"?N@+aǽt[wnG ;p‰O@T3VNT@b#TU ( 6DԦ077XRŒ(q`$X,3 +SQ98],i(Mh p#Xċل73<mlSPd""4za tѪHB~k#sbhsx,[:BTUC"+PAȦ{Fv DґQLҫR8ƲP=AyDj-=#6nɃU*zzDζFb aP>-DWWaKu u0نb*.dӤ(Qe2c>Z{KomnRŋ|ޓI2\SJYGPk]KZMv$~UV(4e~m&4ystN$ ddjk@_M6פ`R*Kj"H-5t J(B)dD M 6_wIruuYA[ #gjirxע ږAWO+Y"p}CDjUV8?m_oLJWfcGc80$&z#Tڵ/f#nm)(rx>OunSB'EIUU#H,Bk]*() }.51ɕ<$9dǦ(Cy#i`X$E5V"P !nŗٴu{m$̒EEO@)]HU+꿱V>&ҳh*Mt~} ys-&H9,9]-kq1Iy,RD R ؗHf6A E}zpܗwƄ #<-JhU]HrA1䛽 j U|=N|e& r PEiϡnv(e(gC5LRqf  \[ޟ:/3c3ˌ\l$ahkhIS{bNF&H5*ҙGYwQ㱵F1a*֥S53V:M #4Uqqx>?ggjZ})39 Y*2׷"pk7;%,$$@*;}6},1E$;a!^VlCimR;uE*1SCPGAqRmF >3,Yب+`vl[m6~flBQo*<|ۆxd6cD| ;_$bESMVi Qpad[%6K[ dwcdZoUd3c5) H7\#sav*7 ϣ]㮐 @M?xc=[7b| 3k`Nt-f+Y7TJY^Bf7I˝m[|~pb;K41PdV쿋 lt3Tcل%<+Ib#m,d#5%i% OZFϨ>4,O/Y~S^^:-}0[3/P z,fy0}grI6~GALq جe4=tAR9j)H &Fʹm<2?4ASPC^ӣTZ+i}z=Icv?޽L7\zѕ9*䦬[eb*0GJv&HrUtB>8< WCw&&0 TgHCep{{Ҿsoh28br)~*Ui0t-  S$!u* ~f[:S2>5wN]_IwG'Dž~_oBƨ*s]mb)_ T22dfy]T>>m [`Tli#fAbV="$v̮ӣ"0Ss46{u7٤&=Z~bH0SOV(cV?Jۑ^7؝y*0T;%m^))M4MZLX"9g cbڥ)^@nQ)2t;Ov͙lptxc?Zw?ƨ۟wj6(ejsBK"ME)x]-z_{mEyadSe鬏> ㄲVMjJ %=L,T+FZ_QEL-qՃE;GA&MY68Chlڙ- 9Ꮗ/6鎲(]3ޢiQ*WqLNʝn݋=XO5TTc%iiѕVѹ$۽&S[P8M- zSRU.=k^#~=veWOo=m Xkb$! aZڸ2nB$:um/:O+;_=6Rc^GER&3]iUQ#7ƱmR[29C&QRRJyeGZ|c.V㗧~os V6M=$bar42K#|)zf-E<_gYMnz X\ i$㦉ncUVK\-'^h^agk,*\7 0493uD}һgƯ%uUx||UEL,ouK9YA5v/)j*Vio*a(t0n YXh\T}SQf9KcN"V\yno[]٥z(ݬTB ;KD0w;gW⯫}=nOOSxr;kom96مۑ"#+_e*'RU;=K&6)Ȩw>swݯ]S9Ms.Tnx&{9q2Zj(mZDGF핕3Cl~kx·s>%xO\5U("51p)<<%.cc79ݱ5TGaU VJ TS%x *vy MRWC{wgtX2Um 4*IQ#]\\)o ir +[!Y@T۷w+)۴Sn>ow`S"#|q2ϨY@* ^cҝ32"hJJdtU-aʈv)$B<,N%fSZ$bVѢTRε ;N*h+o\ ~AkjX(%)7G5UTį}4FRo`u RpƣZ4/ ʕN4}Lݽc,֌Ή.+H5բ-ƽ'#MLiRƝZj).?b0Jf[_7Zy{1U?6KTjrUrQeVyA&|e9[/KF3Ó$&2' k{x|~](42<n&h7:-&˂ 2[6?bU+JMERa~ OK[$g(*3JJ"%usi,@iQG6$)@g%SNxy|St7jH޺u/tNz?% 77Mݹv]>df5a0rT zh='rD{޳pFטFmUBXϘuJY,HxOm5ҵT.~[Zb9>K{ʂڿM GO%)S<҇\ KX8jbPB E2Ҧ F. Zmb44lơBLФԪ(h!X'+m֖2_A*ˑiPjxT+ u]MW]_-!4y F T,SK uh&J [ڔ횟X-#SxT(v*>iCAԤ{9]&򚖬kA2@fǭqwsInE#LcDhHx-c>;b5I/K$mQ41`cDzPE& וڪ|^|r`4fE"<坦i'H?1mIqcnRP0f5!ExVhIK\*_I/ gB^ol,Wᨷ7,32.B|\ұOvҷܐGaew&M˗+a8*jZ6DbΩ0.`o[%vD';F*1M\:MȊ*j:jB JRR:+?7:UAXl5j4bxbM P+RN;9AB[N?skwutTϐsMZ릨Q,<2$aܓbH e RR&LF '0QU)?1CUD:eDk1"Tޚ)&eU$%kck(ݷ%)۱˃N5-o <"o{=T?"*ez PrkZt'fz(Ν8W`m<:8mܐyZli3=10| "co̓tVxR1DDdxP}o ~gq!e(wʈr6Ե:9CܲOd%uVHfm'1{ u)Mqz?KX!G-@>cNf #}iڻ/kÄM6TcfC\s[ny?#!TΟ`f띡J^mgj$-"bPxYXe .UԤ6-T@t^=g4hGt$[*[_mr+{jUb*^/CYOzZY)\7v//1uQPmLeC?BVjʉOa,ֹ;HX`#}NCq![;CY5ƒXzh2bbȁH:40R@ۭݤWq2+55w!Niݏ.Dh4KS'o |}3^* PMdEm"+rO}_ymI!Y@M40h4sS2CLkuܰA"]h6Si9ƃQFIpla"@-S׎٥OSfڼ.?%W%|F ڸR*DEO8Wm(!+&{jh6F>9qsRs MI M=o=G)$n(CSWiZzX%QP kc'M5>nʆhn$9 qO,4*i߲,sټbT>өׅSb4&8 -Kj|(+k?iYr)TFхRQ7M*oEՔ5o'$ISӃp[M0j?3%Cx~ٹXspQ dԕ7IS*G=;4Y[\>@>K[?}ghp{~`WaҚjPP!΄`},WaN|nvWHQb T;WTsjiӻ|>6v̺ض VttR,2aFIiқJ58T*JeCV[-iPKE4UP5ˆV"(kX5۪ZY,0@%n{B(2 X'<^-</JDPe~~f'nEۻ#[MM#I O&z8j:\bIͳ}ݏ,=j;.~# cn9jOocQPOhBKLij=3#rS7>rI )(1d%4&ƱșBV*êA$kM76᷾:FFm IosN6/Qa4#ˎҾf6'Y5^9i*/M*iiH^-;Vlxwa\55N(rQ)%%qE #$1. 89n7NDąW 588cr툷H [P_ U>_o]f!cUNcVg0]*D)u=]Fgdo Lu*BtaϣngZA+F\3So>=\T&n:wUN"#}Xa|tHA}:Mɝ KUz+ j`gWSA3Z(b8x;iڽܬ h5}CR~ѝ_g#&OGZF#?Q|/]m;\l{Wq)!ѫܩx% 0Gic U[ek߯6KGTeocOF٨ʝEQ$qI<#Oo-K,Rot\TVK_`jRDUIӄ0H`l2'3Zm^E}Ebt:vru'Mitֿ 3wv&Zax3_Yd $I[QT"82e꿋p^==\3Iß:k #.>6|M3nՁ'xjt *vF1\Xc-v? u(b-0^ÎT4EPV}-CSǫO:ev[>H}s_%;Gvb629)5~Y$vuTxdRnkcEb 5pk^C}qƦ=_ -U T(?Xg;[񛛼㥥QtT4MϕWQ'7(8oʍ C0XWGH+N!CWKUMK'O 4#1*LHG6 G1{>M1Uk]KA^~h e1E_TL4ܺ9vk!0i}C!@-iLbo#D ^.TB*V&CN)Hθ9䰹'uNݻƿY jԲ%)Z*VD~zl:%HĉjM ^G3E gwV(Nx嶝M$a(HߘH(W{`w<+% c <%PXBt_,aZ[:@ WiWq`_5*I"hҹze 9e }yYΠ;\vWw؛N5K*eVWUVʩ6>}0 G76Viw*i?ҵhøhzߊ`yՇʾӧ;.O4siI BF};G!Lr鴑'e,*}O}`G2Y:[ޑeO6F,cS Mxg_r`1uv D (Vu1G * {x.Vۧw?Ab2MM~?'y.V6d(]-]^R`ɶjbҡjcMgD#7춓f{֗rr$K V[F#!Gm1|Rނ{֭ PBj$w drL! C1_~aG/^:~>=_.6XyХ0 Hja͇U҆yoK꟭ːa()3[֏=Kw۔rVSYd#_{[7[Uh$qJb}_h}aGFhqOFQ@gwBlN۲cs+z@BVHQ ( Y3ݸGa5uJjґ[k#mO}>f:v86:yJX"h"2Z>o\f09^8\eEmMO3gE4D~y$b /Fα dDigTlAASQ4M4QApsE0$|Y@?/bWN/k=Xˍ%]Eu58ZMIW!ysiIPLf=:xz?qM VXzYX_Dʔ0D 8tM UMq9!g!M+Y,*8 =mGΕJ|h櫦}>֝ɂ²R2!ܚlۑ,5IL_<> e-G#/fKvy?_/Nk3ҘD4TG!.s啕ZƮ [ojL5UJ'5VS%QO[S3hg#_!$% ouƼ1C+?`G>Z܈˜MiCֽ<2ԲVSf#1_'q{6nm5oo* NbfRC6+9]KW5 %fH0}@\xlyn\(wC#Cv5 R}8 lqOZ$c4A{W+AQ ~7*^SWE=Q4$)!RdoI [ w!%##,=)=lV~]()9#mBDԦX+RmZ]z[SR|m:%z$l9ֲyA_Sot{Em2C< uʤ7{YCe%~Tq/QT2tT}dRCQKQr#*`_ʼnGlzݑO-<IC_F|9J/ 5B6ܕ܍,Qs<Ku,RFP~3x21l e1ݪ0h;Njδ>\A'Pn^lR>O \0NHʹbͫݸihuZ!ZSX􌎴D$![{]~[ qlQ4;f/?}xת#* V+PA>} _v`Fy~nuo&eǥZ0/B4NM) } ouC%wK$W !ʮ5(8F`}2F}1P܂ŅB/١݇*V{k2t!5j @qCJ= fhpp1کE@CA@#՗j$0*ؐl#4i"Vz˔5qJ|MP<Μq=NlUMKHN8?uy@ZH(UbdoW,,)܆Zj|FRjiy*16OȒC M((c`{pw pd€@=-(X q:ޫyܓciUB4fs`*85\YYi5HLG obg'Sm3bdm׊UG}[wQ,*IȮ`FY\4xYi$ip$ula\[Lu_!jUA!2K(A[Sʪyɺku->hQMUWQEnixXEk *P*$ Mc,T^UV\i?$˛}q&…zI5MHnܧ^OVu; 2%6.C1ErK6yrc*̰՜}L3A6@r I hgȄo_5(h9 OhM tow&f2RPjUhoĵVCkO-cc+;<7'^䦥ݛn)2sxCQI"Ui_fl A^SOC3\!V;N<MKP $ҴU+㤕R"ijf?g[ߤ׹6sRn&5oZҔ+J9+iSu\Vq*zcjCk#J<FzNob eN>ZdXj'DUXKvmmMϩʌlX$k5HI+#!{f&X%RUe%N9RWMF@ sƴ`ye?`tnWvҲ휞cRCW7ޘQF1KUvPw,=BefC#?[{G*P?ӯnkE1MEn)J&dE-;4(~`OQ=kH󾦅/! 5~\o; UOv>?u3D$ 9:ǿ64S`C=$Ua: ~nve"TΦ͞ȨUE˹m鸝F@5Q3|A;k}?UR߄~ަfj|))rQJ*&Y#Ԛwd,  !B"6B=`|nK)0jׅW̏SD^Zm~-}_v(YUJ($Q,R=²QJ\77lRsrI|{j!{#$B{?*qqì0k/D7C`}] vuuNKiIajjf*IJvkA#m-=;~f ~xekuyP-&)ϨR~N-?q~#0`* ?R3pVnz2*qt3l]Db,T_B 87Iy,΍͗,iz]4xW04vE83UQJ(᫊Fm!~8Uv+dY;`SJҿ*=7߇vDtc>1#$V)Z1!Y2bZc7~4K i"IGh-6VjMJW8i*ZxQjPxTy%Yڢ^4?ជ|4{‘*PƆ@uץ܁sȷ}?_fsg;buə$|6.Y2X٧4uժHhmtǭ) po`%x*!0ZW ӷRd~K̻kXHT  CACSmՔ}XscQ$QuhQ XT|k7L6N<]=],j}}Q, *l!kVExEH |8gnV+2R)FR KI8B<!(n>eL>:SR92?;AA+`6]B$ Ip7M͵Mm(]qA|΅qz[Y$$tJd<5P5Z2 ?%UDQKۘ-UerSQ8>)% HH7& ho*=))+Ui JYڝR@/mAUlxSdzc$жeϙ|MayxE*PБR?|ޛ THN:Ijye%yM\Q{ ~# GCu::Jk!%FHBUUDQUM p;[;&_IpCVbWk6PKGr.EPHVD"ɠu6?@{e8X7QPIR<NڥP @T3sn.` $qbMhE5Fv$Ժ$PbOĥj ye}MM-TsUQud.̈%R,R7/mjS8J[CI"TS+K#YӘHD'Ҥ2LO̚ZHX *8_ӇX:dqZӐQ C[T [.[ۑJN ځ,tE%f_ 8OHfрnGW>Ҡع9N /5e.G#&4i#`y v1Om_i/~}f_$W[|4*ϦOLqȱDcO$-4iPlK\9'DWGxOyhj.#سH@{9'$eY^u>g?[7W֓ĦTP643_^G0 +k2UNjx$%TX3x]byotjNQ*Ak7;}ͤ?/"sw-P/(!r5~:§o,1y <+e{{Kw.H9,BuiژQ#*iD*5oٴFD!bOq!r^n0$R f?|ː-"zypuz?hv{ΧI1 5z*W-vy/{7v|9]U ,¡XŹ2Rcծ"omcq͟[ ȵFl7uE;Lf9"p~F@@=$':RIح4oCDe=FvTPb7޲PGfM*h>6dZl,cRV),waE Z/J)VWUipՏdh(Gʂ$枟J7V+f͸̋SQ*mز S`MF]3_iۘ ù5=LPa=Dq35x ,tiZhQTz[9WkMt6UpdU\qbуؤP D~644k|oo|˲h6n׻5ܴnθ-]IW=$,y吪Mjy4TfVTVVP:S] eqG]]d< ٮ9);3ԍ5YR 0j,]5<=+}dii,;dEC(M0SlwU~#ZTC{ySvV?4%9<~᥂#1.B5za%1Dݥ+g25^!/.ژ\gP4lD5)p|/nVmZffj|k>JxBL,(vkPS1{Rz%J)䈣;饩Y"d H'WoG cVU~xDp|t>)crScjy*xZaH) 5ƫ{;ObomI37AUUGJHk2(ZDdBA07hůa6UB+EfmOiVfAJjCZT@1⾟z^{qaSWQQ:nzq[yɶiԼ2!DBsf+'$ >TpASZ=ʹHhhC /XnwCٗFC's"&M":8׫`BIͲ>yˣ?~v=xEv2#N;qϞawu5M=D0ЗTBc#][>67w_J|_c+jhUWqab^9Zg1Ga3jGv $Ҫ6phC5Sq "mH Aǡ/waj'ymtWɳ;+B['%~7,r ϴL}C <.驡lFTSUHkqѩo$n{T |I'ӳI-iYhj~te ?/~ʄ_ovona}{dz 6cnm|rc3 eUUNƌI }T.fz$L+.'#$1ZZ֦a+h!W@&-i74KHFb`fĦ\TRQH+Y#=TK.̟T}ߠy<>_?_-n[6^Z)ye6x]K ]3ad➧)YSFۖJf#tgUF7sfYtO͵"ݮXV%C}HnnGr:eF%H`M <}3O.|fVS Kf ^Ԙ* =~^m= Se}^#FDEpa ݫ[IFfI~[YEUWmQdp9V6 ӥWUϫP3RAcNoF_#TAW#mcсuҏ,q+Y~Wm-JRkr83OꬥC"Wٔ'}ٷ9ȪffebM%Au=ɻ}h+r?-Zv*2Ѷ(Ni$}}ۭaﵖcBQjɮ"VDRܭMzk*q?1~]W_Cϑ]j{j=%jPW̩+Q?uQH9$E롷ZjBTbp`bh4h Ԛ׈~^=z?Elݓ's{;~ <#|u]ON"I z*me(wܲU5IE2SLC䤕"ā(Sϰ-qYFk?v2xݍ x0?k e_WZ.bh8 ;%.J U5]>ܒ԰jhM…R,zIK;tnu]{a2KP{SHʳ*I]@}6ț6iŷZGbB>>.TК;ѰVugU<iwCK3mR-]Ewhp>c)L#C$"UCCY|N#-l^N~]OnJ#1u.e` q6pg9ňV?2ziD%IOI'Պ'CYUT /Okhl0[= ΌM1=UghO&l2s/OO*! Η$.