ExifII*(12i8-'-'Adobe Photoshop CS5.1 Windows2017:03:28 08:52:310221(HH Photoshop 3.08BIMZ%GZ%GZ%G)8BIM% 5Ƕz'=x8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTDocuColor 242-252-260 PS8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMO 9781782213024nullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?Ӡm:8BIM8BIM!YAdobe PhotoshopAdobe Photoshop CS5.18BIM maniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlong'7 FrGAdoub@>FStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslong'7 LCntlong8BIMRoll8BIMmfri8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$$:7RҩN l5&Ay4 ,W$Y.̅_IvBkXe ooDz?WF'eV1္5\r-   tFU ,}-ta}%{(`-{?$'ޡU?"B()$39 #_[sp=CluU7Zܯӎ4o?og֋oM@;,ְ.| \_SKZ^#b*YG^-of[_ϾV+ Zs_ xZ|HUahaHWKuiNO$KicsTLYCOr/N&=?zp,D70:6{{u׺{^mdb- :q<[>ې1G*tvV:;laSb('œ,ՊT6h`7'aGCP.>̆d!e@?HQH'hN/ˏI<ЎxۓcůbAcqmy\cE] *XuQfp~o4choxz9eYZ՞nbxA)TvrX k[>均 4*zVP_) HY_r:zɍnj# 3^I}6D]^} ؎Eo$5>}\c-}O3xhU$]*=Zn_7&xt[ʫbڭ"*,TX^m_2%j an٬:6*H"`DZ$ ujx *}A'II}$}}KxNS:>$'_I҄]_QlFO1`l4j5߃$GcHzOfd B}EY[,HQqs#<,[֠astOI ޚaȠ!2ځrR?eM SHfb\rR_ EW:,'LYė "[ !Ո*r,ݤQeu JAf[5݊* {)tciuQb u-0E)WDثi'Mzf-\PyzU5ƈ7Pɡ]M" ȅE$S uifҧǻ˦D@Ku%Ln%WէR\)vv7ͬ?WM7Zzt͗Ri J2 ~E1fHT`b8q_ä]J,l.\pY|iu"Ui* #7XZ:Xer _SEሙ-w (\ 3H٤BK(C.Jv, ҩ&D ޣo bB2X}4=٩e|, (RWQ |Pk,@c:tJLtO: c?b[튩5\nE"=ݫ8GEJJ_O:a=,Ybms}H[U66B[F?ښ+jч&mܿΗ Ksl]K8xpzo1wm+W>Tb%*u)ʲEoHN}?#=yq˛3G@`]5Ԉ(B|%qx,]) VIBuoWl9 Q)f:z֟ˏ6>-sX'?R:M DH.]Dv\ fl[uZ;5#/c kRxSUt4՞"?$،X*eL ,#zh؟O$ck{lymH2yبUȾBZ$͍ksp9_~8mcfݯOw~[Y8?oI FIWF0NAETxVSjӬe"8C[AX[_x=up.ewp=rmW,5$#x?Jz<"66pI5p2Lbee-{}O]xJ*O\շ\mWl/e4 ~OS~O;.4EZydլ1}!WO_VVGVw*E|ٹ_X[]mF1$ T h.}]A#F::^* +k$Ƭ 1g2'vnje!dBE6Oyʾ{ =r3`-eVUn NfJTϠ;Iw?OgߝmCMɃ4 2SVEB[%Uϳ%xU^_ l(YZՎj\V}x)ܷmeݒ$z~*>U` (mԕ5d}E'x|E] g1%D fT}<0MD}I4:zf 3x~Re*}N-ݏsy睷v9䷷JÕr8gF Pr.{ѺP9 \)5V4{d,RdeddG=4%@6#p2ݻl͝(j:l4OND $Y\A$vpH$}sCoXvު0^_Wle6F@f3:Wy #D*] {^jaqWfrGJjŤLSF:[_}5nX0UYOg6&oe竫jc]?«:|Ξ|7>m99ۏ{I}0Qj0<v,H礿H[' d܌ @+;|4Mgʻ%CrDJ⤯@\_v nTݓٛ7,CZN騂 \+uMy Etxg(c~#!2ϝw=RmȥF ѵ++j#Sfs?_#-S9(bEE WNtݝG-$`1չw%,*XY)r>F*ZjzY* q4I(Yr~A/fl^N:,V;xwUjiyāL@O6Cۭ6h-ny$XԵ Ф(jQ|sn"g #6N*~B#ȱ*$b!^mh[Md{^mΏܻ k;zz)#E1(24V$s QHu^o͗:ShTWbe%MSm^gݣc2+SCV:OD~Dz[nJwl h6ZW EWB! q^̠O)5 A aTq:6?EkTl6bwGܷʞb8i$Sctj nםoy|kǍYth~Bn̛c5cht9jrdbH^Ii{)2JpXJ1Ȩy1j\uihH ϏLQ+%jzvpS`p( U5I(jT=ㇹonĨꭡ5:t$n:} c]Uۭ鮧!x=cNĮ>MivSSƪ%Mj*媭JVSuRJ[v|w3;^N[ ;U@=F!U%K(%͌,sTGUdtH[H-J P"i }f78T1'vKW-FJQ=+k~f/1:~QecSFk2(HajݽqBy05F \ovv%D 0PiSlsY\H/DJhHN%æ~7͑7bmbum!PKE.Zzly<|q?Em$=]{ fmM Uv HdX`J9RrCCP EE{b]'Kr`TTQJƫ.jZ@/;6# YzHTOgI4閊\r4B'}]{;c0{Wvm|bk2:Q&򡪞{p4edRbI^%kI%<m}4͉5-PePCҨwD [l-t8d+6]뤪HHt.==ŵZ*APXSU< *ՠ[:/o]u6o=_ol{TۖsRbE+WT".<&_,ؠ6n-ه+sED~WrYeTu4G[m Hbό%TP+PSӧxwaE,EmV՝acӉQ4ier :%Z! Xo<3C֑UR d٬o `g`ol&mAj[gثs5VYϹ\:f *ӀON_Fb-{6<_ګ:{zݱyiE-}CL_vfe5rx#6ۼm$t_SҨݥZ# [-;-O@c[cic48fJaW(ȥ(?E=Md{8(TSHhY!%[qWmM S c\t>]Ÿʭ@ ?=jdRhdM \;0ٟ>Ҕ [PMme1Kג={wm 6[>ّœqk.v>WܰPu.$(IϠ6xW`NKuQR1GC_j_%$u Is} CvNPRx JtD:lfWRbCͭ`x^KmpKiJq}IULe4pK$4s`\z J,CX7Ylm;i O_R~Y̻ݳ HUX4Jww|"WR*q.d*qdS0EO%w]Q)Bջ_7->Ч0_.-.`WʣC<ӟ({wo÷]nI}l=IY!lj^&' 1Uߘ9yzdmmO URm-JMqXI]Ƕ3ݳٮf~= *P4 EXi܄N=S6M6ɘS2.\bqu+Ll}[؏yɻnnW4kE$yi(?GxeQݼ\cqR QE4a;z ivOf IGraZ]O͸p} 30[y9 F<~Z>;ǨY}V'B~ٕm[ۜRdx8tA{w|? .a4wi@h- P?i^fݔ}IYq(FѤzQ3S<@w?Q?*JMpTWUÎҼMc2 t =*Ww,keV<([GigYA`y/h"soʊ jas]kfGnʌ~F|SRVn l/ ](ivxez| 0:Z(8᧧Bn}ۯ\cT&k ƠոLwuźہwFޤUs@(êڿ z|͛>T'4TLDu lGqp rTǰ7J$Ի - %,3KOP^'qq45:.u_Or%+{+.ͿreEmq$!xաAZxg^y{c߷|s6+ʶ(&P+-'@ǫA4non3=q[UP>F ,%%*#TE~ gG[~jRILU) [4S<@X-ӓMP\3݅dGtz2_A^,7su \uߵ𛂆7%cୄeI#}aq`ʓ/E:=9ӞU-qlׯ{eډ`-~} 4.?%gA׽=CMyab- xϵ>^'F2@nFYO"Oo~(HPs<4.ŭj8r֜:,R?ڽGy T}J::Hbl?\{^z0{[ M!tY)3\t-RaA{SGʓbnXY_b{6xQXw"ƚ^@d!s͏} s{zyUBz0YT\M @ m\qyQvBԟz>y*!'N?^oo!]իX^X/=B QoMPli4FfjTǐy^M&@G v%I!y9[=WR$uo_n~ ~ui}?m t.=b5Z{mcVP.@Ϳ<ɭ.䄧Sn 2O[{1BC4 l)? QKsv H ou7pA 0K-zΣRqeY$IN?=MK+'ơI'?{ j/TMУCN1^e!XeIk^^-ѣyPݦ^}C?A~Zm÷uGtq5A;j:jlpT@:KJ[V ԆyRdH \#?gc^, Y("k">Vx`I+OԲ们L~uA_Ά^ū•xa,6An.G}# ^6 jf[b)1izf. DnGkӏizڲCrmrR? "WzԧDn˨@-Ŝ5 /4k1Nm5_*t/b7Q$JYU@=Z=l?[{Dtt܀GH} *wt[\G\ E` \%u } S.mq٬;`2zr DYLn)]Ԑ9ڙc?cb&_]zp'H-qb"{Y{kU^cў.s\W @cX12Nl=-u"aVDt i`HVϰUŻ[X/a#E4ö&Pk\bTʠ1Vܹtjz^D7zN>MD>+b1c24GR׽׽ߺ^~{߽uoF֤YĐ.j:֠;M{^f=:ɍPnцzMdP^nH ¨06 m.+.ฑ8YmV0.NÏP彏يڃ_f -lCZӥ@ӤL],G>͆ǐ8QrԀQxf+NIFFRsM`Q @S\q#@yu\ #u?P}:#7 '-?zdju)k z8~k.7ے0M'$(]xz% - 4\4|OgkbLdbTtruh^Ă/`-%x?z;1׀5%hȲҵIowRM%Oڣ4I V,)kG ` }Y]Aq]2QH$Lb\C*ա͉SO Ćrl?{=+[vH#GQ㬉7Jz[=L.^l@YTkp9ֽRkH8ztVRV2S*%6:FC{؁"Kj" v{sUKfP_M%If$7MO/v,FDjt }E׭PMpDq˪{m$zH+OeYA2>\?^?tŐxmLFf%d֡EVןbl"P&Bf>p]{JYYjZ+]-#G?_ih/.Y}7{>6$1)z>|?f,Ɣv(XPBgf,ZU ˲ +Ρ{ &f1+* )c?}EwԒJn ͩUBA& [{Iq`J~Er4N1WSTq%A+:B6=@h}~QcfE\H/o jOH%,EӧHctf2Vk>#<CbHZw\קbkzdL,MJBPx7>p[KnnI r8 9>SLXָU0`E7-W۬.[ [zBA? |I񛮩I TkZ||xtL!O#N:0$FѤHA7"\uPku: {$c^]'(BH 2 :.fF0E^)&G^"Հ+?,6BUcLlT2Qd`<,S G??{ǀ5W%77:!dB@2(@u(t)O,P]tF1#kZhWW/eEX+C]BBM I?W؛Q?h1QњvH38pcW1U| A'12Χi=+ƣΔGjT+^1&XH_SX٣m> $Q43(^dvXLI}nl, or?ƭp~4zO}4B>ǐVR C~A -c6n=p. ~?޾uoΑkQ _6kb?_Ou#tUt?_ji6$~G&uu5Pt`x$ 76?~.9?Aǵপ(h*$I7fSvB~D7[ Wqv"n&e4IY4>?@sҢO=qOt_w]oҫ,?[s@>nC{?>ubˢ[K.IZ6I$S7bZzv[VKkjcrPۀ67oϻUZg=/hd nx&.qb=jepGE: ʏox}s+vyӭS$.T$&5g.O taBbVQ%HUG* Txt${sEFқV`1?}շeRfAIE䭴Kb?$QxW?WIo0.N)m-}[/?vzwq,mZ0g׽R%4+$YX M٬E=nܮ4CO-6IwzufMΔ{IRPhP"Xs{l{۹-T-)QJ;-( 2ǥob!7?]s=em$D G&;miA?W('s޹ln"fx\$hJL;nװ<aaKȗsޭRG q$?lضmiyt[dЖo^_;igUxˢrnk>AglmrI'iMJ{gK?彆_6f%f ϻϨShi8檆9%a6um({~cT-^snVnL)X(t 9%xDI6>ybaZƭAcEnѪ_n:.z戢t iup8R&hjc$I]Qf ϻN0t5:ڟŏXcI?Ћ?#&m;f_n2ҹ.G] +LSq}-IoJBOwwI]߲v`c?n%m$|d'E%0LE0T**D1,U V7;<)eQ*V*u{lMOqcCr"bEO>B"[Gd}mx^l57+OxRB h醖/Nm7GCQY|~BDt'J&\rG{ Ȝ%LY4i^V3WMB^Cy$2MfTǟLY\cx5fƭf?TU h&*D"Y)B l##;r|T h%%A"~o3m˰---ߎZYTvaَ9ry6񱩈dda+"zv;~cTTe5Y0~#SSDM'}%)(饫4hR4hRޥ6xn&S0X*ӯo~ae%̈XQZ^9ϥQ @>ZimmVJRHMM,9LDBߍ?_g6ܑ`0+>@;rot45 '-_VaNꍛK űxٞIvB蟘=-wlq`̴U"ϟN';ᢶPr4k_LׯߛqG=6&{ ع+]UyZDtKLɥ"os}[[F7ha#jZP~~m>7{ۭvq%c 1?.TQֈֲaK)R@1*8I6e]unofZ[+S$: W‚}J}=;2L۽準[H1T+]# j*k/v)@,K i%IjS"<|oY?ayZ<5<䩪)d?W7&L TQY#Kܑ iդEbHwQ\m>VfWFu}NdzYCds+ȤI 8tű>5Zt>hvLe9ّhMh f87:@M_7\O[48*V;I"N.@?yqÿ[ac8ۚEPhWWW‹RK SݼtG[&)Q}MVY6j.Id9*25 JݭMXSZi[p.-gRP|܈N۽>ݻmdhvnB+2td0vD" r.mq7w'QXܝyZ& b*RTy# [җ b@8s|۹eLH'AuUi j ۚ\E'rZ_.E 6#,{ͷ>^٭tXOxOYبRkc,ݺhj:9;wKm;F"IҮB 2=4e-7d|כӘ8pYXڮ,zZbҙQggdfpt>͵*Lfə1X!*^=2Tnu_-%4nJ0[W␼6 P*!#)̊=?c7{k1Xv}ON 7Z&*˜"i")F!T1Аnw~sbM=fF2Jlb:`jvDB}b#$W'3]j' (ujo͛mIt  PFk@N'\_5v?3$glьF7)õ]TKJJ2h`dK=KSS%\+槯ƣOC͸{H75 UvN'tU(KJM2Ct%yeAU4B(|a`ɛwBm)kNwȋ\5{m3-F=S2G4 ik.C)OrFn/2+ӪCi+;wUԑVmoUE NڃY#;sRMAvfHrJ7~ұHa\J`>366M`PnZ$F7FcoO<Ӷr2SJ q/FúE5{ S5upVb}>d_U`>_kK^{KQø $QRѱVԤ.}/sypm-XL1'LUVUVj]MXyyol Q"A׸g+r d۷-lAÕ c|4ԳNt ZFb}.Vڇ'n-Gfef)"'{虲J*#,-)kIK b( k㹘w?So6W|4b5 Vq=]Of}Uڱ*^-)ClLut ' IZ^{vo _C9$">D %,loP^ϵrgky´1ځ{Q>siՍ\z}{ܶFhIf*d N*E{н`a>ZL2ļ4 -cg#.w$Z`ق4C4<8:ʯ ϰ5}fUl죇Y5ܠGC$k.u U!'?tABaY;w-n;w}>c'̒* ' Y>eW2Qͅ{ݻm۷1>ҥ-\6uK/J?ggA+q}mų92j7I CE#HcЫlU1H$ՅBP535 f234JxA{+Rv-6Q*暟Iy%,rI$֞zgnN=~TOX3GOvv}:kgzض&:3<\*\l0XGw;v~.!W?eoݧ]oʤ>=K|9Օ<ׇ@OxNc)s.c0R"! :hT@ }VL )x wf&Fy{ww]KxQcX:` t]KB(F*5?^ mv-ӳ)&L+ Q:#IR6,,5s>4[kODS԰!2SA!߱mh#V+& ^4> ^DpH pn4':sVgg71.3]AMl]^;OWӉ=%<&3(b4ڙ@ {Z|٭HW1xf/ Qjp@ :-Ke1ME8]sS>\)U檡qac)8тRײI[5;_[-f"(y#h!]@]ޫgv'$mR[_5#e MHzɍzn|rˎFV5|S/nGt:TQjfg)Zj X p ]q\:`$]E_}I|l.b#b; ~p[B0u+RI4q(wb||ؽcնrRb3QUi`iRbL)R-{?֛<0]2c>uD?ңר_|b_S-hhvy|B>R8a'=a6ܤI )WiȡUbr5-Kb([y+gn2U TPc8CA/oaWAS f[H@ELeMKvnl;~*Tf*+*j(hS Ay{w*[JKqfH# :yR d~U8iA(o"mW[eӣ\M-8W䲳J!xچhk$C=,d33ݍczfW'l8]F?-ʡqeqQ\#RӭE>fVT5-Ry ;*68@/mFUEOOlTrH`( Z(ل$`pEMic[u VAQlo~V)jZ%ehyBA`|*,z HK;H["-±C`%j 0 AQCשf;,h[c^w4.zTXɩ8`DN}aEo97+b31CT5Щ$LFII.`&A4%{YI&HY$箛{Q4mLOӦ%,Hm(d&[9ܹdutc%=-EKR6]+Yejh# n.ڰeWM I2EK)T:z^Iw =m S nE[9<ǽ‘զMClu e:zqCm$ďQMoqz&Alb}E׽ Cb/ktڨQOKӹ  a MG{zY}?ViU pܡ  ?>߆3q)e?z(ǥ1MogF kLш R N>jmTZ/ΟKaV@+._cX(nQ&j. zub6] %>co+Lt v㮙jOѧQ҄{E {ߙ /1֙{.8z?