[ku cY5G]%*#(8=Dpk?U]$s=V? j̚Z>jjlՇ,Y1&X(_ƾ2ZLogҾ=ZQQqmJ1 OM#&#!D+Ś1ڂ+TSAόa3g.ݴZ ufƊD82 ]EuMl'MOS:|8>[lG״ewnosl̝ M+AC?YD*UX m3bcAO"S EeDbxU[Pp1׷.o0ūX"/K#*Y4=Og$ƮڍwBrr7+GԴ]UHcSWpZYbyaƄ3!Z3u L*K"e/+Ǻ_6=m=~g(Re*;_c$U2MU/촩DXɲ+QLBaQϜOzT8#0!y򚀈2c+Ɣe^ ~&U5i^tZּupkO~]MP͛v>BZvӐKgԹF_Ӭ>Mɷ;mOEF)ÐZV4ydf3RmW5El}4dž?R*)CSjkEPK lPVu=ô)隀dp[t;ka2yYN+OM[/-&S9S=\q0 tPn^~\zKۧjNF4vQ1'D:$0$6[*z9g}: #WWu*YBGh4'1Ϯ:LN*k'Z)j~⎚LI)tY$TtQu@{Munmø*ER\lE&Ycҡpt>ldLįE {:~cxen?_iJVb1)Q卑zj*FZxӪ8 ~5ZcFUXDXt&6S5/-N=62\単cjIuиT dq̧uhе^PtT$T}@OMͷ[g5ץ^;vVwL[1C:zm7̉ -ݚF*<MDmQc+^ʝju b}J2Jy9˭$cP 8}h:6e]դJVtz&oNUF9],Ha W-qO.dk#;,xzi%C&gy ݐܯmd64$EP09-A4Nomݑ_ȅ \ӠnS6_l xYY]K[.Ee3SE $K#>u^znPW jazj5Bq9u0I{;5ΠRPJV9]˧?z]GҽѱO5fMbQWqR|:>vmCh74Rɳ%xzȱt7r%e.yS D/]۵-OˤĦ"UeZgt_cMnvSGaxҰmGLzB׆X 刯Lm$1-A,¼GNIމC7>3_CWSY*p9Mx 't,}%mo6_#SqX1D)3 KRbUF[Tr œn% {AHHZZVXy-WWz9x |mY*kjbG<<"30<\KZc3I>G iqԩ=E fTITiޗn{x0"^ ?q'S $^KFj(cޚ~JEUAzth 4C2 ;2yo6c `4Qd%EhXVyix, ʂZk!4!HB8IpuF)<ɡ8aܾW۩v^2nZս3X ~:JdrL9F᥊VPsirœsřQsywhi4h3T_4XXҭo';Xm՛#SƵJx A3kvIQBԀWkf.[iͅ%4ie5:GtU ec'ewU)2f1;JZB\]rx%+˫YlA%m%auuƣXvACZp MտUEtּ .}IƚW*jxcdGL5oBapT"05u =O@qAT,PK_oWUɦ#iq:;݁(6m2*z,P@\f)ʲRU<µ.zd85vJ%5$0Y鲋${˻/Ƥx6]+$jGP 6>tC-l!bb"3[2` bE7»#&u{M>y9Ps48j:sn9 g'kkûdLU[J9!˩4}Rx1[i҆Yԛa*}XJi)RSѣBjyrG5%9v.Jiu M"2BK'`ÃIr<˷Hf@͠uH#t)4!,(5^?_ˡtݸ6HKO6BȲFRh! SG0eD}V(Fh&ޒRPOaqX{{ Y$o 7 5x*)H?P+Gkiaq_/?Ipyxi"@ƞwjjDۂ}Cv]jEޛfA>&DAO>!j!SBIW") хcof;G{5(4uJ_!I^ŴQY#/kvԨ , z3lnXmm34&ZfESI#M=5CHgywf%\fN"CC5Xe_9#f`Ŭ7UW|}gFUQjca@m:uh9m,v ,p5髢.d`؟lؽU۸jjMv?zc>i^Kx]CE{pTTq:c9%Jx4KC1(_ Ӿ?/,^*ى¤kqc) ;9:T@D#q㟙׺: jh#$/SV2̕q1e$7ى7"_L-Z0m|ty&Qɖl%%h?SI\p{ Hs[)\P !x\i:뎌 1:_:t&>cϡZ]Ec) 4tdddgI<`92DrȰ$[⛨뺃jaw.j}ݘKZs-,kSO/;z"DTe?K>űMMΦካ樉ZCZcLwK˙-Yh"ƚ`;sodnӴ+V6RiyCf& M"q5anަ ;s q% .n)i2)$3O+.3o3%vWj"'ᐜΚW=an@`4ƟFyt*mE M_QHik皒IG 6] n \@_l޻\JcZ,VFK[\+)]2*}JVr%o+A3)pYXRE+2uEh#J @I zOڻCjdf{mGG1-e>PerRDj0wn ⤚QS:kQSJPZR[[Ff_a>gخM% A# ~!RJiRj4 ta0QPA < hiH$%Dp,b@ {3}ֶ9RGzD\| fFY.8H>Rn/J2DPu ׷ _6MN&Ti-^|V[Vck$j7ٴ)%0S$Te?{av;o CY)DM& aѬ_b" o;~Ӿ.aIn*kt |Oflecm)Zx1lǖŶX .Y*+jjՒ֪e/Vy] K\9q흽hQ斡*!Xu 2k${&{Ͳ\5 %Hb ?}JVZzhR)WTO9* Ed`(\(|ͦ_4)^cq=JԬ6QS\x GwCwauRZf*A~&^Jr ݉ShSD.ookM*3>0vPTGM㫶dRYp{:<\YFhpq! >zm[{;Qvѩ W_.:ɋ[Db5c|ڂ^Q7EVo#%)&˭l{Mfݘ}X6[!$5QE[$STQxE)egk[\j]-5| z8?uӾ'P:AV eI[فЃb-b_m׶;jQO33kW;V9"$Ʃ "=;~j3JgWNI1C_gt˸檥3YCWvDyhD%K2YE?^ASgUUU]]>թSOO.tL MUM4Yj\ ŋg춛q">9#:4UxG~}8Z-MJmc]ʁ |:RUƘ㞐҅=1$mb6ک?#X[!]+,!G 2gP.g2UTzW_$#*6NXWkl}Sp8[5RiSkS[N<vh6SNuq0*"C5)(y[5Gw7@Kゥ=.oYY۸H*j奆ξV'ȃV=ɍ۴|oi|RD^П!+).mdl?(LYf; EeLݩFg5I%T5 ITLXAU;w&sS;d(v"81T3\YROM`板rk-dOHM$S#{Y.I?| $S .FPG \ nڛ~8Zf+Ҳ|[#t o>m2qPժ^kir 45:z~|nfw_U-3NuN`Ņk_ٚwMtQnfpFf=5lNkO=M"Yke5]NYVϸ~.wW)`@[7B*^C e7v:)k)^?~Is\&lgNtS^"oSM^"mAO^ GM4hզGV8L`ocydWj0HW ڿ?,[k\}"=ctv<.lZ%&tJiM& ;Oo|Ѹs45@'q]{"o ,E~]aAK~A-#3C^ ^oӛ 3Nl+)N* 4KWMQWh7*MH7 17Ş2>Gή:}q3p4 +:YwX# 50~MНis0 %]56LawmK5O]&XJ/ <QeHBAQ^YoEvEp?5OЈi"}~?Ϭ0 H.,RJ5m y VafdDUϹp,Fg5K22TF΋-$|MjOk`rLcҿRq陌JguJKO_NA$*Q4jQ^Kbf Y+7zɵ2WrCNTFazmnBKlLLU4k%(d#_y*F YD5A]* H|DoF۫xnיlGl)2x*mᅯYcՒcNBj+"2 lvW"g"(!4yW8>ӛֶ5ITM'q@.WRR5MWM |-Thv]^XP$nBR#->%F#KgV42v h(#dZ,)ReD5i 2&ɼco[NHYNZ7H?gЇx&#;dn⦊%%Y8IH|>}/n(wGLC\) W JzyXߑ%ۓRUC2$|L.\9?7Ǩq{oLPvu :O`.`RdhBxi>u_0ݕY+-kp8zi[FiV9SS!x9pLz/,lR?T3ZTk(U +[W(p/b_Cyۭ.#袑#4`oÕ)GQV2|<мM''ݐhbv282SԆaTZx;! W֤6[no֯"G.N} V5H s^<+Q0fzUcbI׈}. uFgn~{SUo`Z0%̓bV"ٚ+!_#%k*1ԬxSԃּiM PȖX╞h_.ٓdPm] dcw{'(- ag4SHTrTl$U0%u+3x0s 0G'FXY"q;<JeGi TAWF[<4h|a28i+k#X Q,|YRjRy jiqYZ)!GPSGR%A2R ,JDWw5G˻Ԃp}?oO5qơ~`K̾Y댌E8Yf.^|"0_Chd KQ7;EL~=C7/icN8cxt/&sOqMN`Sx"%(+A<`PK>n j1_y"*\kb%)I&j!NgKZBH 5(5_ݴ'>A9_~ߗR)Z}LMd_TnkfO&]JZ'x?e11p;CpUp`WAҚzt܏P?^dQYdG?O`+[Ouv%HisvXEEie~==Bǭ槲ʱ zI{rn׶ gS7j髦VhP~?l_C0O]*R,G'f#;KvuN9_h(W p:5/D).{Ac~ȍ,$z>Rc iiMTT'$#ҝ1n-x{O`x*jUlAڛ'Rˊkof?RU$k]F%bܟrDN<'$ AE 59i֩Y%2 biQ{)J*=x5k{;M 5UU >5KacQH^{2;^\@hLjȢ9j1ۊ$4jZwY\dD~]V][:i}[wtq}5=&-]wYH UA($PyҴ=]JTm>v':90+GY&>[$s5ۗ}Ŕ+K"FN$A4BBrhi{:^˹nw2 ƢF PGC|=pS9OK' ( T Wjb1Ԕ xi#IRiU:b@f$Ind4Ro᭙UM[70i& kç$z>ÛNus#K?!ԟ8&ϡFw6smanZFSKkj6,XG[ܻr+OKN\m<ْv7K&)"E%d/ 2EF@ ɥWIQ{ʖԦWS%{8y% x.Ÿk Nc; 4h^)M,QS,L6jv į#[ Z>Cex`iYcKE2 XבE۶t|])M,@0ӝ=ݑ⣽]b 4Lr U7#NB[kxͩzTVo!:ʫۏמ=K+*0S"$pއ:Zu  &O|-*yDGI;B ٛ {*vKhIP/ҙ'h= oEjڃ5uU KB;<#t b6rx ퟵ^~b(pTAA$ C#đ @s䰻O-nfSW#N I&pq'mKߝ"X,=e17Lx5}V͖v$ wSgk:K<'˫[yjD,tzjWϠO}cw>z9ִPG 7Q+?+H |lYOu{Legaő۸VS9C(%[K &o-J҄jN*Op8׳:O^M1jYRB˪, Ңz1J L$jZ"Ebȡ =d[+:Q#XPJ#Rv@tDX k.HĖ0UP-[זجfl6Rw1M(8FB]Kk9oiiqT$>}߮gYZ}[tΨ",5-+Q}yXTbuJE]i^)Y.Bj>Dj\FGujbY5j4%"LK0"6X!ȵƚ=m;w6*L gէ:>9&~p9$b!WNKM=5;=Hȳմ[|*SK]gdt5 fѽ=4*K]AOXZYh~?; {eO%ŭ5:ARNO;M ?w U>SC,Tkl"s+4ӆ\g=O6"I*BI+kAQFfZ$LqЛ*- {Ƿ|u풫 `$h!м$Sq+S 5.C׮V#^ĂX=-:FN)â;$M4z1'$8,c*(yؒHH76 >mwocSS/3C6sѽ$bJ2 }mhDđc|/'fڢ@_4tO@ti65GC[j1YYs 1rL DE8>i걹ܕQU5N2 tq=~ KƵ:Y.Uidk&eK}TWYU2w2F5O:(aSWIv1e"`pP ¥Rưa6$I%#.FG/[;bJJb9^r;3NfI#XU'2EP>s]8i fgfj FUT@:F-e, HU\8߄=wr{n2 [1Ŏ69ϹȖF䣫LeJ@$fSToLا6qǿ{Ɠey5X6JB*d'IjebˆdC7~ޯsZ$R@erUZ\kwVҊk cw3Q|: bEUV?泸}*R3Tͩ]M^(O--#Nm$>KݛZ|m6ntTC$ɕWJSepQ&f./)`5,Α6!4x<@jI8ȾN_JE+N?I |9_ᲩM-='I֚zpuJ7[Wa:rnۻ։ݻ}V'yRMqfyeIcD m[q=&~ÁdAFdB̽j,]GI^GUhCLqPx nmUc+H,bh5Oi6dN૨d: [S2-OC3by>km-,bUYJJF"ӅQI=h*? CCNb!u2&ܛn9`9+{ƐoKؾ6s UmWn=ӌĂ2´?R:Ľ8I`'ڝv'i;$G3Vt%CXUS_Ġs/w AٸȶN73m=si)UHj*$rq(Kwnk0{o1MnVAMwgR䪤 ^zQKS t.i0j$1QmœIXj;iy"I0g;Ae?|ԓ_tڎ.{mK 4?s O$j,KiTx+(t+ {~AOnK[sILmD!GU0J|haiS*hmeV10-lTJ̓}1dZ?)4b2G7N_qjb;xa2UQJq܅Gd>BNIE d ̇P3z敻wodmihz d5W<}ݓհ& (ɜ|WL&boqYC>9hShIjj7>~  ek \ܕٍo$K ֐yDKt6Br0i +]U16jU)mHX֣Rueo7*L$n̯"tԭ]:f_F]WVzG y`뼔uyM=~:&\.P3Z W5ZJ6tݝƍt<3C|>-%+,8L*G,8i#qqcDvlkG|UHAF0&ȥ-K#F*YT4O{>EXsY|&.engU*T7ۣ&:oo=[}6[vdij,|MSQS`Z.vbT#fKq$3%6B%BM= i=E%oaWXev]P(^AݕTRWm]UldM-_MRbajP qGd`G8O:Xk* Ѫ5::=fvZN[|&`dq64:u?+Ѹ̅fcVԥ\O._j:+= lʏ!JudVifC7cv'wGX|z L,!I6$S[D#> I>F\x*-,^ZfW@t2}~IPe9SWjhT5t|Nr0?1?vՏ1tt:mkvfMVK5C-Edtą0p%U IU>ch(H+uP~=~Ȃ"NAO"!IC[v6aUNau(^/G" >a\[f0k,sIG5S]>}-[Fz"Ї `([a:Y̞WmQ)zڽF[U%RY#2S3.Ͳ\nuv|8T<ԠKBz E+ktc.ۇp/K/6$$RAjڔLyRIY7`Fꫂ1\!SI;֡+#<@^TfJ(>[~͊﫳_tjfF]].*HU]V@?^Sj _-$UQLDk2RPzJy~xK/QRYl,%.zjc㷬{rY*vULYC>#ħH`.Ƃd [ҊbPHWתtnݧ'Vt7_:܆?vnܖTMjfy=u-!AQD߽(F$}aRƙ}]rfH٥G>I|*R5Hbx",_qTj높,ͫj+`^;wm~ԥsU#К*Fk L-<҃$Dwy|#ܝ&W7WA]oZ`"mS9)'XxfHJ V{+wIZ:kÖGmzMZT͓C=@^%<)NN.Zyn$,2HYT5NMBJZ8(4}̸u&$s9A! v;{rFb3/_>^>*]]itg2s;O865l{#SnIbDJ\O8F%+cN ԩL ֽ-/W)D^|v:= Q}RAvTD=᧶oxW0RsԂTUk}us7J$Du[WiN~*V\RC5RSWd*1,T+H%oL>ɧ4ydij|=6.L4^ T4+$+N➗#rm*S(ϒ ΤRBEnU*AFW lXX s# 9.R3V8 P@$Kݎb#&~U qKw|JXM+G ȚQӀu7v?Cyg~JعT6ڹn8qTH1d<šfVpXF"/fmJW;ylwv^3 *hQ+J).Cap9$}So:[,4 v  @C@#WW@ l+pmO5izڝb^(&ߙ\ZohQWƦ٪>4ƨINO&gQuR㺅hjypDw1EXh3AqV JPt7C ՑW4?so!I@͡"/!66?S3NUv|{j#VԾN8(f2LOd <H[#eJHТH 8ܭMo-J0՗A]][I&&yk!: },O?@Qq _WucN硉c$-(SSQ>&В4k$_O#n}M]j7&oAIDBZ*L5Q0lVJwn $Z xd,X 7VM DNuӊWI=EpQ1pRCG6jjĉ*f:@' 'qǮlrQm >*SG1}|fm %X٫_r%&6WZd.*g{e/еG  fG%QD[kU$]Fg$i4UŘt\;|Eܻrf*7eEդI[!PizZXUi%jnf2|ݭ@-<43Ob8!#xH}DrM~s?"