^yYX`I)/!ZK(jn_n>$,/$smę(HK=Lj֘~=fmÕֹ&7}{yIr7MZ5 {g7+. bI 9ǽYOHd={hɀ[Mٹ7}oQbV*))P4I*kRǯ{WP5A7T?lEzhoXu͈a{o*mF rno[JtGXQoӃ{#Zӫߧ# Z|oǏ}9~n5IU u6_~>x5OSP&Di\-8ĞGPV]B+N ŁlOqX0& aAo|${ci(gOzN`Y[P$uO<;8Q:.ZO7{IbFw6@^oWQʤtI #)m:O R9[z@qb|mɼX_JEx~ʝ<i꩷AW{7$ r}N8:uKgNQ:Dje[/n#}iQ$"J& ^bK } lN5tfaʛpC~}UYPB@ + /buN-6tmb݀OpA}}Yi|i*Ib9ϴ%uBi~8 ~O{;_N|=:ci{Mk͔9=Ẏef^,X9mT>U xuФ2gGQ?_Kf&B9GY$:qN']r>+B֠^ {ry@_^Ϋ =kp)֞},S Ss꠨om(߮KG(ML*NDJN]tqeceՀV&p&,Z$#f+k/N(aәīEܵoK$MB]t}=话ZbP\60EJ-'Hϲ/Bh)R I_O'=/qCyUˣUA`n~E[Ǻ %P SWǽlt5?=B'IZFVYf=f:Tmqc!Q/P-?Þ}.~{߽u~׽͡p ?Cq[jJ0aǯ{/ h!`6hNF"?#A{ =S\e+EҵW{;6H@&>'A|B|)aQ ?_DU>4+z5JSP0\~/GiߘAq Bߓ;H:ܵU<|(aܓsOfz"`(ikRa|Azj^..&ܟv$\:_굹 ~I?jiU%spص~ζc-\GHOϰN J8v˒XP!@X p؞oY&#]5 `\dq}D{*WwPh/RidB1jeSb85 m-ʑn?g蓥}( l,O jRǶ ~HOK^l ď>Ϡ2xn|=%EtX˪,¢{x]BjR+RX]V*_.-qr UOu8u'zlYPE{P/[R ?XߟOS̬U%I}.C]lkڧĊ kW]D@ `8?S%> Rz *y>ٲUߍ?难)֞ C(xԛ--R?[š amc\{ ʼn Q$Xi&(H R@$_k,-7g [t6'g{Et~EI6[YFh]Ї_~Oai ) JT[-ir_Indx5tG|u Nڵ?/N}ӆR?EzՍ<.lU=S^=^`GOVr)Y0 as}nM͋6 `86?oO:g 4r[@XZ>jտmʝ+jCϓE~GBHck@@bʺG'ϵZ\, SnuL#f,̼Ф*On1 / ćO_m:ol0LY\}_اzqKLcUtPLThفPUa+1Q):7#SGgc*"TC*꾝\,=-rzDI \}o Eyfb\t(($qu"3I"u3]ر eKGA}j4b;YJ)J_IĒԡϽ\K @*Ͽ2TĖYTʫ gV >x(Su\F4d6sb3%kO_<|ǢZ \K' Ntse]ի:Lw 'US8?Oʼn]@ӫ%k +$3`C7$}^jwWU .vdRRFV#?eY#f=!2t 'BDgUD/E 0,?Le+0i6?E=YwȦWNxp?o= 8S"c䊕T# "++\o{7%R/m&6v+oyIOv|'hkjxq}}RwdFM3i?T../oQb@o$^?HeHCΩeiJkPH` @S{.[8Ȓ$>mGeu5g4)},&]s#c#. x=<[ x#D\>%|Վ<:0;:sF]! K:MԳ~8~폨-s:|'kHW).y!Yqs=UZb؛XpG‚xtN&t*њ4ts!$~AǶ@\jb@OݺOAEt !H?bxs)I^Ikz`l{7Un6KZXX3A#<(Tut* Ĥ.Ip.scn})kjs{,V,nWǺ;G #U} 21>{qjz+I"\pRSSK|l퉿޴0m1b0I/}?Ao[G햙Q}:K%>ӥV-ytoRԭ_POborT8r?'oBF6R@t-ͭGM)W A6l5X@EOjO ֨@K :k̶<_7}9>sFf!=:G7<oyT(zWO1_P4?6}ml*XN#BXjX}}lޒϞ/S]S"u#{< g!Wb/<ѳF,X+ }nWxM1G-U,L(NYt.R~_cs[ ZZ"$*FB`Gϩ7ˮb^+Ȩ+UbŨ83:KH|~XX,C̬<\j.U|unhc"Q),G HĈQY 캭/;{/CsmeDѼa5xpU OoQ4~K @+AVwAc;?7o؂rؚ44tRTKUD-s9jnNMI=4sO[6vFB'`OdP{TNi}WH_<|aqIm5O "R<>CMvD)gnL螋nW.a t%#I$dt׽]/9ĘME`g9$CU'P$n`v@t0 9_nfլ{JD+ܹt):j`q%5]<54- Ybq 4n7{q^-, CB bxT\$r/^-˙.MWOPwjj8.m续]wvixѸN#Oo_.&!NRIRf 2HӳV#O鱵){04GvUW^F 穚FE1IH c}o M-62@WM@Q><:]fyC LdyP^#wCZGȑ85PD[ 6\ѭd"J>RiR^e!BPnA6 .nk@Nܽhh:*y{uc/<v.稶R!J:Y'cIY(S ɵ05Ò@fc񆲚jerTU 98#hzzlu)]dn_X^v.7͎ktHt5P) $kWbjO5F8x'u*Ə%%RSMT.e_ Û){h:'l3Z%ZQx 2UXp8lUO@{{m_X%ɋ6:k}r٬(]9h Lզ't}˛AZWXWS-eP+0㷷WQ-+;W] +P<=@#ۘLam|+&ZsMTسu&X)RxXquv\gqg ,1 K Mb,$A$HFκ%o";IUT RdGAmoj=A_E{ylpm<&ݒc9#GКU9ha^UHx ?n9:9#)T :iZ(P9y'}?a۷ kE7+./U5iY>_n:q/z9R|ɡ'@9]+6ʝ̶}:a*/Wn6DR̔U+0a[n}G w5\l9`ٴ: Wy䀱Gc`aΞŷX;-th~Y 5]lU­ Wɛ=KWjqdg vĊ5rj:_6z6n썋tjVqu=$ð8SIECT%rC!tV NTc)Re7_p 48᭨J)Y4P"5[{~涊[X"Rh:K}ewf/"H-vv k#I$\/B8($FOZ|mmNWzhʯn&3 %oY|u̝Y؝λvn C6v*`#eϓEG61.MGCK\< kT+ϑ+YiYja]5{/4xaC:F)4z7{F9'kdfMͽemkux׬RSUI Y,mIVZ-? VET6k=FR2.>x& ZF17߽>w67m+0e<Ӷh,e% 7u6A6n;ͤ#I+8grj=J /\Hmޟ0=ݸz|VJ)ʕT쁪#DUsS cƢɍcS&V\6[aau+_JIf7v{k-4t夀j0bWV(0B?qfGAhT TΒy$-_O:)*rt[!A$[/E,93 }C45 1Ҳ+, E;);wN &cs(0KBR53/y{nQ'$hW&X[]_hkԽ|m|>l/<$W:GfU hFf+s zmGKRejVn/qV2T5Q8+-4L~)$:@ 463SM5wJH5߰t$/qkmﴟvin6 $#3 dC3u+/\ 8wҟϢ{nii{6to$xzX#J<$X܌q3xEd͐U^HTK`7T[6*zJzuJV4ȏ l$ zj͎PS*)Hz 6yK) \[k|,bFuשXF˹^^, *@:T#ִ /ە|^qV%\[DJ(TH<Go&j}AK6 gTQ}R!%2W}㐽"&iyjIEOWiܥ `ISCP0БvU&뽙Sv{|OUvNh)HwK=,,Z!gRǛm˗Z r䷆ڮMYHcRcbZLe$REQS㏝ uKbבȺ&Ղ5♧i59me&D[N{Iq%ke;W _uK`6&Kjmb5M ]_3M zYҕX$mWFld`rkj60R?$puMM.ct[P p~|Vrnא۸"μWugIʒh ty1SVAY喖%"+4Sճ" 7إh}_-G+#_Z$7w_$0kGo5m.hl4,&E,d55*K~nOK`7RDdRj5|glhi&bd'I KUD#J/KwW@[d2HS:Җ&t1j[q<ʛ4(CatVƇ%:"ͪzv$hڃR AnsUN7oE@88ʶJj䣆QQP80Ɛ,~εBn -ԕ*2c*IYZ5-kG.M7XY(37Q~ Wi,߃= /f&۵CHqM8AvWmn|dnkqRmJ棁0xs 5\%I EhpˬLocM~R2SXzxPUd?QrÎl>@qeIWz'gj'5 ^I ;*)8֥tjNk7vogj=6זٸd UzxZ#ԫP`Xii E,[Kqt }@nyym[4qS3GZuQopf j^Y K$Q-}_mKK8}V2P̟@sG.)aGkQֆT>Dbgw]]g*!*kjfLrA^JdySL+NH`TR2@bu{gܐI+I`-4li)UMW}VDz=ukeym&lHd^58$1u{>W&(J1Ӥj!R48aҞ;~ˍl](%\QءS$RR4nMT;·W`r϶.?7@HJW#*=;/btXS5c+>2oz7#aͻkD`F4 "V D E|쾰uS^Q 6ӑrO1sc +xY.=ɷԬϓJP"RE aZv1&/⬅Vl&ɤyj+@uxpT>5qOs) \H gBłDH{-3)wn{&a(i5*@?oMb)Fkcޜ=fA#ghΐ@-r>^ܛouS< k5-5U]JI)e$?BTǓ{{* c;RP7 !73lv,jԪ~O:ǽdvM^yMGJ*/ȠE7,Z2;=#2IeIUc:sE~F!Zueb(Lu|2Fp=6PҙNݛzT#AG2 f2i5dW0^%36E \S1T(?x:_>% C:GܿFb,߄{ bcÍ3kFL- ͢S*nGRTR8bEi">0xYQ?~@KneSFТABIS[q#k (dN qtoNAu5"5Rm>Bw-PRS !YOKSg3 FӬul걕$?v*\:aJʺIHGr{}l{%KZ#JE4<{OȻ3r4ͷ_!.mIcK5rz)"_n)r8\ ."QZ殅bc DRYbBFݻ>-4EDq#֡o?Ź6q|] >?gu]]mȦ[!Ե4I־-!_IlFXX? wwt<{cEEk@oTqz{dfkc}J)P(Ɲ_=\׽ώ!eH[Ņ_U'ubcBF:1rt ۑ}$]Ejc>\zB/'*=,SI@lU-aō??>W:=1f]% UN^sKYr*/pXs`s=Tb1! )V(ޖbYY3׉3jâɥ2H^<,˥IaI, +vm9SU"6j>mbtrk׽h 8[HsǫHPTjav$,llmv=MIwDֆq`~\z|w<s{h?{ơRouƸuI\Wo=ou/6?,tSj<> k`V٧ؤ`X8pHO6iá ]{A݇tWdn`u~~ʷY`F-Ef t-mlA6+}4  ẙuee㒤{[ŭ#U>.d!6F2|6Fb^5pbo?(]"ܢ޼OpS]k{ uVo,)>iE)!@'X{Agc RŖI ,~=%pã!OV#i+QbPlnE75A&tEfkXln"/id_Nqт) 6U5-{7?Y$0ΐuSkauz/ģRd!7  磊ZO>ϭ =OJ:fH*n_{Ϥ܏g*ؽHv s{0~H ضiHvtM `tW֞f b,YX#uHRG{5D ׋`y?ܕa]QrHc bp-J ZF<_avFYKͮi/''Ww_I),HǥH"1 onzzA_nT[Źc.+=Q#Ϳ.HiE[ۏ9"EƯWI5աDe^ok{^{QZSTfbb[O9(Uztj @HΠ7?Qߏd簦O+rEssoϰ1Z>_YZC4(_o=bRX^ǏO7'cn.=ıMn#W7dA=*}<.P`'MrT=^ZI_x y??'&zz{^{{Χ0xuuv%}8`Ϯ[/ =\5@s k-*c?,:0V {=v6#Hi7/>ġmzZh4<lNG٬CqrV}U?ϣXe *B?CnzckEtU_=R騪3{|2Le ofRT +~m*l$A,M;z$HK)$/ ?>ԘLO,DFmvHقYDeWһyLNTO",Ă\@77>]gR!ne[Faec9usy6#Ӫ*:$9180;c0}@-'P#A>mtJO]Cz}^4¿zdĚj*oF@A(e+< }5 %rQYRFdz*_Ds^auϽ?ŅMm/>bʱpYRﯿ,ơEMKx ~,4=skDugTrd#J%\odPыp O~=IzDW颷 3Q ~=Z>x#Kd醳 +:d:zeA`*`0e }-k-L;VB|Ҵ_tP zDT¥)dde`]Gr k#?ָK3B?AwCg/UT5GLx3CIƍ.U|$e "bg|BQ<@",c(yf rlM74,Bm!FGKwMU\Php#E0O[k (=k+4W`[H oc͒-X韶 8yS=_t aan@p!ڣ`κEd/nj7:]f9P*/Ϲ"P +<&h\z;CO~)ˡU1v!tm<wT+船$Z!!T~/UFa-W=#ʩJ@'ppu}aю ~ICр":HԷBo4޹}ErnaԱ+^ $ _ϣ7T_qptab[_Mh*-`=\A/l)({[tO'Cл7T<ܒ~GԐ_= <-?N.=ܹN$+jo>-H cm3MHUp#uH,SpV6$j"ښZC?ǧHGt܆nJ?E0 7UD =YKiV[j+͂ʎ.ZNWy"_ސ.JTU->#rη"˥GOoq @S܎OEh蟥!@xnU cy*!ո ,Wlcee:x$"-I c0:WFl}sm3[@&II?=w>w[{Wњ뭃XkQ\7ӆA“}ouK]')HEq5!IKki$ ,L{R.?~]A<+[)cQF^\Mۺz_J *WBbEصvUX8{m6No 1Š}>cϸ_VifH52B٘ !٥y bx]F>P˯Ze=z'Pk}zmv6H) 42xSK9eUg eX{{߯!wJj+P;?FH$%ua="\ʪieC)n{)$ ޙ,ڿg?˩1"v N^Խ1)Bc~u2ٹR""Qnoyj4/4a\Boqz >,ӯ{~ARԼU By'r3!%ٍ*ZZnCq/ZL|KdovBTlo]`  Av?lW /7TUFtw=LZeW_M?Os;g6]A/%6wV)pj{H>U==1I˒@kTX:ʷ<>ߒyWPc>db .$1/>经m濚]u0? 3~!O?*\iZ|8P:~y_{Aru)4DrT̲x*<U4{lNjsd@/t^$Ɗ\ZbAOfo6<{E+&Jj!^IV$)&^<flذqꢛ)he**jbmDKGԒP1K F7[k9d=EGG|z/Eø!އip{sUn,~5Q$K1)kЉK0A/>)b L!::Z ٵU3:E!l2/h|b;LF '=(k t_Eg q;8` t#=ؽ0Cv$<,u4uۚ{B\}dž: e*꾩u+ z|Y6b`DzL#ly_&&siwo~5.F@JT˨|Zhw>`[ FpƸP*;gF&iुtCM PBb8AEݿ-ϴݛGߙubQ%*iFP-u}y{ffH7UC+z?\7BX#Ufw`>6U7/6[AsO QU%I KfS;]ӕQN&9LU3UQw++J{qm$214d{.@lIa r(*gJ^JjzZyH\ \Է6/w݆>.>ZQǴzw,32C =yc;Gb4Lvq+)-My wqkZN āWE *8c箪m6/a.+T0eikg\}N2zw qkM&Vl5TThIw@)#y# @$- 6ѣܶeר2NX.B/Vϸ =H.-R̜g CTuz3Tt.[GO_#XZX2xO 4 %uk ks^T>W&9H2WKZA؃kTm\Mn(m1?MU)K3e5ZF LIdbACWJ}cm*_e uSBy\гGYQ%lXtgZ#jY4yz`K+' { m }vFp8W1oOE#E,kJGKb ffu<5y rL<-P;NM>c[nvoϷzmmzy 1Q? O P/VLiMbkHKЄ3*TxlANŽmK bs1ͶXgsJE&{=Aj$K +g_1[lmxop2khYL#[ Ĝ"~ o{J9Ժ(NgfˇR߷a,DFķ)}WoћVm=5eQO&홶 >lbdaUVjK$nA'هEh욬6o-WS'+j5|QR 1IHRO$V;x M ;4i,yש=-jUSN _1à~-t?qU՝f6& Uɶ6sWNV}",6IpA>[ofp[TQ2,t.у@J;i6 bZ\عמ |,9E5Բ&K!o6{[rXE"ߪ-[Pj\I z/4]}WO6BY+_4 ROL!"'rt||<1.jXhk*q*iqtWf*Zܭyml0[+dt2pOӥX#9w{^l%1"k_tֈİ@,iP/1,LvoϑtUXiהZWl2McOK4FdR޷;wan<(13`iij)j*@YuJo#jXR7KQ iVŠv*AoB=m>r#{66PNRapJH  ImuY3nQ)+Vֽzma ehAA$Q)k^UA#wnc6]F}m䪡|yjaJGJvM0ۓ#V؋zÍ5I1+ h_JS49H ;.r>'ޑ,6~z˰\YDTry**uBq6vCif:H .F*4ZcKuZ(G;~tF'-{ -מHS )Qȼ4\#NԬw'PQvfJL3eEU)8*ehKC:T\}kaߚ$1[IRAHάMq:v ;{#: Dzu)SX2kct{>;3'O07tP(";%jg&k.ЈE]cZ'zZJES(*oDZm@Cf5]lٲQ棡vѻ٥k`HZ &LQCv~lRbf|/ Z-:UTW*%f2B Y)UV\n&T'z%JH}K{Gǟ%]?]`U]&2BSq竁^bϔy6OLUaZAbR?ȮF]+gl jh5':g#yU4Vj^:cM]=eUe|'SugZo6F׫y0yOUCU$k*RW){%zkϜ)&/+9D,zh"ug`9Xd+eO"{Ң$_/}XGuյ_:9ft$~6=Q3v- s?0b@l1v\R{K5&;+W(w⮠$j''1 @MEU"_=T7nf3KemJ|'ыM%.|vżJEg?X[ +?4 Ew9:fyssۮwMR?VQREjN)ӢwqRlΜIcqCعL7UG˪EQ?2##xqY#ǽfvHc$,ы"=/u O؃U %Ϫ%BJ47݃qۅ14O+~ir 6ªzSբl|VUΓp,ZpSU S٪>JV{plO{5ۭf,KHͤ7 >H'Қʂ*|؜iunܻi=6-cCMEE'ʥy[9,q=ma1O*'E31)X49]X1ۃ꧱{iC0)fh@::brkGyܻ~66C425xxESgwf9R㨨玫%xDsO-E#QP̬5Xlxjq5N6T$fWwDL gfXXSO`mڣIĎZ?:PPpX|ʛ5ߺ/f}*QPC T,@ .ۻi1lYqpG6PE=/, aCaVnVK/S .*,uQr~Y/]m\Rq2vi얲KLTFGu{{huΓ/Ri%ZQQ][ĠDH J$BG?_b OA2it#sg2[2zUameE ϯx=śnٷXN42hG f]ܷm{?@g[ iRAϏT޿-wo,68@ gRtDZ|ʯowa.Pi %}}Zuz?gMۗu)!:9238OHJS͒ q#'OΪ"7 ]E?Oaw_3v#RˇR4[eR<^-?RSJ PabWU62nX*l=λ9+.jP^IUT<*H$vHߟb-S"NWB("bRG~,t~g_on];.E͆ j)ΘYΠI5q1TA=m,NA:a)qp3]:WÎ|Jw;H'}Q`Gtu>/?