źCWHURP\?Z;1cBH9VflꢑVx=* $ʦI2F/0C]31Q2[ *%Ν#oj9k;wVm m96VN\g,@8<a+u=yH5I{tm;P*4IV8*:`2iGh+Rn,4WGQP)MΡ 8 ̣Yg\jsRF7l|0#o`-(-wM%˳$y_t]?bB"wP~%AڃEJ"/Jy(颛D! YVK}-_~IAZJ6D 1d֦H#^2ߵ0y50`Z8ث-(H jZ$c5B]CSbr">L% URnb8OP,)*@ 7W Lsܘ$H;opMH%5u?Urxķ I+Du#$u #8OMC)ƭ"n[#UMM8{iMWH+iq%°ݧݔ.=b-L'?_CA]*Cв56E g U2I㺠:[*)Pp"AmB[.? 6*׹3PGmnޠ]ٲvV<Ru l6 mGl~C/p`JΉIoܗYmOXCe'a[P-^7.Rt"JRʨg>k-Lh⦪hhtӹYQѹW{FImD` Ԁ:_gf6 ;mYѻyĥ@jb^9^!;Cdf _2Jv1%4XlU-`᪨uQ>p%=bܶkYⱷ648e`ř>T#)ZyN~Q #jQ|=8b}9ĭڕ;wui22sd#ʦzY +V,(_fDVnj'ݣL,FPU]L48g@&*/c/P֖*daUz6aHyB1uFF812 cxiM-DKOnM(K~#ٯߑ84`]E>rer3S͊32'O[ *D0 :v_3 #4kTPέjOǢhP-#3&x`p¤iiEpC4JF&Ss[N6Z ZGq-QvYDjDZZUIl.<{Ǹn<ùducN%iádRB :hdYYJ:=@k*g:?\w\ص1 sZ@\yƇWHe?RA'Ǹ:puf$V|^]/FYYz28-GKccJX._{.ݳTJZsAKL+<2K.GO%O#(~4 z1 DСYA ]5v%O()qXiؠb,.m鰿\[1;ǎ#jDnUtńP%GE%i| S=jn#<-W\4k/gl￈Žfo6l7T^ WzW)I50jH݆6v7ңjC#ƆV-4ՐiO?/Z” bEɮY|v&aMr$bXjq54mdp)II"r"P ?/_ m5!U|R . A>vC+aom[\~N/+lG*=Y͏M(RC*Rs0O辰"5>]A*O"Gһ]9Yǂ=H'Zɬ.BJ|_1WeL]3 f,u0i:Hwn|FFJ,[VRUSɪl&_bH@t9E1W)kuU 1t!ajcPM BC5$R%dd2MU"?7w):vg>qs|YvvbIdQExuKԡEۍ;E5*k+D@FJj(Qi3N$*=IY!Sea뱓 SMWUIbK =g%QEHm.5-ge f0JGaH5QH:*] wBf5F0p5jf?˫Z+Pj -^9dԥ[Du+X L+OZViF&zQfUiq>٪4QO:Ybg+nP +9j)8fnWgcݔu[o9OE"GU6*(|Ni{_No>>4jjQU3'lSTWDgȲHFahi++xJ# Jwcj*tDQҨOBŮp|#m*>)X^"S*SŹ2FX)it #" {;εb<ΕT:fԒ!<=}?9?V2K&r%KOȱ->YHf6< 'ze.ԭ>/< Mwo-rLonR91E+¶>ƛ<n>g$ԯdtܹzH"3M*/`V8#Gx҇'K곛>-TRMʺW5ITҊzi@q q*oԁMJJ-ٽ&Ij gP䤜'a0YdIU 5E'ԿZnnM]Z-ɻڪ:sxEY H[A]DQ%o&ѴuԁZ頠+äR ~?/OQ&CZESMBQr@HaIKU*&"T/?˺ESWD$Y[5:$#Tշ(+6&L@WZ:(\:`9=8Pt -? ?}?ŎmW1YB65QV$8 mUx3bV/+ʡ}|ʹS%õĖ$ Oǫdpq_Q++",ʑ0F 2530Ҡ iMɺ7rCDء\.ͦS'mTOI#hQg-yXH)f\pd27[g? ZE.>\8Wf~uewT_LPY6qv7xgڙVW7>2:MESDyfv'K4jNVٷ˗ޥ&|8R3jQ=hz2 QTq>TTIN5uX`L]tEc|Zjuw}ɶ&9.a1nLE^J1Zu-cX5yykxUdqD""R=ի;?ɄܘV^<3#;ajڎ*tj#aj)UC:fP żwnJd j*7HI+EfV$^JTe?6› ┢@,_hLzt͉>^??QӎŶ l4W4a jjhAy! D&NjM3tUYfQ'?d*Q#L54*T@K(G[x8*C|zj(##1ZE O~N 6H,N ݆uוdQчЀ}TO_+%|~C3~y5 5*,4*njqj Y.H[q&߾-Yue( ~RÕ4!GGA&əu.F'q!SOR1{>A]JO4.tI~>^ ! jd\>e=A5?f,b-;156vR "Tz|jֽ~#?:3GE6Nb2X7yWvMGfƜ@ z"y"ٺJ=7`t0,ml9aM~4,A:iZ_./<8(U~\xz~-ѓTMHtUDbHMf֟ǷOM;vv\yUYdK d OLZf%l.K=ȗiʰg،$ml:KTPcZ=^w1 4QriXNٯIU%tutuW5,UE[ZEY">yDU\G5EWC,trMN| -㧄wg19k  Aڔ?_?-mGweBK-DJIjwDT_I ޛvq&t-ai)چ=JZQX_؆O~֚OG.HB8]LҼ{OWyJni oFVKjv&Ir5Hu-+ɤ*&@AOimo%Mo2Xi]aק\TW>M4oIy'NqcDQUQkXJ/=5.X6^fCTsP&jU( iPQʞ?c;)O?gS֑ ±XK*  }}.슮 z;Cv2Td hZ]&8Fj8DdeWiMN-]lxj(~=nNNtžz]W'9hִ ܺJ"Y,b'E6YZ|nWk$3uDDTSā6oomdxpJ*Af5_>"Jdj"c+:lfRF$M#ofnP6O:1uh &_)n7樞 I6uPf"cko~]?PRP$RYi^BYWqJ,ou}i3=I2:zsp%H ,!ʳ9zBD6wk]om‹R;Ňp阤h$hi>]giuY#:%CgCG*lE_~:L7qŶMðJX`2,ӌ%s0TZZ4JʾB=eA}lT5 4A`q\fW'x, nS2( y?(:LfTy.tRn$N<ќOP)*(*pVG 8^#VV>F.6RT(iz 7TUW*hUs.So4ƤƫϴfeFWJ]ՕJ 9>2Y23NDInZnW!YTA0T/G&/׮]g)TLGT-* ,*?j#?Wƕ9޻$Y>\BBLvjC{Cgug,So`kcT?טTL1wt4goF7=#?=݃xLvݕQnȨuUG!Y-Wf4OTPFh m|W/ܭe .CA-bX:VP=mPk#V U$YX,s[>crQR6ԥ[Z,Fvr9%1qWS ,)_3.E˖#O)B,tp:[l#w+UPǡϟˢ3/PblSkr%SSOi"&duuEDWisfGQG%wVØʬ&mCLK41EWfUv8Np61F qtm+c5ˣ M'L ZHi"]1Aw-Eu|Ě Xm*9FcjDZUswRigF281ӯpvqjܯՌKUSS.:t+ EXtH~JP̤.}}]GS>'qTZ)㮧Wc(1eᦆS^K9I$5LjjPpa•HHmڜ[,GFREb@ SVF+SSpO@o_}Cwu;e{S(e)zhjJh飏\:ڤ5@$eIZUOOWAn=qJl)˪āBi_M:x!Au<Ȳ)Sk# 8<ۏk;rE~&jjx)`2w:ʕ6~vፘfSiuEU OhSQOD܃ YN$kILBdžYNZeV/**T/?TUe[_aUn\%&Vr!GeF.^PmdmHBQ+?Ic~[:Ե'BHM}%>B8秪jZx*H ?w)퍷AOwPtz*y)W"W [,L#wPAk~CT,q "ŕ -Hh )n,CMt?Gbb ,򼱄if e6: ar/H۞F5H̄ULč>qGjZ10J?v,ҲvP6Ff (`A,K(2dz h|ѝ)-mYҷ'^[G`$n͕Y+d(qt5k>(c,Rtt@nQ)*4D ǐ6>}[wa2gLqRhKPP֟.+*D(HbzԒ⦁$ pᕤwrcq!TW͓zTX8(P~PiF6J'W;qE7+w2~#Süj?*p nO] hSN#m#ҹA]m_ 0E,#KW(!fUGaeo<ɹs{1q9<.ɒsn>/iT5=^I9B",kpTxqe!p8= Whm;]eV!ifVBAX _.i@]V`tZ]'n )IYWUf#5x(u*긕BR'Ȉ[_o:>#^_ѵ;M#cQ1Zy4.Z*jiMD-EGc{KB63pPI>T56>\U|s< YI`u)& 7KsW?j8$.iSNw[H.mҦ U0"H~UOY0%n J72 HXdG_8u%=|ԸOS̒}4Kˋ)pҥtaE<\u!G:^\WF¥cyF>}}}Ut2S6,]{eZg"TOC&Ү=[^G4ಁqNE(xͲY"y/@2#!+@$g2^;FN7ubC]CRRVB %T Hk0?[DZ9,m~RUbh&%QJ}we!B{^^J%kQ!1`c1[L2iTLPrI/뭫;bWSQa 4hT<*o$=lO2*=ĥX6k宨6!$Zy^vSv 1SQbiRGǣT`2 x**>.=13 YXVyP<\"A{pk5U=>ӭC"lŖjgFjy a :ʳ*'"l;ME@#Th 4Mv<\GGRbkqqt"Qý[]S%顝wMzdkhh'PȬ#_ aa66*bM=~t,[wۢrujp8 HL;jwz AS]C[ s|1ㆶ5+aKjD$'`ߛwcny1P-39rUtELld0 s͕Mq錞Nྞu[sV;!ۣe05)(2iO,t l>]J!X*""~umnGodd{|qx2MՌQѳ+fJJUUU ̋tVc3݈C N@0H)q+mlIVEd`* S5 8ЗU2Rt rGƯ_^'TiqyvzZ!eE1IZL$*HBD>JHW'ӹ||m1JhH|PS5z#'cIHQa\>_ Z\V9\5' $)ruA a%rJSy^fE*/k gWզ@`Sy"w )e( )ǀ>%su`(Yc֥c$*ojDLyd_Gʒ/^Ԕ%}m\kE*ឝx3p#4/fmnnT$':>+zK=*Z"4hK@I}CȱPGgs)W@n}r9 XP;5}҉FZ4:4sbX9Jq\7VPƿ.7v1 :$BXm>*ja2ٳB ,5-$pA6U z%q]rTxcb'lb VGS9OZ>O7$RY鸩 [sBZ+q (:EME9ri DjW^.$zIw +;Y5DjoP&aUfa ؟Wmگa8%hM#daصvzW-i.Y֪8:c=יJEi㢯z*y 1iM2F:UPce6^;/gribqجDPAJ#DT31E'WvH-h E11-v+[h'TY#Վ{"Dd+oUGJȷ7 Hhh6۸ \SAKELxѢP3i[[D"@-(TyP.l>SxNm,NZVN4Ypy''>΃zFIuE&0MM֎:y[/9L}㓦PZ/UP tõ+_,[mbUジBSɨ i.5)m B41ULI 6(+0 B5IKVϐeUdD}=`Ԭ%dU%̏!OX}+p&lj)jQ0UJ.k^9!yc I/.&{- 24<3)ɧtpKk(!&:<^q7UWɫE@aP5*::F$u{6v5ouE]B T*\,I3/THuE{e;F{lH$mZY;{Qע/!UUoߗٜlE#)ڕ7yK}],6>Z:Pg(ÑoMxm3n˒۳l]43%UG^䂝u#ܗ﷋kkc(gGLL-^Udj #*. q@)_ʟ?Dׯ+M];ma^/| Czx1j|rEPPbhy $];bbcln헜Qc`t[kd:,GX 'w=6QJΓ_HԧQ+i:,jfjV~ A$@)pх$tc\}ۿRX O{k 7?)ql&s,_pAT+ }| raCnL&|F)*)!H[S%jRMyb J7͛tZ]Im'#:,gC  e$jPxn.|Snο7?nۚo;GKQ$MroRV-!ze(yALUU{#- ]b'M]f?K,H +1C`n[n[M$hVԡ)0MUԲ`8tS~άS[.v`-lb1Uߛs8H5K3?څ]$IUtdvLG"&2\t Eew]MY=+h4L`$m'mQQcEuHWnM^ԭւiy#GOXq5A= F&8 BJ<dJw]@Ov 7T{߬i1<l4ZhqpկWWUq %I2dUcEcr(LI ebHˬW4af5P o]VpuM xV҆CIJa6`)RVZ*em"$re`Wji7dy z<gtl =4rn/۹,*jy*;@ͥ0|f?Qem6:M2 zqXJ"}pRSmc(j2˙ژ,TMLؿ?P:ZhfY# 2w3KOrq_#JiܴTFX)^ŖmKUBe "Vcʆ6#⊹Mo刪č 2[4/JʎcU-t. }Ih,w F$s$l/rUAfMo$nEWGr`G]; Y]s[h#cr[ ٕVu\v=)tcm,Ŏai"=RfيEc-=Y{k A^m7[YHo.#I6|WcHT16 3]qGI2uPgNHP5δIqѨZ)43UWA9x0{UySg$T8r[[u,=#gG{cq|sɦd:|{yMdӧH`pu G=1(iIW^'᧟Ęhz˒Dl^48(K&Hf:K] ˩[Lzu*^V_7LO1=F!*c3TIM `7H @!eWfa-2H(NCwK%b*?3<+ydz޳I&*e|TVU]Vj`HyҬb_|OSݕlcsyQɎېRrg`O]$oIOD&7 zI4i MZ,h/u95k#ՙ[j÷U3?.Ք=֝5-9]۷u͵UY7w0 /"It)!fFm!u-H z܌J=ֹVC}ewvK%jL mBEWiYkI;"O"!%x,JK =VWml#7doӔvOm,[^T/G5=$Y*]דmnh{,B5i:J1ye ?:zS{L q<\ .w2QmLf7u6w9E] ML5"1vXM)!_eH0{Ol,h%Vj#*sM,fRm{>`56ֱ2J%c(Rw'J kF"ϔ^8gW.ij,^B}mIwzXI<(dwWJq`hdl/9YChj\G>"P*4. ќsI/ Oz -SƚEFPTT,Hi)n.;E׊Wwm해)XFsT@Y#.}Ce n12N2UI45WPm*+ +Sv]7/Y\%Eun7*woY[:Eh2n0U[{ |`ǫw>{;"MFX+#X!]K0I.HnM]_E|'nm3_)Sؽ_/' E7n5ǴZEw'&WS:]@6]$݊@D,+Z ?akf0jw 9Xe&tή6>}Nf8>C#+aN[!9눕ǒbBy^?ZRvy#εcJ B5vtD4( R8iX)F/QWYG\CcM$j4Dꔁـt9~lpYǙ#K75N))NX`%xXnX{=UXH$u,HTTfvnn}زi:h|X5F u=1 [e60mS1M :O:äO=U Q=wQ`nE[%M6<%CNM#cĵB>OI$}*]᪣f)3e c閞BV.d_K5l|aq\\NI:X TZdi8=Z/|WWN6⦯ڽճGؽnjW_P #]EHB6܅;k*g#\Gi[,s_E O۝U] a<6#ũOҧdu/ YbiYcr̒hORnll=ەr<%q) c{nnnn&:V !] =,n٢E@`ҧIO{/y WUIS:N)I3NЛCkō l;T5#eRKj-r@J.14u4:Y#tԌQ_%;hqz:lFpzL4߅VTv) hϥo}:qg6{-tWxcNAj=RepUh#kQfNjjzTXikjD7Uw[x .:o`b3x/kuu4 9Z\Z*i=%Lr0h_s~r,.%Xh+#]E[[")=<^؂Th\j^?fzWɦd2d鿃MʊdL)A4h|O){/d&ߔ1G?Wj#S4"}2SZ -+̰62Q|1qI]}3UepHWzw7Xyj:|L)*iI- l11Bzorq-E4(4ȰAM)bb#܇4|ZoV%ZAKOϏTx3{j~TˏH(Ĝ 1Y*IdL AQ4jοQO>ZX׸q7 f0SK],U6 댯X$ainweG0s i:J&hLjVm#:i(]5^]dwfuMVuBj "U TfhlsvnFnpu5LF5V;RX$Tfj5EssƪH@hh `iZ#Q 7%7Y =25TS#qr%5<--BiPBc\]{?zZ i\ ?i$TBu #lK;|vf'T1Un<)3JqϯC-LL 4o~e6 ha!JF1?ʩrX *"b4_$r0ݤpHDJ0(Ćѳ g|/=?gA?)͓wGEch2TeXjiU n~,VWn䱕pb2Y&Lci妩FCZfݾ`m¯orV`B tԌ{b8dbn:ȁ÷Ϣq{q #O E]GMҫv+yB/HcWW.GߛȴNLޗ;ám@ڽOO.U+RҼ S B!!^Od3t+BK9g@5; CQ8 %.]A/U@*qDzKH a fw{A~B]2;hݫO9Yj?~DcQk? ㄥQ?e%HRxn}N+L @>sŋj$ WӟvQ!/VmńozzwFގ*ȲŎVlB),/>]0Y`H(5j7^k#?KJ4|Ӟm=¬hҀczQ k\W{5~ }>C-ݓZhkz4؜R+iT}ǛNո $ O_NٟCс[|B+>y*(奍*Kxǀ$'UrO UCvxeY ,/PiM[,,ܥUt'>C`08E,u0x2bTٗ݊?