ñSO)+Cɘz Dj,u=Ce,juV7GIƖzGAW&(PO5;1k=ѣ mBx#*_gפDx:Nd]%$O=R54OH(9[??Oc>بfM 6P%5^Kh6J爈.Iѿ_wIh##XVE+!x2@#G*6 {ƿhK2Fn TW}lm8z ASG#TlKWF "t}m¤UUR%E=T x jdUDd22x;|x]m;N|]&xC6DX͋ۓ C,d_U[Ra?boԟ|*D<v1=ၵf]$,$,=ՠ^bciWV_'1i[%yj(8|6bNF0JqAQSSL1Q0FA7xxgmGYj(9ś3Klw/oF5j[,ZBT+Vn."]i?(FoYnϪ8L Vխ9X?ɒ4uHƍ}-ozꌒnܕsOFvt)&b٤{S 4B4ʿ,|T1WDl8]'O4aXC\Rz(HҊ@!-=|H]$tuoqqoy IrvҁU,`Nkfk  ͽ>>( Z%,{E©F ~`M"X]=.4i S{$nx>k7LaSuΘ맯{`pTp?P>*P1H*Qm՚4ƚ8nQF[Dž~]ݖ{iujM|rA l$Vo?OyOiu/ \x{3M_kHqI&N֥z|H p8-ɿ?:E #~}}ptÞ.(5SosnA<~flx?ߏg|[cJ?zѝ6nԞ=i,yЋmƄ /IDMapCPy `a)duay_ރUiхԆ=u".t2`ŭRP,߸ikk_qTDB F^'U7?a+3[ڬ]!F>]\9pGHQa4Zrn.-a6$q=ߡg4cYX8*+5l$ {[UU)3~C <)4TOAu(uIn82j'i#_(E nB@,Yl>%wm:uOA>JtO3WzS2H(H`@ukE{Sn (%{I_& 5YK/n,t{o}^F!uF'JOnfMq`pj |Yڕtjk=4 ϱmYq? ( .7,+j}_f~ѽ83 gV+"2X} WCQ"K`ߏ}AnYeZgt8ӏ!]Q.Qʬ4kFIK.~mil4D~.[Q{X?ޗƅ-D+N+j.TzT6-h38W$PXnyHݘH"vUxu:$~C~AUoO~/WR EDŁ% ׹ =-^Z.TF" ]t q`W' &€mak B%$ h8Lbce)BW I'8VR*x Cz/QUIJcP?yS<,44jnUGISkjj[.0#_I4?F}%59Um Z(o,XoU_}͊pр%jbx ָ~?mԤmZnOw].ԛEsd,N@7w1Q矷7҅mU?>0:B *R o]-ssN%͵rHI8đĬi_}54SZ'`\I*oEc6?|Q+SCj]_[4]V'ruKO:1FksaOIa[pMPGWH >nY#z!T)U'FS\W}ˎ=lTd%dcЊUW!I't\I>R/C# yƢ~{OrucNΡK1SexyamNY#hu*4+ LZھj7Vmjr4v(RF=\\=b&r}A"OHkeKHHYd>i ѵDqT fC{Z{BŊ>E?ztvJ>%aJw"jc!B)iiZJ-2Ʋ+x7?$~3#z&bMMs#iri8Ub~=Q"-ěz& u L ;qzJkKrגLbpJ`vbj$ܒny7'ϱ,ϦFOiz J#u'=\Z{sjMzY"_TZ_ٔjtυPW/Fwm+""V=,BO>y*'IQ },T gn +0c?>ٙ͹Xyonuma{+\BPc}K `WI{}C+ol+sGHt.n3 @@}Vqb~?܏jjIOQ!k۞"pƏ2^|Y H^bk _oT-]@7o\kPӗ~"W7^trEv(]"} XOYBڊؓG'S^tO~ YUI:ɰ+&j r æ$qcбd(BvHڿ(kY=;O԰ jWJj??uaisph8nVa>FIA*Cj6^~' NIJt!sk~|F1P)~U?:9Hbmн@tg率Wgq٧0cD4Q6WRˮ1nɷd|QR ר-F?׮]mu˛pn 8?$Q.nb EkOx۽s&#LF~>4s;\ȻFrmݪs??>GEwkʃYKPJ%x_+\FB.[>ػbw,S~giڡĉFwXzN?Ql/b}}ll %|Q|f_!(ڔ5m${uv25]_V_.Wٽ[ׇB7Ou?9ɼ3%iVyHcvGAek[>;U%nup85xyyWd{[XK‡N@,q@]4ަ yK*R1WGdw,Eʯ|m{Um=wU׀O^GvLV0(`\55e,Zi*d$WJqa fTmooƒSIn]^ndڷKv[UhXB`{k:m+ݝ_q|}h]0CI‚5^ i=T`)G <<4~:8i) ľP `'~{g&~bږ,TcyAQUդ)К޶e bYD]:M\N:綻/o@u2c2ѐx^LTZghcUI=XBK=oL7߽M6䪢1UCTR*򢨹l*~o̼ir{BEi.v SZc(7%?/O.ܱYG(I8ljб5$-Gj:i" g`4E$HP#K`ټѻ9C٬xxXTDk:ǟfMGyr]F3+ªbj*~>hu\6y~LI-! .$}:OFUP& nUaΔEBF$KR+$r#.}X7}xTM o!<Ǡg&mkin.9cOr3[E6utRAbVh(xS"40k mbX>D~E{yc:DfX 2;1(lxyCgGs,;嚾ѢH:lWd-V[LHdZ R-B8x+Cw>ԟ`ˉm\!2<2d۲IDyj_Ɗx!MS.ت0IWT* UWI>7rm෪|)*>g˒ytbI8]x^8wu&*a͑W %e3Ң } ۵&:ȪD23K)08q%xwqkd!MQөK}I7MxKG|6ljP-)=<.O[yeTU_L;a&6X0V6%o\vR _wMVeOaS-TXP=.Cmi4/'wΪ +6zl˿\]H4 g)C[Iv]ԠSiܲB(wVnwH҇<,[ֻwtWbܛ&5uRԜb#T\]<,%i {r_!-}՞+gUQFgn9N'.7<ɿ]FoBB O:1h3qp6Җ 80AR)b&hDăIU[.#]eߛiVRVmLĕĪhVl\׷}'7O{Q(oUl֘/^ݡyel"Q´-ҟgKbxQdE(2 w}Vu_I->M$<$g%]>./p{VK[6`<6:u2S.+L] l@9BX3+/h X ZҴ>s%vmW\Lak~=E\pLo C)jimuw^ER\ø>#ъSZ*C._?j]+ M0&L5#$jGi =R_R+zq7=77VϷ~9e+<k{LMi&;X2C$IP 7fvO M^|r xS$!a: @dZTIe<ۃ70SvZԆ4WZmCۤQ(-QPSWD| v.žWj*T@*Zj(Ugk5m鎴{/ʹk*M hrU 44JGhs̷%PƮ= 5 I :X[Ku53 x?棵qF"oW7Fv̹̒x K.** g.]z_ -kj.mキ;]IFEf%yX!WQPh$ň w-m#YDueLFY+rs9 (FP@E?.:R^ۛ?9UZ 9_kedS&?=5JSPdMS2f&b$sV2(4t؜xUF@)DjT(Lv[45UUYKj>m#64oRl[]B#dWQ>6:{P|[tvl{ F.X6\XZt4s s۰ꌍ4(Q#댖fhrK, fE/S+j"IƦ/۬7-إpOˣ;˙d[M zdu~.u] {eg۟#Qo =\ji(o4ES&चnu"vN/k1ҊL5G}5-%O4jxVdPyI{9o7 CjZ8p@rx|LJA>yvՎȕ6 m!g5'm0^ݻ荒rb,R}FHVbO§Z!ێtyB> 0EP>G#e7|@ȬjJI%((|\ 7՟~;Zfk eiC8)LBZE*}I]MWsgDE Y[1ifz2KnH7鹇fxmӘeyѕqHEE\ v}ۚvf%!AXI,K0i4psȟ՛3ln䨯̝-^3Ylײ|VNl1/ .IzHxAxyk3G$kJDQ߀̾Ý[}1uFHM]:ʆ8oLȪRIQkm&G7[%?i3R3i3W0:,YB*$wZf \\XEn:xygL ]O:B@8:IgW"Ҏq2&d5ciIvf@I$?^2v2<ځ+،LPNĠNSe+{K" Anգ6)EPBH֦aY[EvHtH V4#VR++xvb/dmc;dieV6tEhJ,)N,mp 2 ->-R0MFM+_ܝ{$mwAP[O:ek"%$UISg0# jj kr$~UUEHQ`dGdN/ny2l $Fn8GqJZc}H~N۽տs!5ДWר\==sh[J:LQx :q  mEvxXɍEiirk =T  nlv$- k]k!'C^3bm0 ͂А=*1h%*TSc*v}S+rCޒUF>V<~ on|oCAe0̓QKW R=,TyQ$Gnڿu\A%V3ʎ A1 pMz}"EFAuGm-[2[O]V)xx1VŒ\erWV©SRU$HlTRnEUP4Q {r]O\PHb~@걟s*#CRIDLM8>ĖlQ[ (M<AᏄAnh-7{wMkkҠH㧖JZ E\շԫLOXq*J%*hcq $=--$gBE? 5ӦVkŚ팕` SZNvNo*!K!Ln4(I!DmG֦l:jdt#؄ѺZ:($/;v%w3>\-+h)՟R[cZ/xc?^܏;Kgac0׋E,|Mϧ㍩[{k1t9%k B D ,PI*YxSY{s N>Heud?%ܬQ/7s|9zvاlnc*\<~Co1uP5A Z`ГvAc+(|3AR4E' (yoLi\Xb t R/ԯAĨmIK/i=j}םܛG.⨳٘ݟSKW Vȵ^ŠDmʵp1lf4XjZxfIUW};0EeeOfVueRUEmځ7Yk0 sY\QщU4}>=l/ZkA4T. .KAVql썮#qI`!эm _O־=77"ؽYꑨd'*9&a@g²8-n t=ܙMQIJFd@S$8;{cβlכW-"TwoGkԎ)׽ω1De'P*T-kx{&\ujlz~n9_ݪAOF̄2ky";\},9$Hn1]WSuE6/ I}^`.+WCݎ@$~oiʹ$pu\'D2z"9~rIv#2?Ԑha*cpOB:N 0jvƟ"#{c"b^nf ck2 ӴfAUmnM8!Wzfɦ9?ۧ(Ѥ}X`lH$ͬ k3-Lj)]l8wP$lXXyT*Aq{.OIM*7nOMIaQ&. #{uN!c2TnQ }- } f0$`X2@_6-4/ _.=$^]xAQY18Wm>G*$l༁6mr`47R=@U!D D8ծm%f'Lk=G'yf }?Y7pI chx=R@E=,z%]hB&c;LH(D ?$7ۑ$}ZNId!S*xz.:V(䱽7"WX}OӀ4oŽ)4t= '{ ,KXaXOч"يW?z%mAQXdq ͹bO#/10,BqCZ?PT)!OkKR-GSck{ 򕑀Pj ;eYIƬtYWQҦ bY,ӏ*!G'msIfݲSiE~;zo/?\h ql{?f ₽0 CQæl D}>I'l/k}[>ۘ~OJԂH;Xkskٮx˓Wa7齽w6`Om[=[9RݔP1[~ȎPUWcJ-p@|W=^_T[S{XR>k3hT/j&ӎ54.Ǜ\qϵ'{k{u׺{^idOy 6"SX[=M{q0~Z$? ^bXF>[Dž'=$X=QuhUZ*;#_rE۶E.+p:OuKldC~=iXmkp 7hSR#vh*<A:wl-$`V$j_m4Bp_=UQ)Ek[poUMR7QP7a{ؔv8CEC5 e6<lAm,H*krG]0\Pm2RYFou mؓUB=%zj2R 9eFeC(,N9$Vk*qm ME]aUPv$6dK\~еXf6ar@nM݊=ouf$v'J8V&M !#@[^_Ҽmk R:^A#+);"6=*ʲ.٢:ߟsi#y,:.Cr?޽+kB{z9㑊FFPX8krKP,ǟ_ؑe ?ӆzfa_1z̕.A,zK -&f6O{q b%UTq+JJ}}YQSC)4u5StᙕGB!gϵ*aJg1*1~hoceB!XhI R55B"7#ѩSS3>ְ+i+oQԭb E+6=- 5>KԬKAD1M#NU7ZV fj=XUjyo+R8M;qRsJ)ۍ*30R 53 }?[MX7g6@FD0PTPk #Q>,ڮ~>ǻJIg\g'|' ѱMFIU Fb#dk9=ٱ"߀_=!!Iiiܯtf6]H̿jڃhЀIy{>jb=$<2c:3{lX8 $M{Lt.m`MIl_K}ow^}(%P_H+:yǹ_7&[5\sJuZ8,.loUڊ]` ~sz*+^zF( ҬC۝Vݔ/`{T@..RyߖBSQ = .E7>ޒ]&O~Kz"?>$OR݁C?+-(rYT E=j #.$P9M, -Tt_yofй]iwT1ch2:ץUͬ}9QSUYuGvn.?'qW5{gqUG4 +>us>XY̭sZ..YsC_^5T4ZŘmD\) ODzG]QxD "SI'"Cv [~YǺ IJ~sr7@GF4b0 .6^tg{-lf_Ɛv(ee!c[ܯmw-Y3 SS_< X,!3b?Nc.}Ph~E\"L\P@\{fc୼fWI8|;ABi^}0ϚR Q+ƨ}D -Ә㼎mN!m_zx-e/hN3\:x^}2DRKV^"K*,wMv 7}Ҵ4>~ׄY}ENWowk{{ձwv#}@_Un%wio ӫ_q\ͷ^O=fTG~}4DdTiO^Cݸ׺3ҺQT 2Kzਉߟ6ܵkygm%Z0>_E[W6|۸7N 7E5y{Qh`Ԕ85IPaO4jĎ$ď{&Sw-HCջ|X?3_KH'N>Tjάg]}oՔS-C"ԦE5m9BJTa걺M>I~+]qt05:xV`}9̓t;iuGLf㦃i]4O AɩqQ?|uc`ǡu-HhZh&GR&P X_HpvCmɌ/RT}ҮTrpn}67%M&z,SA)㎀rRVEr8xU;OA}JZS䨊ATƩS݇*6OfdY_)x'9b .񮗺{[Ǹ7 {#& ʼC'kpS,lۗIn^I<(ijy)ϣ˴wV|m&۵?yCԁO06$sb\\pHL;BG &/I eDrH<*w} *_I}|Gw4}  ӬNfӗ.ٌMXSMTC ҏJ&G#=B<u1C#%̑I17e%ޑ'2n\K*k *&'TӨ{w ˋ3w,H<*,G qwHԼU[w];ꧣijM$ P+zU$z@?[|KXTҕWuNo9טu[jʅ8y W^ +VƎ J$CF]O*~=;=]*oRyrEV>A,z_p}ŰvNWRCͷ-ԧSSEƒݞSFb*x˼!cVF/$ RHǒ~Hwp糱+Y5M IM0UkӞnr?²s12 ̱Ϗf5TNV?/Q<,UA8:yk7dXtzfձĚFR0 xmY0(OZ-9Ju{O~Ij[}F=ÞϏ*@ƋK `ZƢKHłiIJݩtFz:Q5мK-rTno˂xuİɦG0G4{dF/X ~ep=VkQ([QD_dQE$Y@["wn #EM)kWҵJƕ))!P> Kj%,̈EOz?éݣŖ ,HRuP jq:lSas4TSWSE)]U4S>jp51uԃQyG)Xbk+0x(h>g7jZ)X+@# fcyul #֧ž=*SUxx..HKϷ qΦ6'(6YGϔ*Z/S-m|p(3DobQI$@O*AiaХUDB>\z<>ouLc GJRHeMiJ:_.Swo탔yzP"(+9 ,B=]k]7Eai" :ξEOz6r;ݗoy4!eXS+u콡~2$93?K1`.T-LZY 4gmQ]WSSSq7_$R7Pcb5MsVͦYܒN-inYi:|1E̖*Jǝ1/;zC`:k*ulAL^۵ D9MOm&*wyjiIZC"hqeԛ)z䨺֦?%D1J.G)cq"iү*Pt}_w"r`0Aӥ;Npw7"8AR p$yæ=т$j*Ęzʤj]:nJ_7#%^X)*&=!jn r?}KM뭟qIINb~QH'tUb e2(&]ϸXtUS w5JukV6ƅldDŨAbiV] VUN4;7wx}sWom4ִaXQȦU蚁oo/װl=n"4š 7!-}~VAөKHrl7.lv#QRN#85:R|[NVJ4e+)۩+۞ ~Ԩr}P5v9^d|_4aL2=MQ\$ qtg ȺG}F~\Hf]5OwGps_%ڝVٕYy*Jqn th2z"TxgyUc,nϥ#zWrc(b9i'Ix&1Q*7y; o4 +m3Q]kZ4݂ M.f|_ّFOPTw^3a;%vV Z\n&_i-M(HIE?!!l߸g_'RQøhF7 CYSh+ް0*ޫl[tG0BQа'”N+Npg"`Mt Aּ}:ؖZlV [/1窣*襧Z3KOjY"=.cwYݵP>2%K]&#O!"8)uD@Լ^,\XM9n$UT4eq5G#ZPƚSzEQvfK;1;Ś>ڨ_8:Ȃퟫ4~rQͽ?_f#mdrdF RI>F)P!SI@0,މ.פ'xW}QK? ]bV ڨ))=Gͳmt [9 ̋Ph~Db[?znn]nn]Ҹ.mV55e6UĎ5Z{cTY*DɈ۔UYВTǐi#>Im @ s6k6~gyvbH[.∎Ӯ=*KMDWSVēR{BOmH8|kՙ74yltg_g"2PlYo&2F̤ qo!fjjqG'3mKL$FXؐK[r6ajd,E>CUc__זn:?hޞX0c3IRL~>ͫഛkF&^'S&4Ԧ1 6Qwݢ8Z#z):`W[~RդegW\[e͎ODk)t dyΪ:5#9vCZ\1E驙2H$,E;hj䍤Ev-3,4w+ 񻠾&L[ګAݤ|iǑK݄$?:nG٬m-lgAL6N('jPz~][slъyjfi*'Gt(1WGB 7.Vӈ6eF&5 )Do5+L|_yMkid`zu*l|k%G_Nkz?:K{߮TQ.G9c>VҨB+q!8f2$ʧOЯ/nnz]ϩ'̬wt/l_o%+[(`)<hܱkP?F,h|wF(v73/2Zdd)_?^=4Nhej8+6q?:Rc*쿋8YQحM?nJq^cDOГ{du ![fgHj \97gq\TJHCcʛ5.Ag8:UPeOLF7[0yܕV!bxp+PxP+V#NwZ D2G,"]v~ȗ#SR$Ĥx<]5`%Nz|HлWx~8-nՋPTiAYGm&^\qZMkjw0>бEBPbͥ+`Dpx.S*g`Zhl1cQ-*; Y^=$Z{mXЌ %0U{C@,;} Ѭ1ۋd9?]veDwdQ$> DBQKOGy^IhCS% S.eG% %yZnqi(8ʲ ~]]^,5BڵԿ=)?668|g]x Ϩ*K'QRJЅ,2M6^F ifeZ #8䎹bPKihUSXm|T-ض (v%}:O]B2ˢ |sιz|\yBhkؔuYҫ)%M?