νV.-{pbd;cBTcDzxܲ5HT- pTYo2Mjfc&<3Lȃ^gYLj@'N6^ SD\zK5<*=Oe,YPoMtnN|lAWj\r4#}V3)GD TAd 0 L^6{UY fۑڣ=EIVC,ԼZ[S=ђ[b,x,f+{ljc&ˬT$*ZAu} mGq# A|$QSBkD>i S%+ghg iэ:z:ny_b tkƶg,5@ig#f8!hnN9<-<)CJ yc8A8$ԚF KRk^ͤo=L@mvȶ4rH)S0ҪóXUNkj|;<4vW1tKEJ'>ν @o7+?:W3%,t.MU25e?OfS=D||gaؽuggw= 9UCFDm"ED̤<> ~o<a&YscnOaI:Ugo릵9/{|0qU Kmź2Ȱa3Jj`':_ܮ߽Ghh|}~vi*z֡++&6k$RK)V=ŴJ{Y32:]LGiEgJ(`%OO 42"DUU9Xm""DV5o9Q13n\N7pe!\q!yiX"Vh+ 4i0]s6 mkPBrA\ gJ o',xq/IYD@3V͡` "h>v:bG_\M dET7JgHcfHY-[]0mU&+^r2z.,GJ惇\(餧5٤f]C DQE6k)cqvV|憝sγb)%!jI,!T<|v跄:yaq頧o=:_eici)͠&;mCX{qMM^ũʝMn9y- YC:#TS$%Ʈx Rñ> 9,#?z8ͿA0 Ժ(PS4RCjzx#EknKda"4Rʵ;Ք?މĐ vFanM? o!t?8u ⺚?&Sᄒ>$`޻*|q՘ȴXIEie+}2ETNT7o:n+lH$JU=3gEt)$F:0rH?ݓS%9UuEe)<$K PAcSt6gnUZhvj"S[-K4XQ0Ubp1г2TTOCy){`XS|=CyθUm Rw@&vP 8\f_zӭ-fs/UTphILzoM=33i SmOqE5y(i~|?. 0ji7]]E5lSfkY:˕$GHʭY}X {[{@%3AJyd^I&Fn`֒qљ`)I?JxP79j#=v|{'3E5S^+&H5+Ln2I+-( ḊogpBjr$OFO}:7_GN /NrTGI(i2 Q*Y|қX),{X7&c`棊\U9X޶",0b3&o@^f4#Z A]c'_>>G>8m51 wZ:ޣNd䆌),F 7S`7DIe*Y &zzz LѴ/6D hΡ7}) hvGQj1\~k?_ ڸhij*HeK f} OyZyeʘiѱDFTc3Xm0]|x*qf_Z q~~:Y 8%I_>ֹl'5u-Xȴs`2-OQI %XM<7T)Ok 29W~\{HycIa`x)mYđe(+{j 7>2.;jO@P_S1~uף3L!6vDG ?..U{FUmݴq4[zY,_ <"y`vF %G&]oŨƀWW/r8 B@IG+k &V?SQN7645 SES d_˜/!]qopeO]ͳ)WpSWhR#lzaOxY 7HƋqilnC?O]jwlUMO6TB<3M$t#Pи3\\#=/Q+ ݩ܉ O?k˨; ~ZO޷MEunz>{+o+A+-]OZum ^d&QP-4i5Ԟ(9_˧K$4+_>SbD^ {lξb 3͟BB'5HB"R"{?Ap jy;|:jcE|6U!2BE?L;>032 V ?_X಴r"%MCzc@O,UI?"6mMWCO^Y䆖.n⤥Е9MW3TUJ @pp4K+5ZIs jOx ЇjjtqɚȢ5+kthi@ .G1{#]i۵ۏ3N] SDj>,l-9*T[R9T+ñxГ1JȲ(\)T띻GNb51chd7QϢ2bYPv_d[-FT[jnڑU:nsn`5WLQJj8$d0ۤvN4RY rp$mliR.C=LFFy-an,-#Z\/E ̯?^G6̋#CGƍISAOX駂)"S,^0/I?trf,I}-qͿ_b( R .ohd+]U;hoI>ޛ&|*X:*HhRұ)VZ_m3./n߳_>ųEv꽯Tn6rF鸡;Wzz4q1:w.hj]"Mxq>;w2 UL%|>㷵eE~*dY-T6XfSJifWA$E/|cak45eiҥT+"Si!usX Pm{NۤH11"hqjkymUF3P Y\-D$1լ}V#d7{6f~a1ucyJ,tM5Qyd@<~fs&q G>2a{.COa{u{eJoMUՙFM7,~EyV /<,$[e\i~FCsÃГi՜"TI*5MKytKWOYO t qt6$? =6%ǹ[ ~ 2Tu8.@A]G i-&]'f5{@롉G tUkQ\'cxF'v:; IM^ByEE*`OIqBM,& &r Gv[;OjVo%Ki)h,%/IK@>z9bHx m@.7(▒jBX*tf{ o#~rl5zG2[Bi2!]0JfiwvIIɶ ٭ҦB/Y#MODV8"jzJx.8ڂeZܭJ #֙m[kqkhJ  Df5zӀP_$ɢͤC27}d6om\~3iJJj?|D4ej*"bYCIcV!5'`]OohI+c54V/[T{4LF<>Ì9:"Ħ[Kp$VTlЋ"_ϸ}F eeBcm[|}*(Vj3=DHB+ &(-"VX) rܲ,@t_AFz5 m8)dH|12$ _df*Ts'U^:]j"M4f&aD u/ecWNCfXHurdhD }^#+ۥj+&⦤diPJ*4I X!663ufU95j1ջpc3 )ZLeFacVwrWRJ>i@FpY%PIgk-cXdu zEEO#&7dÌG_GpTN_:J=hөTل/mU7.1͓,?y3TRAK4t4T(h PÃM#/D$R)VZ+^#N{{l-ZeR@Ttul4qf&w,Vok bUC2o{>inMH&8tԶ?p@5=VsSBZKTCk}}n-τx45SдPzHٯwceQ=Zj=pxp=OXostlͼDz6jy;o:yLtJA! }t[};nn̖$Sǽnpꢪ-uT+ԟquK=iҿ.k|mS%V{:#Ug'l]̔ջ*,S`,Ӳ:܍u]~#P 2ϚX K*%UDF4 .~=麵[sG]aF@>d#^:+ius-1~/Q8(+[8)(3OuH+G )¶f鳘ln~?~PlqIA;!5ŗ\}:F'M LjE$]O2sNP~aE]kO /5=4qY j}D >}(Injsvդ}q>+ pTnYFj趣KX Ճjȣj~1;mSYf0 IPmIQ)>6<ɠ_mAymGYbFFY%eU`B䪌tCA:Ҁr ߊ6|d2wUCM3;5M45KsTMuj@"e~AweVތm(!*q==Cui$TNޝX@搒sHR6OUm\QE\:Uv JGCVTTփT'OVϬSlRm]6Wrʦc=u|0ѣOS#XB{"7dmJ͍0ى:csL3ؔt^!SBX6ǚKiKDa {Hwf>!J։q)1:z;L7%ݔ; z(eLfSyT<~29 @ή h)n}G?FڬtZj-WUEڕrOb~:X\iԾ ĔPbcb.ĩZS13j־u8p톋gmU`ҷY8У%=^Fly,&eMDtSJ>:R(bXh1[ogf69)r5*evs_|12\Jap][vDŽI U,r*QzLMn4mW'5l /G#ثhqVb+BCjig7607c㢬c*>7pLLmz"Q 9j-1ŗY-!,+0 %t'QUt GWǢs;7 S?7ӻ bn?C*i|*#q!`#\l.*mʝŴ۲6{srR*u<"aq:h*,vs%ʸ;oWojUHzj)B^`dgIZ]Ƿ媩h'pm>ԡA0MtY#irDXjjJ8#ݻZ/xJh`pe]sPj#R|cYͅE] r#0jjD2Hbe}:7T8̑֬ ": |(i>%]ٚfYUEKSJd$()7~';8|nGpSSA|̌dX!X$Y=&<҅6&H6-ݩw!*㫴!t.G']gW"j7nd(V[!rʜtljIRƵT:= s{njάUgA3|VU}MpVh⫖)9t=G]]\]m-:ey&j~^؃}L;i RU?>[dr[jmMmvg\b()yܻ!YCVSSѴp V"o*+pUmQiaY)) `j)])p b[,NNM̽eX/eQL^>_o:KS 6WjBO#G/W JwVHF񕵌Qcsc.JB`+_A..-,QQ3Jg5 V%Knܠ<@E$@($:Nu1x fo1=x=ܘlN_U=qldPR迃dcdhc5.6jY!$h][?pekU1QK .ڒ3ܰmuuQ,#qR_9R%T$Uu%@Zp&^`1_a@X sSCJ*W6~}15Sc1˴[vml/#b uN y8pm=]CLɕݡUەWC&<ۮzcTJ%f=0TBA$dh"">;riJFM/SOIUGPW|'t[qmszx{u7V2=O4"<:dĘ86l@+*Vg"f lTIPiG#"#OɁ6WqE4¿<6 CJYeQlnֽ{b0T%acv)%YkG*ziҫ$"4P~"_gC uJE8WT=RU5/;0.4A1.j;pՍMۻ[o,9zT+Qz=j튘jbG(4j U2}4q=qU.h|A҃+?bq}/wf]F''VH$Zmk *2M+%*Um\VjꍕOw޻i֞5IL-CֱjafGВ+W\3nvn[ ]l DZ|uԺ 5 P{MEOtb!h塤y=Nƭ$XZ!%fo RVQei SĔ _\I?-@TT^CTPEU.Jbl|^2q 7iahXmLE)K]X{1fi^@I jaƀEvwjU+A?sn۸+QT݃jjDQXv8YYƫE&A)GM*o.U9.\dV)_sc zFH*)j㊣ݝj1Q]AQ-4W2IÄ>PkTY#, iVR]yY5OzL%8#_IݕUIMI[ y%IUNԸ l,>e:\[0woj+"JVj8)i) G4\̴SlCnc S,ڣSHUUQu2|^]:|Oh1xҽ#w7nSrd5InڔSWU_!TuNBͤ~e9Pb=[Zڭ]#Xv_*j$_*WPn=Mv۔!æP3 ltip!c2<Ox^uR2}Qw|@g{~IO֧휾FDqPK t{˦( nM?s73uf^?Ǯ.]l!"jz?:WnLl)uE`DAplXID}`oD;Z5EE '"4"n-kFs3i3^Gq1x~]ڿN.# < rI%Hc`9#GOK;vmKGDDR|U$ÄeU@<KK]COc|J͟{H yc^sM JYM3/Mu)d^$guC4LST`u]G̈ѱ2\{lGl|t-iBAstv[Qc>U ^##пmptG eq!`Ik{SJDt-< {OA{lcD (EqBC$q8+[}dXFZ̾Kc`!OI]%,Sx)ꌢ'Xrt$zfOD C+K}.hEz*m.onC]%;)*WSuuf7^V72kJH**)VU0FיD>gr1f2`TФ&5~FX1܇} {bnsFLSJP %US_XHarPeJVè=:ievxmTap,V*Pc*Wzv>uL2FPxʪLjg()(*9 Nu"Xq{MyQ0%V]/'Հ-^YnqF 14,ڿ8y䱑c}3dh妞EuB|$Өa GV;૦D 4Z~Cӣߛ:xM~ժҘe) O,:U<@@`OwgLII:DVBM_reѪE@ZEzJ#G ]j(LAV'}Nݛ[,ibOuo" / .9  eswOi1!,^NjLOhRHpj:t䨥,%D21uB*>Q}mb3 m)ZV49 qhd bolDͯ,OTqlwcTh_iuT7CjT.ͱT(gBb) 4]<ԒMxQ-b^ݛǎm%+.+N'DYYkLc/f!,U1.*_e-TESCIQ(F?m(V:cZ "95$h! 9k{m}]yoM1֍$_S\c*hQvGoew٭1 4wYSM,Ji(Vf<-~[-ssf$mB;M=AHn#@yRߙ}yBĈ7-yeJڗuPJ(MT&]0D*ڡR> ٙXkq_A*øM]Z)lF[5GQޞ=^cOV|[ts!4T,{~\(&0jj>dv3o\3Rڎ5PV< Lp:"{Ҏmױ]J,?+^{3|Pdo0Z5 $6$6e#vU#I$3qԿ?Ϭj`@ct$HƂA+8g*m},Un˘cgQD[A:wvm`FJ#.^HN:WOHc{O\)/Bױ+wnaY:N p1`.D;g$%E R5Bt ]RSDIZ.$vQլ]v(CUMU5n졘k'gol=Y;MitqU-fc8̕2 = u%"): Z$Sщ(PQWdzzBe=>$щQۇqgI1ƲI=cQT ?@ۇp[mjMRgK]2CHPLcb.V{T{OsTcJ 'kG_<|eO:{O3 ]u@`th0?/T=ۋ720dir>b_fjpu$D'S8Aḙ̌=ԬH#PDT@zfgIjäďC>쬦l]Sǒ&oQ81uuk¯?Up9<= ҏ&-/]ӒLty!I4T1EiJƇʿiv"H-3_\~*t/}@}<94:7?ßc29,,;OhgJzA3y.29o. ڵg) r Q+3)['Y 1 ?, )=5=q8*3;V]NxiYԆ4 #[{&%6>dI#z|niib78nE5;P䵣$ 6d;¥ѓƔǯOatXW:tܱ ir~N}6ʟgm`}}A6/dat&%*DR2v P]+q'WFoM=@8~~ޡMQ$)ij1 dpVmPca6wVn D&٪)!$Qec7Qqu=+*x9+ZS z.8u YOLyTB9j *E >o7q+dýp<6 5q(ڢuտ}V/T;k8gܖ:E*h@>";0U`M 94o٤xRi6̩k7ޛ߬0}/OYvgsҫMK:Wbwo# QI,,@XQLLM1TYZ @Js09i&*p"8Zt$myTvE2ȥ@P cVDS#-OPJ;J%[t`l*U6|B_;ƋSLX(dU$aVTrlAutte>΍m9GǦܬ+5,'#p4>񰽭k8ؗkGИ&A7Ƕj1:d81Q& n/ۋ+a"ܯQ̃C1=tE:pakX+Aj^c:*e+4r!*T. vv>-Ԕc&X7_QR窩֥R9w%[KseړQxO|z+oY]Je?ӮjyvvfpX]c erLa :'_٧}Qwȩ][݋ yiRdY Hd>0=嶾8{ ':4 :Q_GHΣ/J:(R`&ZYO껥2+ Ҹͽv+RZlB} :")hdwo-"34v ׅ?Cz#*"O?zt-Ҥ )g7'_=}nLI$ IGS?`Yla1*jC<-"i>KܣWM"Vq 瀃4N^\!n੦z/] f: ([XooN-#H#]Iu#TOanݹ][-6DJViF#a2L ,X Ͷ5{#-\+3 Be }eMoa,Ak/?l==m^ӤMa2N2Uҟ4Nu2!ڻn-(M 26T=+>Gpj ]9-M\HU:ʒ2) ي'y=-GVGL*5ۙ- E%cȥ4=i} zc+ Tv}:xNVh+.I61~IOQ8,JۏT%Ek%M䡂IKVYñb{k;Or{GMF+q8|'SO `2ꀂq]cف}Ѽ1i#dsn9b#"50ʢF*\A S~솑p#GWoJJK;KwˤnkJ:**MD"!ayқ c I,*Tj$4f~Pٹ>t ^EEVr,TxT E< NW.dvÚIG4u=[EmmEMT筩jbDq!m18T .M|}6ۮ4{gia)"qҧn 딊y>mMްP UBSo۾۴+m:cQy4Ց^u!g9omMJ;fag7-|VG!R Q]ZXQ+G 7[ەifs CW>3_QL<\WcpꊌVfkP-~Zu_5>H)G>Xp!/#]X֦3I]@e郚B־CNQk&_8%:Iζ%I@NEԁ6ʝ{RaePʴRHK)DۗrTp**Q>qM/6_nrfADhφxz"v_ET>~BƊfzň;e$JS 9(/a$;wWFJJ׮SQUm*Iw%dzYc*H?p^{{ƴ}+Y>cU bZuui~ePaQ+o5$У4LL՗(WUE_~9>:z8{eOQF3>n SsP:i秕d`̣I>Uu}ilѭbEUW[u/n5F\VV` hAcF~}ssjcTȡG_Y Be]A"m DU{o}?urCie1<Fx䭅䴕`2:f?gB+ެgJ:LE*v2hCNp&Gא"er*XxoiCge{iR.1P_++ƣ?m9+PUk2WHn(67 6YqEGRQ @d!8p`/s.ܔ8ugοRFi^|΁sn" x4$VƊύD=,XqX /fDzս:urmuUE}0mW&)E%G<9 OIiWݙ͆[q^5jR5eVRk V H+A=mR V>fe,RTkԆ߇^r SG%8nUAD8gjuvөֻQ]۴mO>X‘mGBX* VMOy ki GF^ٜܛJ{l# AN]-7JרdU/Υ:l=lbj*WQ\W>cRv~"97ENv낆*}U\Y $" inKjN-iwjjmKX%"JS1R@H4'&m;]ƺ\4IMsNgx]r`>҅q=, evLn1y|bΠӂR5}@IQU᪦*"0`-a<{I7A՟rD̬ہA$rQe|\jsOX31x8S5C A8͖4B 4cJ<)S^#>Toۅ6yR&,Zta4Sژa'Ug5d."ڋZ(TQ)-Z4R$: X{;Y}u~6ic(<(MǍhPO(!pj`U)u0#R~ SN VSgQmIզsU5XJ(Zh 1;%^ QpUxM׀Qɾ64a3+_[-sm?ue3t.Fۭ,`+R> nRJԊݯ- ֗򱴸:NTC^sA))Ȱ U)&,SMIq])$j憥qt$yN)k J?:$0Р!I\,| >]dHutcB4D9:xFScm,j[q;>]*]pJZ1=lVɳ)J&P?C_Pi {@>}'^̻o0B_) BEuzTt:P$׊q5rhhGB>,I𹚜l}.jiN0CSu9^x*I[/n #[ ZTO /՞]UbLiJ jӵ:t jYY2ud7>vaB3{HpM{w+Rzl"6tZ*4YZٔWILQx|L1*547M`VA P~@Nzo`ƦEpu+B/ꂡO# vXz SWj|<&|֟ o05k.I 1PSH[M)^f71I.|-"<\qg+b/'1TӹC-<1G S~T>:76AUwV/H*3M[+Я2__hB< m/a&=K)o&QRo2CKlB-|U5;q|H!}2i`3kngl1첢+;$Pi?niD)D 5r+A>%kBz.3mQ8m` T3%4jPN痧P<*$`?HW RY ` IoSIz _n!)vm|UԔψ*`ex؛눤_]Xn5c1;Fh ~NUDi٣:7PŴ..U(J5)k\VBY~Zڭu^J (pWVI]o⨁X>ɥ^tFVB$$%]YIV|vswGۙ,SE0ufP1=p-p kqxys֭uAVu5#);pTxv:#z]jVGbMobgGg;4LNooךq(F榥G  &{f]K\i)GqtO>ekY~UHj|q-1Sɳ-o=%bVj<2R"j䣆erxG͗lr" /v_ g{^Y /c@\}t_5eXO镢G&nO<^qްqbZ(IJ_ኅ+*|}~+;Da>Ah~g<6PsR{H5Ծ)?Px#R:ƍC VO?~9??{)쩨cy䨨z8iIUi\- -O\E1:?%g6)JʂWt n1 U5C+$pRÏv7$P_[cp4U1Dpu1E>B'I9h;%%PXHt#g3oIytZItbOn@ 0S9sL5!uHE dJOJ]0td|MOдCK")zKZ}V#hɶ=M!=%2\2H}8Y!2Yĕb=jEN߅6 9t-Y6=-DwuV:m㷷8pՙ Y^+j f>mkW1)\Oh#ym#dąݣ$Ҝ+zn;DdwUkU>"ْWQ֭5Jҡ*tn}'Gge̗juKgJ%|EA_7j棕U'KVhdaiYeڭFVdjs"l*Kҝvw9aeZP2k\PQGASiQ1*v t򏷠zÇ4h:y$ pObꩆ9wDڪ,Z J%gRU *i gt SFRC|cˀ+ EԊتt~T^_8㛂94)6mm%qATXpG#pWvmmU%^$J|5_еSQM#bu!7X5B-sWtMuD"<3IMTq@>}'/uIGY>#'-;-6ZCKPO4*5' kq_UT'-S(3.BTj#-%Rx咀2U4P>v-tp[4:+BF*d*YHaGO85;J:{[,UFkh4Xibf MVIUA*X$ -sey\].ڶpMjtl] c'g,Hغ2*z&-g}شJ#ffb20=!ZF1Գ<_|tާ{ED[+0~8-_Kwt/YQYi0SKjQ ,be%@!7EV:I/HvƩKIQjTU,2D7i!o7kS[!"6,p&4nL Z=ʹ7Jѵ5=3`fF=${R%|f*xEi&frFxfPv,lfIJJ4o*Y`%ancpIw` T\|!4SO}Bw@8Ugo=ܜ9Zj|&FtfIm8%<R򥤗,ۭv<M+W_UCQ? vsF}gH5[-M͛8U۾*_$%E-c虥7YWTN$*D9M2dqUFF5~Jcs  ۮ׺xl.uaҁhlX䦪tyjLS]2tݩ?Z[d&)s:2QC6>Չ|rTKt,&$>Gw -]Pǎz:Zet O\La*T!{m@c/+Pҏ~}TF#o5YLZ#ѽQ܇C\6bǢ5<5rJ/^PSC3(&OI4 <-7:bA 썥+!S1 'B ("%pV19vOjws"ѹ-&>.͛yMi_]ME=chup{ SUȶf!MIiieFhO]Uj, yI2*6Uafu*n$oi+|LJWOaѹߟ-n. :Ɏbr׬#Vln#q+eБ~`ծmR5os0iT=W;i쭮H ӣ$Fhi^?oFxrjnv>**2%.Ws!IW`Ť T щՕ;w}Q6.;p% l6ۤ޵U\tsUf5?%(g7ʯȺ.5;k MXQMEԌyW|ˤn׻*2q[mnplzH1tE LTP<Yj}5J< h7Ydt291ֻr:#qorJ"ۼ w$2TVx&O!Nx#-?8?;J(sUU(0y˷+`Yv $l&H"7,+NPvbffꮻ;(`p;qL.'pVWKpoQS鞌_dH`b(3jj2TE-EĬ A>7sgB|GxysEwЯEYyPX(,hh6k -&Te_JpҠӂ҈#h`ûӶq#؛=^M'qMN<>51T(Rib|d,52.0uSvq&jg31,Ԍw:1*z jjBJWSζIq#Ie3hEL%V hXIa YmK~2# +N_3t]HǥN* 4E ͜JW!uO(1C-*=1ccs1=Pܢ.djjC!x4T o/,rQpNiķuJeTV8U\?gFpgRQ lNM$ێ3oQp=W*Z!hoxŋlᷖ:zqrPVQ ld@Z*e2 <7ҡL[I>;S$i]z٫ 2JNj7_&X~[danna=IbpjYk" y^_ v؟>*;!2 =NJ2W,1A_Ù(b*!Miu<+D7BR;O\}M G/qC]}̜'3=iك QKPǻF1窯A_)e|o,g[w_N~'mɍqFܛ8p;VOM]W()blyjvDYm4,*~U "J͊잙HKPʧ^=(>'\{vEuYMY=9JiFl|[nZeJ+3kef2Pb2;=mȹ7.(/[WޫSFduCUCqw dʞ/lhUZ4At.%kvrhy{75,yM6BYCk_ o_@K~2Xؔר(ic3֚Y) 0-`wSƥWAY42 f/3P2ti&-]CK 9,b3rMo,јy4btGez~Ű#n vdrQj%7&іZZ|D,RG3y|cRR 3!bO2G$ Y@jqJˡ\1 jX婪*IBHjk4`A[<;r)Skc)s[{3zݷڒ> $F2΍8Z~X+B)N4hZ~׃KQ(hp1Þ4TONت.:JP♕r (Old>'EAYFC$-7Gm(d%Uu %*V tWFvh3JΟU:LkoNeNܞgijZ|.G[ǹN8Y)#1dt$iu4mcrG[Y:+_>W?bWarU r$s~y2 ^yѳ2 Fϫ𫤵+Li+ç $~y<.ޫ d7wVfD!q|aLp=]:y'&O*v%nN6?7!I6On$ӼjfhaQO%M|,#Ⱦߘ9Nńk(y+UKTF%K$ 5ʕ __*ѩa]l>rOGI/K5|IE:$1!kA?` Zw+9(֗fmrM2`ǴvSYR1}ۇ*UYb=q#W ?"_ o:8IClln 䲵̕\to*tpEON!7a6P&ZvegUAwU0h6N^'R4IWR$"x ]\ҶȌ $4RIAwid:@+1&iּ{y|wS?oz1튬`"JZ&G*C`JkCϲ:p#%D$򚈚'e$Hq1J1ڿ/V#MiƿoWR̺UA=εdz#Z[2JjjLIYUHaӨAGEf͜`(P]4!z ` 51NpWIj1X܊ 3$x[t$I]G<Mp0KrkU5&6JI5*9xZiSݴ8sfc=ɞUFR, |ҸáU9;SQSOjifh"$%dtmp5hn#R(2ʴ4II:A`9e$'7Kݻo 4BUUH'CjhpE3j(UQ$R4!R2!Vnllm`E;썦3݋wnj;;y(Ĕ3PRմ'"v_b;=}ߘii* ri* ~tKsi~{4@en^}zCmm4K)t214+@=XߕvG(|yLL.>%AQĠj7뚹in'eEd:oNX^G)lSR!Qoҷbm ҎC WIgF/ wr{vucI궾Z0 ze_e#)+dT+f =oݭye)@I:HIJS-C 5m 1ǖ\6^3-sU[115=[5c=U",*Lţ\f 1*ll %qRf8ŶrUM] ³y"$VHWQx% e8 j ^5XE@9@i{O!½tdiɉY_41US+`:_D +wOVc >ʚX+)KDY4E*T}^Mv/m,VZ  ([9sjIϙ@kQ\ e]yq;fIrYv%0PV%#WhZ/5%i&WoM8헐a(e5UM,j,x'Xd/rI^w}U%ux)" KG-hRF^Aۻ5thPIC"HK-Deַ{d*46HFfjHuLXpObmGIX4U P+ "{d\2]fe=?⓹l=,|s*WΈ+)ҚTi`R5Ъv=Ve%m,x*%G Ҷ ksypՑD H)5rG⠭7 `EA5P*UGZ[35s،F]CX݇z 4uZ$R m&v[8+{v =e=2j+SEOK -FZ/nmj{QVCES Vu%̇Yc(V w( 4 v6149uN>)iCt0QPiqTR҆7 ~*1oȓ-&jx,aNصבb?o܊M5WkcjM:%qBFJcM;_{EOG;msUIjDrVXi]nxr}pӈ1I;)ʊm/F~W-;1Vhdo_2-FJ*fjy*&G]MS4ZlEɚ/!yj#.1NҽP84uS;4y#d#>(t,I%ԛ][{ [f6U:gej*c1PQ\I^_6u=Y1-jU+ l5:|yšZ*Bj t 4lp;;vοW:nQ`_Q.Ŝ v|#IOU(Zʩ"Ա]ʨOt5ev}j)}FC+^%ĵTz,uT]dWR|ٶw͚oaxMR(Ztܻ[L`ǻM25pjM3s3Su]̍~>݆}3SRYIU߅/Dz{-UT¦)WOSR2C2V]Vӧqn}w @Z$dzz <1$o SQ -\>fS JFѰ:5đ7f;+KSIf!xUFjxW&dU!Ifᵉ2M;-4kݦAdiʜzqfSP{j;zbuFclC*ZHxjPI‰EORH4 .xM6a;wgλg6ԕب<1Tf2Wkxƪu:ٍ=YXBmdIR3 ` *M((@<^;w֒EQCˉJHzdo;HctSe+(S5z$8dy'b4@$q<&4[/oVk,YSW+Yjdt $Хܪ˷v~gr^.jqބkyΓ0H=ݹ? t&2,LV|\/s2Dd4QSdDOPYXIjTYx~Jw'ASP1KP) 067h ϫڵC^ }N I?CO] l#+MMIQwx誖 5Px\cnx6Eq*#Ș1JXjGEBDz).d @"<+U~L|w˫ܝMT_R_Hݓ=_ۙHe嶕}5F VKUMx^ά0Bk'}9U><2fG)ul6g)KAtrh*SŒB xuH9|keV7 Ea=dU*Z8sBCd5SFZ9% "YK{EÂU߸-Ae6}744tjzE\ 9 K $=GaDQPH, x@iO!Bĸ+78}=KEQ8 EGL̾>;oUbtîjits쥩1I;~y"qxdJ>j!xѭq5 5PUd?J82d~Ocul{g nUCh/W<}SsLjbޛ7/_Ain VBƒZ%^0hhiB 6<:aHԺ5yר2\to?m&0i&e{f67G 5h9ź#@Gq掚oҷPXH[۶[J Î2u1S}ڼA2Vp*0u$L[OzOd3[*lM9\aP7H[^O)^6I#v k-_aövZx-Y'@kS&,Y\7n`1: HIڭyx._hټIAU#U'30yڂϨ_QR+$M(őiJH:O&,@ 3<LaSaqxa1 L|Wzq^Y,tW+z/ؒ8x.y(J俈Dx7Sjj~L/Gf~P}(cC!&29)oVx}qr buRJ"\lїHAZ/r)GϦ+d.P1U.Q*4Ċ 'l&5]%2vV۴1+ Fo&>(>S-Y2 )$yJ!}NcmٲR6e/I#8W.qHbMpu<O5ASqxM] t/M355|?DT#-ѝXm׺&_?go+ȭV֋9cCt:MM^W]h`ڮ?x6+ʮu.xo>zm_}zGN}q_m& 6he6?MO6bnRvU[`@H#W;i"'zN0vǖSȒ,'(Nؓz^tܚb.4T~УۓoOcjFRRWއ?sI4sl>q,yj~٥:/.k֥O_6HݿSUI(\Pɰ?H*KlxWo.ص=z4HiJj haUZ@JxuU\ &6^`;ͽFF@ < 磨^OUq@00E$MKRo߉ Leܺ"iQJB9g㻙B抬Nn~:GZj&9ċ*Ui 0rBup~2ج/[j$MN|l5t^ bHd Z7,.XHװvtI })L|U u>cRk3$n` WU}@SoP6?ЏN뙶੪#o!dMwH2'ШEg`d}aѓ~%gTv_ő8܁^nֻ7"T^QdVEsj%ˤ2*so\]d9:|nتQ6?/\vkek,Sƅy]lkmdE#~ O^#NJ}Oll?MU U%\[)*RJjKRY H(vbQeԌGn5yhȻk2@|6<Ud `y\$.7 ǏgKlgjnF6n3{g55|6KS C4ts0>( FSi@| 8N2Yp+#>}2rR0f8"HP,pA$On}ɴOLN*4Ʈ|S[2ZE ~՛9o&%$THxPdL$8,KD)uHʲT6x:Uz8W/4tϕe CSJYU,66{<=dzq"Nt8 [_o5sS,*F̺X)rroɎ 5*R6qZdV@g\Y;rFkϢƬtTRbe5\*hif$LK5) ::IE=zc2;zc6nިe7 S>k6W*SQ4LJ>of/wȍIpΡ|ؿ4 קnaKr(cA?n=iӣNϔQJ!4[,O:IA6zh-ESf!}7tfjk&I)(<&l!*-41m]HAOC)yWҀoqvA),Nc7'A^P'q_O0yd55Ud 5R9@ +AmuPƜk)wҘ:#9:[mv|ݙ۸ V8icnV DQV:eAyQi6ZkZYcna2>&>ФF<]cE M=d&jI*; U?DE 8@{ϛxSԸѺf* <1d*DsOr)±%Bȋ*ǹٳþMm)Pǎ{e| o̖q5k-kx< n56?@O{KFgzۢ:)YI4%TJQ#2K(N\O$4R:x!b :>ͷw@D'j𼚧N LEym^7 W!hqi! {q ~8ISE )ꢉUjK9+:*WU`9d[pHA!ҚN(sk 3VӹmNzBPj)qP^"sTUː*u#d@le(5j1&𴻈W*hu,qF/&oԼjPkAE!A-oiliF&p#8i$ǡ12Pg7"Ty QA(&zϋ]s6Eh+(1Z xd<\xG$.BG-qno@"V*ցBժhuP`#9+판9Vxc6QTb[w[wٯc2FIAGOaԤ7,3pN䚂*k$)ɴ`r2ddt7: ]?%a\xJ6ͷUBt\֞J%Ubo$z ynwV—{ !ARؙCO)ˏ)ZC+" =b7V^ FV 4} fwK܅9?KಱePZ[Gl?LE+5>BlRH,#G[KrMTf]Jf!!(M\Ǯ B:Zdmk%>:"v~/œ:.ܬEK0$PZ>^]?Ic%ѵʸ/sarfwfgMɌjUJQVSe"ʧCT.;R⿹YA=$=; FS諊B" X}‘-n=Js[HM\0#>/s4d]--cT#/D$3F@70<#}~`0}۽Uջk=/ &ZjU` QFA6<$JԚ^aiAκzO~>/˜puAg𪮒qj~|E#->1>mlP@I/1HDz${7RSoS$?WY&A.9HA%<0e)X}ė>d5f$$ cM; yu)^շӦc1Ҷ%B H@,vmc͵jVUmߥ(tD{ةwCncS¼(iƣ I[DKQuE i b)x\r(tufVGOPfa\X]Ҧ7u3A)Z*zzm*+h+d (Kɸ e T+.ud]Qi/~xe5rt8eTIL+-[, 9KtsK* id\(>l}ޘ+hCWiW'!>pTOjcΦRIGY>*ebyio!G @ ,1G QJ9χG{5h Y uj17pK5-C_,[S;[FEZ,WsObQcj*H ,Hٚa{g Ԯ6E8 7>e[sDS5UM;|cJwd61R"")-  CJOlroܴe(UiD(d6> "WcsK;55OjE-\+]Ʊq7oYF2jS8="JH25Gy<٤}3;q{6gjLRBH#Ś/x42 oCX-9!|pF> znX^Бr=2|GLKPLlGcIz㮥jjCsǩ st,Y_9z79*ZB까ja,'dH5 Z0~"ܽ;n`mgD-X  ‚u3Ѹ#MWxi8r!!oXAfoѰr/VRTV*z|tꞪ5WJo%y_i<1YVB@ƾ_niEiiq8xӹ{QK}Wׯe8:_O--eDi,4.a9XGSWO6wm NsȤ/Q)%1Wa3$ʟT($c'O+f4Z>].ylZZnHR*=\5@ZV5=oh3l)\D5TjTdìJO2YU_uc-s<~ZO"vRUfTDJd%T9vkժF~ϣli}RJe$.