/axMKpDD5t4N nu~ֱͽ{4;ű~GQ-uh͢ZU;_wV׭h,U ĺDzk*UFгx F@N,bN Mde IK2ZѪzA-ŽH&^cjO_΄\wQևzZjn|l}uqr(bG O%tC:{wnډ))VX u6@Fu(Q_=-`ۈH_F1ȞcgUjg_[62QbY** L5ZC,|4VVķR"INFC{SҚGez$ma4 7^۸MseHB|7t!qE m?S >=Ūo2 fy#yk)Q0W eRH-og2L̕CV4ii!Gp1{B}AJ{]6DԠ1)Jވo7-zVWw[~ן~GOI+7KFVڢմn/ :FLkRcғxQ*=G)(O!dϼ+Zh+'h:k_R0kyDԣ8._01ĕxd B =цk5L" E`J`iOyb OC+rYU0ҞFrX2TFo\N Xq ODjt+m:C,NI)VM׽N sa T O R{hc "  B܂ǨnhbՔЌ{Q:a$C˥ a\g0 t?"ŭ6LBQ:Q PI!?zv>*!`nxOOE 5^"/nFx V0ߏ ha5uqNs{k#*-ȵ溉|Q++>/7>r҆d1:Q?_\Q0Խ$NY")Ogo[s j룦r됿>pktZ#H6}mU#Sn@j^%(*nH /kg Z01?Sq y>׿hY OiQ@_?ϳ'>w^xunF'x$}l/{;T(:v(%ҽ{2x?Uժ{O{kWT!,>HA7 $4$vuB#V__udzp,j6??iA:(I觖+㟧N|oS0^^L6g9oye+!;6HƻAc<m3 hKNVj} E[IU ,]o9zjIBk2NҀKAKH,.E y.=ۊmJjjv H >r?2iԋˣUU6.CԢ4 (l"?D x7لVyd"y#V$鵜ZKi:~uGmቷլ~ABҷj+e7 [`NKkb? \p$Vӡ,Ik_qkg/K 4zB'qcmSuڮ524hJh96<_s3iEIc͐lOS<6??("?CF&qr~Oa~JT.'W?D$9Bz(Chtbl`>sk_ù.Xl~{*)W.*WL2 ƭ%[I.ym;CA\'fbA @ۑao>8&#$ [..M${5R+vZ-5zu'bI-pϲVz+4~7}eQE)=5jpGJek6F <:6m:?#AQ~+(^.joDǏ^ߺ^~{߽u~׽1%B,WSnE@څ_Ye irde O^cYVXE+F^??bی,$umc[hW~L5, 8on k p?)WI W~}VB|H#z 7b;A;D js͸] jr4[b:L†յTr߃ȹ> >gV\oĵֺMfI!6$.[O?O/r/􄮥46fFí( ].^B&/{\`|9*-Ay<^_ٔdxz~ =7Pݾx= ~E*(WuT軮M,0%բ䴂GI`!k.O(2HF,xM{_7}kν'j* c0EH[lH!{WF,ʤ$Q99NtQ*#mNJv ԣOq ؑk+_ mCիxtڧ-B4Čζ`eթ6 &={]c!*nċj@#~OCA:5<:E7:βJV+fr}?O}e" %S ,nYlAڝ[|4^}1V2JAuKV=}9{oHKJG7xQmv{K#]Mæ4vRKiҿFW{ıI4?Dc@:WפnB{HfS`)ʩkGEj*VfWY'P#~3}K 1^7&LSˣ; #(  ~:J%AujLްZ~9"oǵp񜆢fv/f.n+a}0?HQH**1ɌߝcB?Cek"@cx|fhVq҉-OM!G>FG}9_K>׺*[x'\ʪKDޠlM[O,'Vz?{TRWA ~U ~gN,WN,Zxn4ơp^$7m{s܇_Ϥ5GvNبܙ: yX cq{:ĭF6T G&pΡH{W"Xq\38s6Io5ͭۅ&L 55,}ByA5P}}Id"9ju>"4R\#1Mr9Y"8)0Nmv9.=_R&2 yk`*Hb\)?(Mu/'M~_7w#V]UXe-AO"l xG~rആ)kaV 璘X7BTm:VLz^WbWw2m$@/r&o~}WכȬ!JK US^^Q&M[ĢRTUS.h2肕x͹ɰYAmxHݧ?kϷ~n.^%~,ʀbǷOl2͕ɾI @i稨cQ?>ѥ̫:Ŵ+ُ>\:1ٶ(3J GꩩZVU!O$.fbI 'wѻvvdqTPRG y񴎴"V.%-y8H[{K)7Wiңk^5=c5\Ͷt5&3V֪n'}?;3}yO7#4tJ;H@S2N z Fc5NT٧dJӖf1'Ъ9'};~J:)6)Fi \ܫ$ҰtfZ>=י8oeoFNJX豲OAyY%&ZB \ʪoy;ouFЦbHSQWwAb 6vːץ;RTeTuZq!q5|NX$!Oyavu:nP pjY&G2ji_d7n?_K]-$q:#24lEi5Q~/|KƎrUsH 3~:C *o}JtV`tcՁ|?Pjdk<ϖTI2M#-#oou .1"3׺$pf B,p0=/abYtAԤZ"w?=Kܗi0oLcj yXj?TQj|8-z5Q:ʾUeĂk̿yܙCr+S[SKQca.WCkbHm6-^{Ζw--'뮦N:QA? |Ɵ8s0G69, Y~BNC ^B;bk0q;x{eji tr"Zrba_H:j\ L1#n5fq-.[n}6֭$𲔮eG$:X&۟'Xe^B/Bj _9< <߉O5{vܟij;rceZMGbqyz`0xT"/7@nxҩWQ砧ϥ,▪9 ~ydVH5&pmo&Wv[#*)GNtDi6 }m GBށ)Z*|t-$?߻;^;n6w09YRrΒ(ixU^C"麳w/q3;ƫ'@$T/9Ii>Wv˳X-,ͤ? }}˽r~$[\.'zj"qѤpG1cN5 , T/~:dŵs3-B!b#P`&]:ͥ}A{7˙êFu g^_I^pՊ4u܈(Mjs > \'':I)Z4Z]nV>P,5 _y"C $),y*yyU B>"QuEZh$WP2Պ1!]g|:Jtۥ;-WbW#]Qj+k"K1f,ӿ?mއX&\l-6,CV])4Bei{r B+H;|u_zÆ EAoCݸ*ܽkUͻᢵD.*cQ x,Јޢ4${{luFʡ|> \'Ut2"B-[S$ney~t%{n./n[NUKvڡj2lܳqhmLӵ,pJ$](j[ݝpeՌUMM>%gǾ(xEut_4ٝcjnkYx|]EO10JVI&fCm}5A[TvT1.Ht2xtU,bUjf?!RMСU["򘖊)2TF,m  Nꗅ}Td#$ȒEb5N4Qڿl}[ hͯO_-+cUd a<"|Num*V=X 4s)W?`PMLbi&vNSw&Gxd{?-jJZh(Fslfkˁ4u!B*m`[ǴrV[,vpjq@Zj 6/@>ب+C`ߒ=HソqjiFSնNYQ$bШ]\1Ph~;]B^j 1+ϳZ ]IR,ZZV'ROO`jwv…6C1(m>*Jc2TL / le!IJWJ(RZvxᘫa϶b۷ c#[5t,dƞo;-{nד\"vBiCjWxu=ѽ5{ ż2v>,}<.ݏ UH Cjkڽy9z\.Ҫ}OYdzru'K $L|i-ZU[J_Y96[&mkej9"Tˉ捻;:ck+qii}ogFJh YCWE흍%>Yu2SxPUVG$=0aS ƒX3($qFۡ+/;tPƎ͍LU=OmAH! \Ҭ1CM5hO[|5޻S>3l\&Z qy*=>堬9*jW4uSeg\fEX ¦LXpM)baT@b񸨣%]PMa UGRH7vmn! $$briQVj@dW+guikj5M4!SP,QU hHSҧI>WN_$IoyM-[lٞ՚wR x"IMY%4-]# SDG6J5Ef2"dk|`"qmoܲ,sO|p- (4.rg]5J0  tPjA»ݧvv#;7<,VM&'!=7\@Njol;TBsroTfdS5/+P+MxVD4qy4B2],hɸc8ΔP W-$,QZJs_YtQ12,JUr''_GgϪLL'li|ݔ9lN']W2rU s F;6'hVF{%Kig'w=v3jfkia秆7VاAX~{5ƻuVӐO* j;9|Y̍$`ʭش( >?[|P'.;/׽7Evaj;Cos9=^s9>`Wi[Y4* ERFF̨xz|X' nerUMOYE@HtZv6k,7EePvTWznm;d P6PTָ#Afoݨ9ߪd_rlsR|e>iSMUYDSXр:TXg|;ULli䤒$kFYDRΊO*EЩO$49Ǔo<[hu([oudOZW$%(k^$um_ ~IwS;/lc vPV MdLe=0ȷ AaԝUS)IW7^:*Zy}[Q5Oaq"Ynf1߉.bVB*?ִǟw[+Ͳ[gKvʱ x㶀tW˝:QɒM6soL|xh%LdRdya$w m&چV YhbIM 5 rI ChC@ G=;˳F+M#@5wGr~e$HX3~%Gͮ 9:pZ7/->n|Ѓ/X}ؓ(htiEOJH1),46'ESx΢R|3<{ LŻ]JIڠ1>9ǏY{:sm)$˸Gq W`*{G/2Q^RslͿLTUt?ĿD*xQ63RDG$CY[E4L]N`~鹂xAMDU<1c=K߸[=ft,Txa#wW{~Kܻl&#l|_'@ch(@iL$.%c<=Sn}rEjdҜAVoU޳JV5vl3k.cuJ"hhNOuOqzRCMz*VgUqTdw c#GMS+Hqk1;]AcjtAPd(!)&sB x'xdޛÆA_6dn-–њ:ϐ)OϠ7;*] O[ufbHNm>=:RcL(wW dX"H^{>IJs.