~!QƧ݈cԴjj\tq'KLp^{vAVeuc^5(h#j'EYbo,N\Z4w$m2&+P i4`~ ?W|?ƴpVIW+A)x8Y~*)k驩53MQ,QG (eKݓmOj*A]=.C $ #BFq; 3jbUAr%Ņ_GIe?TzrG4q~PHALS:_*UT0aMLI,Z` UOߝkʪWf'>&HQj)iQ{[f. ;iGn9F^֡Q1\u+vv8ݛ:J$+QV l:0$yuC?WG[" R#Lj$3V@\ڞb$)Y< KKilzT~{iAqZT@eܑ \܅ge|: GMK5^y2RL4_LDaX#~ZN&aOB-OT╧u5s'd=i#E\i`lIbu/%CWRQ^yhᦛ%NM!iդ"7$.159io.)(gZs -#S)Z\on4_D*uce}sROXiűc!Rw кR>:TQQR¬)frI[έ&k|BٻO,R|3b"?uMU"IE $3DGBR@/e<rĖB-!!Z[sIF0eQT:r j Tҽwk/(x4p"5\PGU0wK$!)RXZfPG E 8qrDGmYIgW+$(~G!VXR6աѫ5R2ǹ!%L)6Q@-CL8?^GLV*!eM>.i6U|nc||l<2jvHfw][Z4N%M? 'z1_v!5RuSf؛r\8ʼnO=4 7;C[EPt 6Qϱf/+7LQw&3w3&i'H>ݮT4V{cam].wer\<(B.H#J͆ML!9W$5 Ə{?aǔ賵hrեDrլE ArK 6m2Ev-<{T׊H y"0*Fj?Sm5B /ONITQ^A`Zqyx.6bfCaol55>î>LɉMA$->W%xW*Hu*no)Aں2M)}D۪n4XIK v {[ot>A1 fuZٙJiK%W9 eoy<g٭MU]Q+(禛lLjd*FVJp ?~ބYkY(1\0 3N<o7-u^ chɐ21qƠZfdVֺN$1ȫkpĆJu>Xi"O'jtWc{rQr[G}j9+OS2c ̑,WH $g{oݽٿ(w")c]&{e *.J yc$Sbvf(-ljukTOEĮF:q\5>pwx ˚yjR)j)1" Ȃ5*񾎛+;#YVM6[ է$j + aX>W4j$vFQ c! UCV QTo$wpUj6O Lfd NQPlhevĹ\Ngvn*lYC5)IQM( b:8x%,l]wKK;X+ψjȨtN S9&kb O^꨾T]Ot{jn q,.lדg\nٖO2:T-V` 4@fm>a}sT$6VŋҺ9* >AvYʢm6 T6^LlCh^)r;4YJuجdxUjw1;tcSSlU>=43%lmJBw+r` N=.N j *c,zʓDtt+w nЃWgnܞ*_ I#*!#S]:k)⧘`]S+\~Nēn**7m袅8 q,9jIgpl|3FOKKjQSsPqn&rc F*($m-̮5‰ʠRY_3]UJxSٵ2~'n7$d;$Yv-fǟ(S& ݕˋ&^.#GuyZ8ncTCW/5fۖ"mɥ*jcP G@-:1UkP<, owWnǒ=_0 P~6cT=S:j1:b.I{?kqQg#b QT}24CtpRʊ6ݮl[G*̬UUTAxjӏ=hj!8Z_Gz\Tx*bSf`vC_ZiZ+t8Xc1/횓ɉ/C %aqY +_KGMMH2FN'Y0 R+^:ZB+±DM, (EcV%ap&CO4Aj|WyZݳ)'ws'Ҋ;_UYRӇjdye ZMm2 mYqJ6\=d5 QTddI f!T6m-lY"Q+VCHɨqA]euE$}]5oznWg6FU{=} >7lvURj"ZqB.Y%Vd:rxNȳRx 4jx1J YK!ee8+2RRO:(:2:Ekm JvB銪h&}2R1piu]ó댒nhj֪8G>9d4RTxb.5+6wMoctBN W-GP+02BBq\OG';͉O=6͛-GFmOO,G%˕2g)EENSJm1 'wZ3]dZj~>:];ѳ!SreVֳCMqvhQu2qIjdtv;F3+;n|&<\sfqtW4pP ,zt!*;_l|ojyͬ2:uA!4I*ڎ$ӧVoQs$lguuM#2e* u?iMX zy)Л6^wqm=۸ݛW54]MS\NJvjJij*e8EkWCi398|kQUۛvD#1"*許ܟ`ۛMKd 6aZ#+ Q䪪ڗ`̢nW*,U梨zue0XlVӭP<ǶP]ҵV[Աn ⷕNPAGrzHR&6`]KK.4Ҩ--$A$r[Ed^ūSW:Sj#\Na`'E & OQjj*O? Djje$S{T8@r> @QN+1񕂮#"S'a _&Edi%~>xJt;(`c_So}%C(X[꺹(M]r5n=9*ޖ9e .R_(j4YUuBQZqIW=tzQH]T܋ -i`̳K'~u(:|Ր NFG&/ǮՎdj6a;buYqhTy&EcxAR}6c'd)vuT|/jfIJJ${tV/m*ƀX5,WJLёP8׉hcJy?)ܛ; ikjx!u/GO;bo d,VVi(+)C9^E GBٷk^`$f3&(cWSSF ")b_ fEXgv[+U:&1T%xoEFkb\"C:i.gs[[!1W wmN䮞1ԨQ$5RYFR5QRS|v5-f\N|Em&\NݖrOQT" $&6 eQFm8Λfm=ĝ?hHz0&HC4.2U53chqt8x2aj*bbSP!}%枒LdxMosR̙X[R|QI]iAZn7 EիS]. $en]=!eY5ұJUăNz&)+k3g42Ξc6?KQ5a KGOEM!%M*v"*5DUF,Q(3@$f#k $ofHy7XTUYv1"wj9R? O+C/#DOic.L'R&Jԟł56%܃5)3y񭕡[W-ɍ*,k,t[+E+N*dS޿ήڎZFcc/z߸t;eb3x֡Pv>ӏ9*"/`$Ewb4 s{:$SijFըۦ:s=s>)a؀\lL[Rcl'_ƀ?:O5gG.ħ> ZfFASHR+37ktB*.2GwcZ [V3[=>bXU&7 K`Convev%Geo7^o9!jFZ5JR84Ṱ$Bqo}x&1”SƩLTRBlxq]yjP'^X PH~hԪ@8jßO_mo,lrɯ\F׽{[Gn3,&\Tjt+K2-]Ks\6vveI␫~< /?N\_-eɨcܼ[N}k-<3½þprnPMy _8WDVV<_#ڛ s8_EbV:}8c!<)y#1b7"$_Z.ݰOFL` Idl仚@zl_oSn@G é<'j7e|wgO*w͐#s'Jrt+e{ ڸe1G===]F; %S q#PuB KacɼnDM}b Fo?NRkW2(A$z:ɫƱx֗'HiIf?]<^#ޭۻz;K#V⨇taICP{0r_@4`.,M1[3MJx t4ע怴 4w(f >CTlO5{koiap٪tz ݵ۵XyĂ* *)KF(^C\SI_GOlUM8Z L 528Q j#1sѼe\]JuUk뫣KՇ:SSԙ :#A9Z](O>ǟզl=EAjJY"Ԥ{ݗ<3N !wc4%ݷՎF G9T6^siSge6Bq࿏yhCccIЉ)7DPiRϊf\tHGvFUS Id$K;25<,+)NHz_˓]% )fJH<2Sn:);-*+-~'SFJvqUL8ťxP02O[9WA"EeE vfS3\K2^mqq)Ief\OqJc“{ИI%N'?V,5X0KK)`Uc^5$d<+±[I@dlG2kB͂rK.Aq3ژբe\U8[d5E`H&0H*o?ױ9]RplYlN".!BII_f'fdb Fݮ9SJz]×CT&-Ld i5HU[ !gPW캁fopqQw9-·"I7mm(t:@U#SShom}U"WW u %& trʀ rDcF [=V+QMMFW䌑MJ)t%wg,O)Q5, Ǵ'2U U @+OA7K{Gc MUNWB]~ߛϳ{6㲔y9?CUWDW׫XƔ±ncmNrxU",pTcȂ 1~>wdLΑP|'ӡRfbɗʣ֙ǟզ(Sa(%b,6g }?Ma݁׷⤎!Vd!6+RM+ QBخ}>k/ǰ2UӃKZ_UBբPuTq~RaݻzS S=\X)+15x,AIKM?f{1]2ul:Rei`޻^Rz +K!$@uӘv)RB' , t Pq ^lvC%K .K惁ꪎF!ȶcgg(7SMrXu,6JjHiಫ ;#vK7;phux80i̿yyX1&u~Xe6'bu$a&D3ƚqCê6Yj'µS+:zj-꽻.+p49 29I6ME[嘧!캾1*w=vsZ,bD*#r=mh۫X`6LI??KdI`bc۫-^s;&ꉰiUfJ,nZ/h̯偤ʫ')'E6( !* l>S3 Ȳ׺8vzJAq⤩%4V588?I x{SP~ޟ͵{ES7i,J|.nh-¼tA*#C2bc_MeH2r%$ޥ!3ĩ7>DPAs78w:xհ[Wh^ꞑ÷)61b45᎙;2X9w{wcv.h$M/9 JfJă{h]aI|1d<9JG:&bZX/hOd'_ ͛7,* Ej%$=  6& <1/ "?T cjFO z:f:)cpj6( M_[x2Q壯j$Jw==E֮:V[ri$׎t1]F |:E@>+ubfJX<}$UT"B,3%X"I*FVU`A#eT/]bF˪U<-l#MM2龠.8ٽ֛O>TfzrӽK5 O*];aI=;b)70`Iċ6ӼXnvLf77 xچC4JPbc`x?>l;9nwen&y8-O}Y nN@0H??RRRHq}ߘ*C_-{O(Y5ar,iSdlT&i#:D{IKe'U)*iTzVV1|C:co8Oxp۳G8ܠ.e pdidXي_Bkfٮ|R)Džޚ0{~- 8t]kOduH ?S'zSDٙ5㉊fhuepRhyV;ҁ~Z7S' UM8ڌyuʞGAfС$ n|65Mi(SS樫h#QsU, S9h duրIjԍ_^㦕OjOkˮ @`؏QΥ>a2{5aEdS9iUPCSWYJ{Kw6̖&ktS;5"8و{i]^W\u 8V*}@O`A˺}Q_^n^Pɳ*2U’kSe4HZ'6*#-<`}gTb}oϥn k}p驠`#b%]Q,mp]Pa;bY9#z:LeCTB;yTob4v.#ʖO!B[kuG3_y(JubE~gczhEҘj~U.`В <ݻ($B#;wy=1~@qbo{82{J'CCf8b YG!!fU,j6DIY/s)QMIE>~}X Z,In0SA#Αo:~ ijh-N˼V4eiIfZZzIjMLd3JK˷voޥ455Zyeh\ q+5'uBI؝/e{lVIq B \h/4r7USX<=&ͪTTy(uIY]9S]#WwLc0T1:`X*1 j X`$ ڏwpݓj$3#1E:EKM&jROX*̱C3C$ey>nﺕxP&TSY8#g ~zi2FIckn%0O2UrB\-{#dݶJϸlf!cQ)S*xirkzDc`UuqbYKc]>w%Q8>mMӶ{#5֝biLV%X\rO'OG1xVQUDA uZGTf,\K"F./uT71&d%^ɻO!:?fcLN=<}۞|vS+yenbZ,,)8hxE)FAM#7cqmPU~0:"OLUoǩXj4E ƵH kcR=kלj[]Ai ,؏foή);u(7֥7㬂)M EHQޣjn:{86G%%}cB}t?^\xItCGYOMUPSTx5,tQ葪K~=ǽǻ~;QPRTᅦcSU3&#Ki/+ ,'l Ch{)xpԮ2r?oz%P} xURxx>rz &,F䖒F*J9LtSP qV?$39md 5:1@(xT޽i\pknBKQ[XOII5H3,5@.~b;W9MCTvf0WT)**yĶ[*a{}D*r_Kռϟi*$48S11BIZcM(+*1ڍ+6Ϸ-Ԉ|!Qjk_5ITÍ$}8`6sVMWfvКjAIK[hD]VjZb&Fk[meiU{|SOF_WlVEHȥ>TWˬ ΅KjޮlB|=ݍh;1 K"V;zTJj *6vKD㮌> iI$ mv:̃w!'Z h7gn* m h~ReXIdԲKDjԩs`m} }Rϩyq=n+j??gZ^RMMЏlݚ A+r2grTpc$ʚedI*@rp=Ǜ1V2($)ѼQ܆(AW>U1,qb:Zygޥ0M #;܋~-SnUnQTzVwy ּRJd A&7M#U1Y$D">kAJPT :7zY~Ol&|͛Ѣ3nMWV[Hhr^A;ñ~/斺33Kk>UebxDy(U< $:[͍Rۖ>09Z򆕡%9pZWKԽ؝ٴyz*|=VB(Dt6V2i`9&{3TqG}Sr=i1t54rhQԴH\}({}S0I>:1&5>Zgү{ ɜS҃/V*"HzWwmPx?K2XMÛJ碓 O*]ZVEi5Ij: ܭe]Z-)4hˠ[$ӌ35+(`eH ( ?؏kdu~ФUnWPw=\9]ɑ:jncDV=^ i۷Kq=R|DxOd},OS W+<)ЎT.n`vGsM=QQ3L=RvDnjwsp@ppH}s(H.Š_$I$7?R8O`; fڕ;M$uIfO)e!mr6ۺwTb|AJi]]oiHj!2<#! ;*{s4qɚRf@Z;Ҷ*$55tz9KXe_!eᔹ*A^X`҇퓁'~΋y5'D!u N^Ov4XDCNbzI"Ae!Ah lS~Ֆ0N¼>_/.tkK 2`8o 8T58)h֭঒hRD_ 9 |\pOF7gT›Kh;/=|-C`y"<~6,K+xwq楆{}BѩC„'ڮ7Y=v2IIZ2QVҵ'L[lݣ&j|s0 <\0¼ #QG_2;6bYMqpի㍇*ꓻk͊7j6pem[YO+6*ĒF$i/Q݉қC|O2,msKXӽĒ<@9֛֤fLBRs<^+NF2ՇZa?;uKPjBpSF"GZnX,OԖݯefCL:JU S%,SdC3KNeֱL" Ƃӳ W ׁ#,V$rSA?P-uP+A$qߑ~I?fP~0*>F>N]G9 Q'I'%uN<~?"(nٚ5sW$$Tu2Gqu\pknwi**U~(ڡht@|IKD\68: C:ϩ2ƠC!FAP 9a{?ka{ov;55rSPA)bl$NLxiW#әeShEG%֌)BT^^ۦr6RjVȊVp4:.4o.:.3t:%E0;K$ {w/Rg[$*rKGfh(@,,QHd7emojԠTiPCPrS_,sfϾ,H c/^$cZt=2eybR'W$z-VIX;'#OU[2EO UE|hjW$K+M ۀ;]J>*WGj}J'X?/ӫ kreޫ)Gy]fm0WKm6]:s-< +Fl6@p{P|3zZ˾l!* Ӏ8hacgA*e#DHT3SyIR"G, l-Ԕug.<܋:H %\pJI "SooXUČGr9!Qks:e)Ji zULXP%5lbG w/Vf4uy \ѴƖ2x!ɳ*TBLI(߈=S *%RZKj8r0m[jʈկ^+J4/jj:,BHXPX6u;Hg>RHO_*g$5ϊIBŭr3LP?Яs+jUʦ.Q㬲 qcb_ζlשX QǑJDC#E=boQEe+{9! O,ێҽFnV1C<m!IySPnd5(twQy--0 .@u/ʬ^w. =gY&LU!WX*$j6%q.شl֬Atξ] j}Kd PU@hMQԻU=K]gvOm䶦2oO0EH!t4:^]Ɵ[+#UWXdx3G>p#29i{&%̔ҴWV&עWd4 U?HM*2MAA|Sڽ!9õ ^"JCD"ifCJY&<{j[9E[ T, Ffq DmR}y!BhωP[BTw8˩1"R3aaJ.Au 7'bKh{=$}Bk=qu%c?0lPcwHF)"l*$BI^aq}:?ZW &8(:hq|DYos{Gqj頓)7{ƒՊfn$WP>ڊ_NJ=9h!PLH<Z?x*M [iBiQB>#K [p1E!h a~4=]._ fm&>$ɊE\9J x^2lHc{Zd#x׀P[4Oo̓+w*MhG*3J\pZ`)g!qt,Î)G7ݨۑe8ږ-h&2=DU '#NXI)ss\5EEB2ȬE_PϨlSǿ^Y\˭ՖG4SKyP=cП{L3S)VlsS̑@ܬ6RlkMid%zYCǛOoqΒFrFYv܅bWO<)'ԐIT쬒|P05C\@<3x#=-a7s6Pb #ASU458sGR]ŵ&5ǽDEz㸬ʕo'/u4qSC\Zyr};3oKd\mdiL*"u>G"G7ݽ?6O]7%QRː5L|S4^)j uwyQ Uj #JϧovҖ\FHF'T0U#CN읽'h+mhf5xH*YB#fX؄n F¸oYQ5?ve44UXUt 5ɷ 1ΎlH:sAig'i Ǧdg) = p~*)iq()j4%],JgVbR^O^Nm:_kZxg Q+޸$m?X~ّ۲/4[o.㚗1 5tiXN-0F`^:XH.vWz:/Ϡ숖щv$N5kd f0U)K3hi5U@ k>~GӪev&ӥa2[ƫ84`\z|~(j-YQ O5(d))4+{%lͽ7Fo=]օ{"T3"`em$b*躡]L +9d4^iV^M.٩II>([ʼnZDeif@ 0G{TSмy 4[{l}ͦ)DTG,c05{f|aK{Z=+w7oϷ7_^I<PIsp0mȽQJEq$U5r$ԁir )~ݛU3xn/7U^ǚ &O38~ X8mn4"ytTjLJz+q(4P2U_aIvm尻le2i9Lↆhn4b((:NY4RzVsQhvn4ڙ=e]ޒʋ>> O<> >"hDa_e#3x;hÂEeiJT|zZH49ihkq5Š;yw&QOK[6:$$K$)$Y=Wq3 Rdw5v=htӶr(sd撯'<ЈY)V,+o6H KS9iIT]G^ez|mFlFo#_b_Q]YSRJ cZ%GD73Tn$7j0QzogMnbnv,WrT Ÿg|x^(wn6+;liLq(%S<*7M%5Ufٻ&x20Z#X4eIhͨ.KQ>IJꦕ Wʪ=n%x"!gȱ|uFQ˸syg..2hJ3lSxG+;n|v%lW@; 19j kU[T)1_}G]DiPO߆h"72}-bRƋMjaJF/+*=zAoɔ"fku8_R8tV(efS42!t?F}&5r-4p#3L%L1$/HC4SN(#O7?K-ʭĎdDX3wBƀ32i=[Dqv*b|z+=; VG1 ؜?skZͽeF,mf'Xe.~| ܙblQ} NUj`%Y Yx6Sq1K,42?QX讲v+RrI::#'=u)[Rl|)E娷ӣ$)QJ$fXe2CPJ9m& Uqdk75~X:zqWAcK-DT ὣ.wvh@r[^t9BPv0Mz3j.tZH?*q|:.qܯȝ[{9CBLu _>֣È+2-.JT|$ޱwF6<,\SoɖJ-YSG>[~0ROXsђfӫ6tjp]ݰB۩lRU,41=ǫ3O^XRdr:ڼEE/!-H:Ʋ! 뢫IWWƍ&oy1#E"c\1dX4j F{ӧU2A5ğ/z44K`G) l4ۗf *%ŵ~wjNj :KLgKK=̆#P "fB`,9Ө#OUK[v᪳Choh+5C"yuJ\h\F wY zuQ۳Ƨ-]htDʤo$I#LmU.- ol4DQ 04cjh'gnLŠl0u9݉ژ4X6aLܕ.~DZP+JK %hfv}a&Sv○gU9NGghq&GVRk97}λLZ{iKuJ,r3fҺI=R'oH . /xv_GO^_3S`4{?`2zFn*׶cnCZtxLzZٛ6Ij|1RTv"ln7eyeH{ e;VJ:D"i5~3b0YI5On8M͇h>rO,xZ7Ћ}jX\?6onFYj.s644xo+}D@ϊa5AUVO#BڸVG)7OXPmxz\?ő۫=^W(;K[QSI,d#"E, \]vn73 hha|CQo9LNIK%lEN{p۷{E{$Om%Vt}5M~L\4M3h8 qr+90֙ 0|ܖbvD%)NiMbڡb{y@o,{n`\u5X ¹CFjE;dm1`_g_"EW&VK|&Շ˪ϛ=2z]W2\؝ b-Q2#e[m윖LJOBh6"Sh NFRZ5:u*H]-@(Dr0%|ETq_RO#Q d4ȩtzܝ= '7I.૥U-5NC:5M)+`V 3 .mٹԏ03Օ67AoB;CBj\Is2$HWP*Zxǝ!t}@\`)Zn/QgU-@j0U*2LWHX*+ܛ/50YsQ co]3q婩Vq hΔ'RYC3XXlVvmR x}upҤq jF3|]X悐TNjUMNf"TR`ڴe2s*f5;ѭ ]vX׈bBӉ%dS[*YH7׶u ;a`hTcU:Ac\fI!Ra5p~ME5`/CF[Xfji>=[98[ST|P!2ixUb}]GXab F9VwT!>+p4[vfBXpt+סd*FJh$>ǣSU|\2SM j"X’}&} t`pv쩖|>U섦Zi+jk6ar\qfַpK]\;9_SVbv{h_r*Y8aӫȎ9la#\E!&H֧n?z`UUoZȩ(z*jR*zzY*̨R꾝"<ڶK̓kȕbAKMb@EW* (EOH.x"e8Zz)k)j44SKQ$jLCk5ǻ 辪ƦEQB#9FxWil1`[VTÅS< QQ❘}ńʺn ^nOmP(u8(9at{]lVyPԢ:pƜ*8qF.G:IQK&;+ =6FzsOAXҮ,n AIu&n|'Rd_ԬVQDaVaA/H *-X^7/&M'EҥH5vEBJ* Z :Hǧw]o<׆[Cqaq`@kI 8Ѣ2,Le}Ou7$k6nT1"GY 5Uա*.lMrVǙ٭VilH k"+ O<ˈ_=>{i`xۂx&J O\xH4qx&W.ٮcsfQ:C +MPԏ_ȢO>2Y.XP|/Cp bj#A# 5ZiMS2$nx]@ ⶮc5&94MqUJ& 6B\lF$/`6$خ.U/ߏRSң5~Y]E<3Q]*_妽㣤̈hI6 i`0K3?I>]iΑbꥊ Pɑ\R4T|84G9)D] , X.o%NkGE<Һ"?V ;I?Jj+*fWYk Z]$Up=+bn<eƝ66_a_o 6;etY5鑍Z$`Ђ{UkZ>?tdfwvכm .v2F^)hjPYt-rbǶN=2UR*HDX੓DIP WP.,Aco`^KF)jeNj ;>UpZG;HN-5+UjVS `Ksv :_Ђc0؍LwuFc(d7&# jQ JVWBC׸m+Е;j huNT懤5xcM\JupPTq|50멫uigୗk1~QsQwв"I?.TZGg%!pfoڻn0_O:(jIU[-4n=_A;6Fg0qUC?PZ|yt=$?/E3kUrDAst6ݩm-iiG5T]YRc5f<q"rlsBG iGVɦUFiB(@|C%NSP|q Cy)G\` G&*dj=V"y墜hdY]X(xgL~⚎.A45QcdD*8e DN;8_cضd ; q$,RhmB 7Z,iF۵{KD\PTtsfi=<)M2~1apG } Cd F;#mЗ(s(*}-}B[ݜKȸ%Ffei\0:d4!R P?ֽ$rۊД9?E%QP)ZzTof*S3FVPf|fdj3E5^X*iQźK ෨i t^pqwjVW2ZI {{+)wUQ}YLQM4d[Pʩ%oo$O!vi^tm qe*=,HJIs x?=704=]o+Gl ~5q#X~8Vϰ.ykilт%TIoɮqtca#RA>RȉP~0N{qom8\Vڔ4ջ[m7:]Yn):ju YdЮnmwhSuY?:}U+t)>gI!hDRHM?Bs`Ofv^8ϨV? W6\SU[QEKd*֎J GV7xr}T1[SjǰEۻoJdO? ,5& AEUv^6"4E_&=M$qg?>(X $݉ffv,Ė?}?{'q!_vnLz*lmjsThҕгSuD1s) {UC|$MLm8j)ֱj3:pHJ|o1`v?.~Z uه;Q}li6KuZe'yfZ+qoi2竣cQFy%.Eǿ@صЃD(Af WP(BdeN;G?ҟ+l+QK_WEI(:JiD(!#T:_fqٟ6}Ib^Em\mQA#>H,v`w$Gf٩ٿR)U^[$isI}ֻm%v'FrOQfj5qH2zǂ{Dc(6" _~ޕu9 v. jjv#*ĊO6 ܖ. |Rx{;6'9YbrURfMøq^܄:"6KE| {=Иw"~"x`iҼ~=O.[h+jc2jO%8,Qhb,X11` ۓof#iPUzx8c"CҬ- Ohv-tkaaY3_3ZkZPWN̪\x~CM|DMg+.#QPƠi$ʭ4e09eݝ.ܴ-[)'X%}&C,!kh%Tffi[!n~ o" IxiGPF@5L'rO OϤԝnW|a7}ܴu^6hǐm+^? D.[1~f{;Q9vsO]^CMVf䥪)" dnG#+ >@k r)oh~/ˡID"E"_Gog[e-/*1ϋ}wBvpe`zRUQO)cJ4wp$޷x69<ʴV&` Cl&^u~}lvKsᶝ2ӭ v/+j IDyd&ե]B٢Zwpnѹ(13LG="JQBā E&ͪ0 on]~1*)N  :4澟ch+vW`3܎J>!=E& S8~ʱ2|o|vb7kC<^^c]U$,SWiv#=ߗR@0}XNxӏ=H7$LhϏлgvvVwhfҽ:eh䎝,&tݛ\[*`r5}V+2[]QFx!fb*3u`oqnE1ڙGºQW] 6{`ub!ЀC opnln;7gw;6k!ZZi)zrr)jX2`2;S[]oG߭$Zoռ:-|45OQy^D$P7. `Vhٛ+Vi1TTVUڷWJY20+UQ!fQa@y۠Uq5hpWgk܁*3n=ǿ7N:VpT k9CXi6=T+Td$xJzro׶[ۉyxOS഑ ̃^?fLy =;*V*hL o U'`grTPml]vZ'+()YieJby k v!{yԣ*XR?& &T!3-HU/=\OϹirXǩW,rS_]~VO*DLQ&M:SلxKp#wSqbkTbd(ɹ6uUvgm&ؚۺk"Lv7#jr:”2OW5CM,k o>c- Pq@ +WLۃ=XfcayfX'5SHFb~b?x|o> SHEQ&w|a־kuZ&KE*t3ԙEk2M9{pq2<2ʃO=\7 >ޢ`qµ4u%T0zjk'">'FZxgVƭq{O{_mnC72U =L&,[O˳>ލMkEf-y6[EdBϦz֏$#?D @0.IMQSK8,*)\_5}y!]c(a?;v3WPIb e%`i1RJ xY\3'[d=OmBH=Žk=+_e2oԈi>B%UQ( =@i[r^BOh7& Tg?\uT^C9C<Δ(KyaX?4olAѴe#{e /O5i |0zֺ^F]GRkocfX()ivlM/) ”J 3KM/k{rrΟpKŕ ~_zRvEW!CԹyHğBJzoGYV%^73^*䮡ŌQ֐ɢVeu<9ojwuҡ|B)COoC_?1ҁ~JI}C"%݉54RTLꍅ^*,44Tjy)+i-Vʪۦ ^* ]]$rg3,qX5a5_駞<:uے5r@[ X}CdM^KffrUUniIjp㲨Nߵ0)-{lWv,5u?8tż,^P5O>MjeU8^CuL!Od^ +,]f&\wqO| %ITTU5uFX(ڥ-#}c:+M1X1νޜ8u "-2m鐤jCۘ/,C0sKFb>8&ѧ5Xvm`*E_XN %{j8tsa*4Z% ̀?1OOLP(rjVm#zU2XxDx;=q#qHAY#yWS.K \frFi˦窆?2='wqX1>1l51W"s`6{y^ ]{˹ pNW(a+EM&TO#k>؋GNhοHT!_F҉3-\(i\p-:ܻ{pTo&&m\6ͲuV.G; uT1>> %>N:ڥ]pʯ=5Z2x7m$@~ OZx[H5vkӯos6RsEHw+ YI"UJTb [UTHk-Gj1NjDtt Lj0*$DdmFbi4bo/ycAba]7h1U~FW! s9F8I!-\(r$ FK+r2͒HhjeR\c+62FnHWx@]H8 %cǡCK8Yb6m?HRC "̀X,n?~}SԤUOEM*TSp4dqC"M4!B1BSq";{v|:CZxN„;)\  N "5> n?Um3? \Sm:\V2AAf>M,YgxQGTخf䚅Dx^DvjkГ}/:PQPmM$Z7d9 13נ,j(Rs/)Qf& s Rgv~a͐SG3!2d+ucQ$Q"QoeWF2rTἳ@ZW*øZ3ʄ:BIjJU ,lTnG<\{~1fWagI9YZ^g)S'-#1,n}yzHiYR6^-_@jڗUԚahj>Z p UGAou]顭к%48C*T5I`ʜf% Խe+vaPcj4MCSBlQ^vBcNZ^%aRj08wIS}]UXRUUlPkڡ p:Wm ύPG=dsG PճTFxE_,/QW4rRhfjT<%i9Dqjի<(A׷ +RV@~J p8`-C,GA?ޭz.}\RQZg94's$#qb}6ǎMI( c>nM U 93AOz&=Еvcla*=yz1JuvgiY/T02{ؕ鲒^M%3Qc%LN ~bAaART` @|PU1]J-! (*XUE~"Gw Pz2W^b:pMO$ #2]6n4˽6f1Y9gc#Ir |VY)e|UbAE X*DܱB1:{XҾDg#Ozx&FvV͸0$= 1$HHFK57b<)i*<0TP =bA+4Fq-gy$Iicc Tv ߄WC ZhBO&AbO*2(+`j9/C28`at['(sf1d+剂TSJ'0u0/-JW.3Zi.<2 4J 35-JTu'bΙݯ,U_ tTO[$L7˧ zfe7MVԠz2;JXrL ;ce6EDz7-ڭ:Y~f _*|ow$*DS9]`q)76a0X\TOxa sQR:/ A>/r;mɆ>"*&Vl Tf"STƐUMWerLjɸiD!&rB4z7(chpS0 ; c'D8*)AK-v^I2*eBK:}W#6˲EYnWLZI.& [GkΚq֮5gcRk4}ݿG|Zm޺bhqxf تʶy&-TTLLkY]_{-{aL5=l>ިFPb3FHQ#h{ m[[?VgEVC/MKsMYΞY^ߖ1D`cWܫ3f1;`lȫm.I 03VRR3J󨾠'E*\s`|A]W,SϏmu SPQ;7IlezeUP! "D΂$=v~XnJ C@Ejh8`}u7>oeݛm)24*aQP@$H%``*zr1P<8ߎͶռhkQBn=f fԫ~`S =Iv;kլ GedŅtomd#OABN߭AP^TҥH l[-#]U 6b'5f.@A)-rͧO?:x#=nՎF M9 X*#Ma챶3y**WQ%%SD5tio *騜UF/$6؏tbQT*Rx0'#]spFBUEYA~h-R|̘H0ea j@QU5IF2H RI a30\ɬ_ېoE**>kZя>4fYMhnn;h5:ZsZޛت< EtbJydp JWTrFC+첛~ wmKS&F uOGhzM85֫HWPu|QͶZ!2, $QVr*L7Wl,EV7an (!\Ǔ9,IztNV$sQK=F,h<lUUudUR4"WOj9@#I0ogY*&V!5z./ewwC*ʲkAROq4m}׷4 }a*uZ@ +G{cu>uR ef' M*ҬF5 b2e&? ~gKUP!Bd ҽ U6pk@HfrijjHb*,8ɦEdU,F27MO{-O\f3_SQǖŽ sDVC-MWEjz)fHM)RǻZ$FA:9JaGjJw"i4h"B\0$_QkIQ)%GQH{j+s#`# 8'zcOEZ Io͛v6Ƕϡ,Zmg5ӊ mZ3~+.[jڢ =ϛqf`NEh)@%Ply]7iLCۤO-u=v*%S3aMZa =;j}Joslz#CpMj>Ưu.~k(Z_V҇bxWiHx?N˨2j,} SWmzx`kMemGȏ_&dzHC4@ֲTmdPjԯimͻl{פ:4xkTWzMCL91>Hd>!,bR6[sskkmQ|wumdI!hZjzZ|bXgCw*-AT ($2H1H<}M)PTa5aT]bt(rTXCWYU?oyJ=_*r,Qqe09Ty(dⲒh5 WVu E,3X俸 Z.h"jE򍠐J5Ҳ:iĮׇWDS դHh_ٿؘ#fn]Ec9rg俇-^/cWE *Emrdpi_(AvM-2@I53S9/UY]9ZyN5CRAS͈gͥ)! Ybp :H֫O%u1C’3ӻ,,Tg bS\:OW]ͼ\EK6ɀ95#劎익IpV@ s3G3J+$F1Tj XFV|yl= SKi3E%:SK,reڅ[^@A5o"SSTQUrZ xzӢ w{ő%]@>ګsEK3dq5T}Xt֨SM_(l@ bHWȍۃeU{)rb[%5,0|LUfpHuY~H-vxc2 *0,gF|;n/#urCRH#Ui5΃t2dpyZ:ZSO5V?T(J<{ɖc`C%-Sv33y1lh%ҴK8Hn-di j#xU9Uc<O "Ql6v1 ~p<@qԽ{Jv{seE[6Q_|i ou}ܝYU斻zoﭗESJrY (q(h15=3P2G,D1~E&ke+b}QYz+?>@P:\ziiRٵc$拍n̪)aluנjuiм:hKj:SS#F{Vo of}6582TG j[$ ,I/G<ope40&c#2=UUZ*^D>9 }a_`_ԓKU5fVVQݫKtU?#dr¥W9W5F6*%PdF&`X{3_pmL r J2SEQMUL61khnR"XFLSBl i!MgnVVb3ΤhGZG7vH:tjE(:2˥#vէN'R_V+(62!ەw|rQ1 E=1TFkܬ>U a/Frqn]󍦡ܟP֑48r,1 p㒯wʁ PZPP:qƃRh `>[h8jz6ZsV7jlLFZ|~5&Q`P#[],&dVak>Se!9\*NkwJ&5ph>wDtWpQ.#[$r9n'euhҕazO:2D+Vu~t7nD)FbGmQƮѳFj~Rˀyn)z}ρ9$tZ,~#ci fdxrU-s0 ބP=;eMU&iz _5EP4Ta,eUts-N}&GbⲵSPC@Li<5haQ4Vv\`da.vLjV̫tc + S_EhLeN?#۲ofTvtҪuUȢ0vDpɎL&u-Rh2{38 L]VM!MR&X~/[t[k pHhcbS0Ҫ5ֽ2YHj *}+厅od6|%lžzMX V.O -79 O>kTPTXK(rʈ`þ6~Zȩmmوzl EH*c2,Wk>a{pA2ju, Cve!t:^i%WݑCe:]y <[lUU=n핹xKIOQ5<|Qjq?LƟ!4\$)W S)jLEr_yҢ<X\*<Z!E3UM J5jzͻ|^b͇nxQ qLԳbPb2~K]v"V^,FzX?MYZC.e[{ n-嵹bȌ[L{uLE&%#M:/LRWjjPU!_Ohh027Vis'b JeH#Mibl["J>ji*0mIJd$<]GK;dm/y7FBj6WmL&vI+q p Jj* HV ;j"NR'<[+_Q.K3\լPU!0G[JpK2;SŷI3j{ d=SMkǏG+åN|?c})Tfߝr?m.BX4vz܌),q,ju {f(l,5k !Tbg/QI1buG~[> ۋ!Ɇ4p>JMdf J%kI CaWJ(Ia> mlM3cXsxZz~?eW-:e&&lUX?gˎfe-6g EQMK,Y*D_QbX.!jT:Ih&G yQEb$jj%YB[ͺG;Eeh V :uvLЁF?g)i'TR838 e, m>@$,.(KK-m7'_Uv˿\62H))+b0*':, zn?zlIУ#;Vkᯆ§˃:Iqy&S?|_>~U`zK5Q0{T#7IMi7xel^vge'\Q(jstմx^*!汁hҋCEpx'[rU$.k J@bE@cHiʮͩE+n֦UeU%]=ڇG{ ϶sXw9j|6魟 y&QxȮ_yw5 r3)%Se!Jx #B ]Q f1%ի!MJS@_uҶeר`ִ#omϐ=1.bm^`V_)qT}äBxqwF /Qm2Ju& I?O"i `@/plbm{s .j(b ܧWKm|BSo ϻu&ۘlgod+Tf2\z<#Ld$RYB"Nd;b#DzOwuEm+9 TpK7a{m}i|pGe*3K >JUdZѩB)p))1KI8OWzK&Y B\Bh`&Xw!Usy>IJM6P^ Ll!"۰TxLZQT'jzzwj3Oʿo:aR7cRVGع1ksq|*Hۢ/ G\#3K%39ү]%~OEGMS;%xښ (6P'k;!V (YƕOQX\x3vV J -:{ u=mI7TLN=UJHd%ƑG!}CS9fP}۵s--n9JV$d@g4d :%̶mmEuo!U₽gFdVwj+c*j&|R.+SO))j(#Ghr)'O]E]n*kUjZl²g% He,ԚTZu8Pc4Ayt$+]$q?/:tㆋkn +%۵8ҤGUO[Lh*8Jxʍ,  øv7xRGɣ9CA}3[UF]X<+zFa̸vxў8+*hդ}Ŏ3SO3K ^FEe5-Ec+i)5o:ڙE@5BjjȫJRqZ%s*ˊCel>]$M!SNi@H3TV7k`ë&>fdg/KYQrE$L@V@ t'-Zl&{|PԊ0{R.&ȃ~|NG`fktPC$#R)i$39XA.˯(_Rgyf]ib9e$ *\|HؿAi$ nDjBqs=1/M0PRR(B4j:J[9Cuէ՚VqY̼,kH9JZgeEyI c-RKdJN4VDic9KYIJۉdu+T,FpƝ 6n"Pӊ,=?ϫsHيuI54n$ar^ W`n `#Rjs4EfVySt[9< VusC/h'P;] N >uV6"1TP,Q\T7[nG x.L6Q/aAF<\~dԍ=")/;'4qA ZR4\p ADwoo6p5ERn<6뢉e4q,U09biWQIFq)(IUH)|.cm%_ꡎcN_EXoo_PZ^Һ|RVf 6Rŧ]^gC;%>I jqS4Ƒr%H$~*-89zmeb簛ƙ*+'$ur- o").YVa.j`1mmE+ jT5u`tz.b_Ö6(迄'.s7VI!n lU1xq+ŊNbx%Jqem\MOh()(1],lacX]dMUj".孩[YqhI Ĉۉ8iTnTݕK~Sm]7{UKOd)E|CT1Q-tt:iAP,鸸dvunۛ^x4O TR):h`J̠41btab= 6 bAH⽃%pigE 4&մIR :g8/Eg ոwgsm-OTx\S5 fGK5mTZ{KAh:!OvSc)C!#jk\]6Uui#xTh֦|f>ja4+jLTŊ4Z hvFHg%i^69JS[MQTDgZ#FF"D,CWJ]F5Ê1Dҽ@d1 4 >Yz鱩vBZ)HW~-Q'; @>?U<59(jb8e]m,ݙ.̀8ԅPU-N4[V]6(@XCP? @x^uڻW5ڴ }rrSMM$/S*9kZT{f3)WhǹbT1YlJ*y~k k!֚Z&ڸn,#2E%dM*kƪ*㣗ӻ.֥¼*3mlr50OI3҉c~c F%GY A>0},X=R5 5˭dqD`\,a cWgd BKyhjMZbqTuz)x4ҵҙ6@QAh$[P("^qEO]F1ɫHc*'!J ؇nfvM!iZTjGmi#p&ܢ T8Pj(⧴׈U+QS۟!v=VɖqlF{ pi2)ż42˩^:i%YY@mf`IRuWN*+V.)|ޯZVQlbV}nzEVWkD5(2dQHFR@[7]\sqS)u ܊#eBy6>śv۵nBN1R ygNAarRS f8:~pMZ*I*qiPD+M&BDqvqg9TH$xajٵOII # +\͘ 1*RZ5ʆ4.!XjA LbEbwQFu( pRWM uueE5`xQVXSR__3f,k 0$s9Bx  !-m>J56z~DiςWF1woɗCÑVOKZmM4b?[I<5G=$SpGR Fa 3S4&D {k{O[ů-l߹/$櫬4+{MNsش.!0u)k_BaO<>3,wr.,CiI֡cMG (_. UA upȤϵs[O+S$Y3nC*S,2ҿ≥GM iJmx .c`j ÂItdݭcJj;I`0~.mbwOlbZwfFa 2Ud[B9HjKih:I9:T#N#fY檪%lA ͮ{ң-sH Vd53}`G}RE E<4^] 8A UnQiidž9q kdXЁ~~fvĴʛ']J `y\PMFWm-fêZYv.!s,bJȆaWprV[ptIW=o[?<-|('7cxRkkhxo$HM+k4?oSޒTU_e}R,z *$NA%HonڏUjm6BCU[Issզ3Kv n/uOUY);t鱸FGo?βY[K,,qq#ۣvo TRzMor) T TL7qڨ_OQ^߆Wuj Kp?/״ SrY#skyZ<:bZm],ujyܣYBto桸TN~xzT]t%x@[>gim|MEh+&j}x>EJ/9$4"ym?LJl~/WiAO3=t *I$rHM_ڏ6S▒HtkMX()C%]|B8 yI9J(yY$ɫu'ӓe}:n~^Ng?V0m}M`\6-}FE:^x_qNn=ٓTmԑUDa(1eQ㡔Q*EX40kIng_|Կ+A[ 45$p>CP*gZpj*FG#y* }>Jԓn] hTr۷tPRşܹ U`;(y#WUٽu7jjw6XEU[x#J0%RG~F߲|c3]˦V#;$S%FelbL(QS= fZ(f'ٶrY \ ?#ob6rh*h|uob"β!M[˪轝1=sx1=i'UU8eTqt*t^E!4so7;.k)OHĊ F|߳MOڶefw6 }^I'r)J?n nis':Wfw~Z||1tq*ᬑ^` Xcu8(E# ptfoO_:OAå~jQ4D5<1,Ui`^dgJ؏ 6t3?I ߎf!fB&١ĐU6K"UMTQTx\_Եk_M'zn[h`$p_O915lh[4ӺY**iQSu'B/_}?[ddj2Qf5@6L!ȉo" )̳pщ?Oqh`'ڝ9m++(\/BHBȢMI1 `K~?r9 40TJD%Bd,jGd\[ۊDu ~I?K-I[v%i2H`y9fJX}?&=4)3U[svbei֪iYESO0ǩe{żJ~%ބF4=7wAd@E+A,%duTD ?aMq 4RF:1* ӵ!~=:nդ6O15j%\pHB@ &Mh^LTзHI zk1j>>zT <Ց #IAY FJM&N-MWP#[[)Se9lm-xa4Q*)I|ci rT9-3)h%M' 2WH,OI@<]oJ̄=%(.!dYכ_j]޲lu*91cߛ9YK j4rEbI@Fy/%Ҟ.\rA˩h@N!JL#Ӫ}[>4`2<:hʜ(Y4x4.vN; Դ԰т lVF/^5$",Af1g y( /m<?}5q⊵/>u)#*a!IL"XZ_}W#o4{ofm~Y7U,qc(EoM%ֽg2KQqkR-l^AcgU-?$r¯pm7&v/sS46w$ES0 CQ}Okn,]%u>/ %L9B'$eҨ5f-ab}s.nr|\~ סK,WOȏt̻FAMMƪ, I,89{WNv6 rŇQYW2dqd. ]%> ѡq,1uX-ȹEs @iV~ N?tՖn*xnϐ "0epeQn9}mx}ƚl>ODj t 0'HRk#om`J{k=eKaҚ$#632)C?oNs>:Vx)JTOSLѱBğ>Gwn=z(YIxPpO:ɦA%7Z[xZ%A*K~;}2e  ?)Lf#(bLvmN+}\[·߻/!d"}T ĉ1b+i9I,HՂX~aڷibZ@$)N!JIYa GtD)ii媫:Jh]D,"HIj XjE|Zm۷pة[k܆>ljTδDJ5/HTJin{$ 0%Pc4Lzdc${\+xA_pEtsS1}q|  p [lvReve`1GCIY&JM"4(1C2>VEB/VAj:?gHIo?0Gӟ:i+ikQAdk ثS{?" g2Ը'EP*vߵؠlUbIp8g9 В0Pėx/܀шbu(U*+o@ۏbВiehB@qל?=tR51F,[m]SU)1O{ijQ%RKET=8JQ=:"rgT%HTX#*~Bd*bRUیl-E p~?C(bB9ךhMD^B,4OS{zOLx6hS R(hp:Grqi;"2{i<ℴh\TvPOמ/D7Yffd3 9L3#*jmA]:#-OQfAomMBPCӎ&ta"(]$I)UJwFEkVeT'Z)4Sku6#r%lͲ0f ĸ #dq|.2-D243"HOied?qs4Df$QJ\2 #X~q_[pb6AYEK&Ede졄3mMFizqCǢnr`nV iEAQ8Z҇);]2YXp܋}=UG52J,tcZ̕T:t=gnI{gQLZ2Q!=<=g_ädjH@}6)i}hNDq)T?lK0?[p{fە[]GTq .G1z(iQj$sLj"Y z^Gb5a2~%XJ~|F;g8nA 8}iLT)MڃU]CWUjz`mGk>UfTewe+KcQYIνU%<4USKX@(ѧNY`PKWR'rptEflH:z2 uqX ETJImbȱŅec>r9Zߡ5i D5 8󛭊UIӅoamGEL3R:h@Vgf9f)]5 RWXxuWcӢ d%<ҒM KIfmݿ%,: ~'#USP*+&u+4ȫd֊uiI͵_-eAMb8_O?n3lv:I#TPa_EAU& ) #8%GYh.jeP[Abgn:O6jzjXvGd`eGFK"lܣ$ɻ VA,JS#%_syq5+ԊX1(',Qà&܉X<5Dk"3"OOkjm혇'LdjgVˉcEW2Z{]H"{@[Sf6ŴU*}2|1)(**vkdvk&a]Xl䷀/qeole"@]n?Lg|?`H'T0h(>d|Y9sR-E%-&F I#yKFMvm((cPx7 i+P Cd4Jζhj5x]IGaѾAPP:Pg!BiR}AiUmQ &J+5%UcQP% JB44tȧmMs*]3QnA o?G|IW$u \V7>xȩK"QI%0B#jXGHѥΞ@66˼w6TQVn !SUe1E1! L堛K1@p N,0 ¶jIշ}9ԮZlJiTP|]>1WSJzIJR [$TbWd VeUC ,A#Nk\tхA.5M߲s4_bl>$ZD`%j{d*=6-ፗVX Nh SUqAN J-m+UNͿW{>E\V%Jv̼]ciI-J:1+j+P(0,qkuqV*8iQ_#~ޣmw$ՠF?Vh$1RApMmˋ13edb)+tS F*H[vY;n^܂O-UB4WƗ ]=j4IC9-,nH-ԣ('A8ng4*G҇0ިtYuGa\TQu2digT˒)#鮾i];_C%Qelu (2>8a0UI=A}>jx-$#VZjnqzZ)jZH⧴fJf/#xVYK \~I'٠hwX1Ƨ{" :huPK[᭖E{[~*wU `Tz n HmTB @P()PM/fZe3T[Rt%DA$v;cjcreCM'6#MB7j4 $(uǺ* q}hWMkB.auե: )47ߖwUV+rg29Vz Ar cOn^gw&w &!Ox靱GT.!6ZڭcivCzTd P|R+u-pƝ*pq_)ȼjrid%V`I)ez|%+IyV#&ĕl캪#v@qUd7FT>BbEHty$IeoQm1 (9s,p˪"AQ1ѭy'Ǘʹ4T54xeBꤍjMDf%BB,iVQlّ6;hRei#H&$r<@yr{('[&*P(be$Zw!\Z̀hMtQ]9w.&J yRMLsRWCU@QfufKCutd *D%haIfrӤi[AZ]KҜDV8iVf|E?,Ge3GSI'-KQiL qRnH,?%6cmn\a3VIk1"52<eC·PhH5姣nYydmB]SdtЀH- 8&=g%P%[UGvիQO{%weljJ".;ΓzNClo,eVs;1U4K*V ,äwcj8릡X(tUTarTU}>[C#F m546:I$gy6E 5BXB(ա< ð]^=Urh쌽2+'+a`h偣EK9mJ'p=9W=riߡVoRGUWffDkزuSWIx@ i{{{iCF2,c:FTrIE;KLnFJ9)&)U䦟]A::SM+HBV}6<5ڛ!NJI³Sȍ<ʤy]W0Ylڛblv?T+ō-ԕ2ʾ8ܲD ]n;um4P!-C)G}GMT֑*Q5ϋ==c݁IٕYsTk UqG,CcuDn0w9|qZ6KnfrWǚ 6<Csrnf*X@;So4QZUQO~ޭO8ujp5XYD)(t}I/9VB C9Uƶdx)㟟z%_$ W]E[ghNתՖkz7*$dq~8>=u]QRLQ+RbhP֫# EU>J3Ә!RH%Y)")(OdķWjũUM\4: Cݎayz]5g޴\ؽ|" N?6#IPIOWJjgI\ը&Q]c nwM۵*he cP'PH\j+"F:T ofJI]=oŚBsAsi<BSmǣڻvݠjdhfm,ĮZ+I ,B6XjR3mI[s _,IbhKRQȡKyFUb Z+IJI"PKVWy"#i9$j?z?UMGWfN)2(৘W\Luʡ$i>gXqIE3K%M%&C#Xi4qMECZwe)V' s6Y Ue sA1,JU[ܞr_!] x5C UCspFKrX*W2V%;ppZ>#5Se%sFTT74e^:X!1 thMarƞ$zY|D+iu-,=z6V?1N$}5N&RT4lnjp-R]gղdrvon ^t2sni=l&|4*U"T4'He}p]̒>ȒLBI;Jh~̬mt=֧Z~#χl͇63a7v~C]HfJc4BO;F'US}ٙng7YnLmOc>FM$2U֢Z*O5\].4LhBcUG7s>ۣU>}ߎ=y1+18᷶}}f糸|ۙ,\qKvhbJǧW]UM̆:|G{Utp^jeumùemňpT7EM![WO^u:$nKywrKmnJ"AR cPw+׮cBZF*3<38k|ckm kMɶ;[oG#W]h\ɪQHGC,ң&B O; e]fo2T䖛6e\-S\524\hR4SN,{mvEjG>!2YAi$d??4.~| S2ٜ>Z>t÷*TbHm3pSQaW R'[,n ͊Weo.B-#{kIuHi14 3H#^ԬkjӴ:yi cٍEK1VQ掂Y}10 JUmpX