#MlFHxA0(MI#S=LQCXAǦύjk='pASx YV^#sB8-_ntl~R [K7J2BU;rxX ZI7MiMbi!)EHsZW3nqXp7qxY<=ѪG@ @k,( 4D0yn=]?H߽8|D0M4yhKK(d q)eŠhi$rF(?t<3#: Z^\x/VK];Ke-9<Ug6Hj16N*Fא|rFC~},ԻknCQmmۚ)i3J?"mÅG-*luOO[Q-tdK{unBnܛa#B?mWbȱ7RySlk45YUUڨEThϮ* .:*ʬ= KVcrPZ|C#R dQUTS+z MNj{&gou<&'P8ؽi?iVydۇ,tۋru=LkY}49 Z[ U0M\g6@V[RA^h਑niC=K$gDmP bN<^U,t/T_ 7o؛EKGP0jqxnӚioLcw=C[GI_TcMbߛn1H\HGD1( <.F7V-BO&٥YԻo;/Q,~I8鶺EB˥d-Gax)&7,qdE*lǝ}J#Itu:̋5궷*K]P>3/wvWtOzM+UK0ZzS&NFYֵՕ}mML@e3FUfuKMfusGBFuV+ֹy$\{+< *]5pĢK=V{1.nTM 1$kis'qkk-Dh 5?fgE]տؠ6c\q|yBѬ KP!p迫D+m^(@4,rO/ΓɠpIdF 6\VSs 4/Z}ˣ[10IH{k/_GRF,A JcN_73TTSSij%Z/v?#_ FKuv0MZJNQ>aZ$)+ڈe*)O.-^Y^T?Vh7[WrH[2E1[JdFTIY>Gɥ~TrGM8G0Ai(bfЪ"<}/kxW.GBY1\~ۗvkkI5z ˗2;{Wf eo>Ғ:ɑ jV f5*ԧU;)K"QZܑosx9(M"ٛMC_Hy}+\MhD(2iܡ1[ poN*Р!o`=:GfKxRڬ,yGւQ41=Rֿ<!D1I`g:8:kы$F?=yL$v!A&ޓ`-!I_4l b{ߩ2AJ1Þ=aP5Ϩ^}S\ܢS,JB_DvUtW-׽+um͇¨l% ?_^-^@1'׽nƘK4J|1#5*,.}C,IZjQ%i60}v^[ $sϵm+35? *^ b6;蹖ǝ>`F~>n)KZX^@8?Xŷ%!E8a~ AZFM`˧ºF {N}}Jꀰ^y$q?POihjgnk-s#=*pp&_Z)}Ov~}\Y_z}?ֹ X%V-JXV_isk=1i#KϤB ({?Q}>iS8ӝDfBi~[:'0oXuSaoWm* # /mR`kH~}Miuk[=׽-ؐGEkQ{܅ 5{[ܮ|:/kN/ռԓ u"(L4_au1Ӭڕ+`o=jiٹ@ I,9nz4"EM__ `P-S#l eI>> %*|V߀y7oi#$*x^J=Z.͈$鍍b4zUځ,[Ґ7#Mx OٷF JBnڈsb7ù5eߟQl קW2}AVI[xfIT~@pdzT߃h?Ply*5ln h$xkŴWVЙYP+&{\ؑ}ҥ7RnomByXͩ4@A 9>ߛ3+X[0]__K4%) $^r~/ )j$oʛok,'#2@ݰk‡GH9b@&sϵ}>g*̵*sXf^oe#skOǾ0Qo_o=Zj^e3(߸"܏ek- rFмymͿ'cpSN)cYYj:0h맥k#]*-{͹d#'XC~ኃ{ݽCy[%$ S7l3>WFAg!muXs`l-3 !"z+45T}Y>迯{u׺{^{{5+#JG)E{ s$hyTuvcu\H sSo p]:u,}zܩ޽jF"6 bKto؍`$FO/U\S}隶I#?,9#ٍV y_/o&`$:RtҔRVtnXhnsao+p($<\bO5LiW(>#5WTo~J/I -B W?i7?{`|MIg:tAo٧ؐN `[O)<t= \ʪyd,][DZVu^#F҉ :_:TH©ttT+A yi)"Er?6 X }Z1!bKR d>A][H7j*ec$Ϡ_u/ojU$|A~s&5E.Wu ױE$*߰4}~,TM~k:Wr֣#4p%u:\HDC z$mEfSlJR>@% &$&FH</af:I*x=de *c4Ii}м7/ErznM)e,Tq01V HT:otQ,c`Ҥ$~~= Վ&p(;MY%&HeAu6 {k@o b@3X\'٥yFN -AY#B9TloWx!UL~Cm"s"@?}2|M={Ȥ Yh[MWvդ۝* ֱҤ 'JA˧fT%4 ]J$,}I{g8akN9$q`kCAYt \ȑT7*A < ZvX)_NIoP}8+N[ֵ'S zԏKHHbq?Ub~ɨI0Wo ;c5==?T`Tczd#d%e7_l^ XHanm@0Ԭ{I7hTK*p{3&ײ~J]]I@@A M% ^L_W Ȋ yAk5bhaDPUVw*AnomyW̐,ߋ\4bEXHXgW2l,9ꤠV!BAe/.rxӫۛU~*?π|6tj+T ]YL#ّSn/\iǠ\7ڏtؚ3q&m߫BO%uFF}OS$0ue@a[k_j9IٚfVz/9IVD*A)(2]A40b~=P:}*@!E##ضНH =F4j`N>KJX]ؒ!,ʼnu]+OHKzt_s_.,UII7 +X؛<}$fX v, */Ե㏠܅ܨ_6'A7#o^ԂU5,_ cc@KZܞ u $ .a,E$ZߏjV"jqk0:gI'2Gw-FnuAR=&=sjR>W!OL6TY܂_k{s4Yl|k05w~潛af-0Wt#?[{TW^d T4d;YxT?I&zJ*)v3 !(Ap>Ym ]7_5:9hb0`l~F>jR$(}/Hcg7Ny105sfoB$}Gv^ݼ %^BwCq2]]wd',,b,Q,$saUH6?R Gfߘ/d~:=5׽;woS jzq#I BC\\)o{s{G.$UM*cxv-yRP i Gg^qm:x 3DŝBv#^G6.'Ow>]a^4ow>f,|C1t;G{w>Ff|2JY"#3gɎLB=/ƾխ+qD Mm.J I>c^h`0j(]U\%;T<ϧ (&{+oܷױ$#E:t~fuJ N4USg3S52CubwHnΤ. z:yki!4HnYK_=>O5^C͗AVq"/Z'qTUwv:l.bۏB/ THMRgaJT‘Wƞ'kH2[3|wy)52Fjf݈)hƕ} '({Y`*Rgm/7QGd$+J>.9c hO%"Fe~oL}CwiKJdx|s2ըp]D.֟YeZAcN _Mp *T"iVG%Zͽ8J!zSȜ%۸Xjb'k.̖ BC)ٞ T:de%'Ǹ^vyZ tp8hV@iǯ{ WsόMUU,kZJ\[Mhaعnowgy4Ы&skRNs۞& ɰW+ RJmOz6=;'ñ!P|Y8 y .ѷVM? ϋNzmT1frT,+MOF 6V,P؂Zav,$hjqOMT1^yylo9we CV*76bN'=>F2R1*D\+:a_NkعwkO?XFߏM[ "}j(E5j 1"]e{saqهᯍS j5oiBZWa=U7dZdF <&a@A}=p㘭^Hu?qhu0իOy/YO(ZſX:mNJS P2h:?nI%)e,|ljG KGPT%A`l};v(Խ2%#Vj 4F #0^d7+חtiM1[2qoqnSxX*KeuSB]{3ac-!PtQ4q=TiL6AϽ:WS=m_wjJhmSF L:yqgbuKXG%=セ3nM-b=zI0ȀHN 7s\{rf ij w dwp"Z'mؕn8NkVTcu0O173"##0`Y8;_!̴N2<9HHQ=~߷oQfU^ P\>} sܬS;h~կhѡ~=G;c;jmQ%D8lLMOi, tt:hED>c, W6g) =F_ TEhXDC@/DZ|$y5I56\?J=E{=̓Ouw+km#ZPIzWSM69ի咖z[zEgX[j ={ lmߑuGf&6,SzWP2YX{nڹUCSj[\Ud;T\cmuܚ{1A;><Otۑ Uӏ>$z5}SOw_Y=6Gُ5Ȩq 9GV讒ۘu~~MR9Y$F%CYFPjxNL}1q8ZY6bʹaS!͢Bamk߁r ?ZIo+Mzuo-^Gl[kjӈUATp\UxG ѵ~4h]kKZJ)詰2dwE B]GVvތd;<]N d螖mTfCn @q͉ȎX/7-U`H T؃it5^nړC*T( LeUG}ޘ}ISKkqR榒JZ9d?o3r ؓL9~`n$&jӕE!TVPVNde1;]n(m6;-۝qm1]Z)V^4R歧Nm8VKv|NoÐŊ.v?Y* yg)rRSǭĪ)"O8b)4Zldcx&*JDve]z.OQXḿhs;a(bv-PQj{M2C^?skrX#TbJ*-Sdw!4g}uX'j0!e,Ċ'<珼s%0V_X #E%|a)ş^f~Bvuk'}NTa3M+VH|tUi(xן2vfŦs`QK۔5uʊ9%)Gw̑Ą l$>dURƩDJ+VZpޘ[&1聣i+VPTsM6 we;g}:3u{Qd{SOWgw &jo,TF];F!yޖSTi6V够++6؁Z~SS Oj>J)^TKZ1T1 )`Gq5$u?Cd)z>ɛ/arڣ"6ʗ`4{۳hd k綦/ MA\؁Jej5CN%zy1h[7"k6akݨGiH(˩'t) Tt?ٹin!"uffYUT͵1 .feI$/Y[dlԲWnty)1I 5!E("]D@mo2f.oP&2˸CZ ីE?]E\]%k  RIZTp_*_>L|$yV{*h=xfSB,~{7 d8~;S T4 9JHΊ0EF晩ԓU<~xlceD: *DPMX+Wϫ{51E'f^jj9V A **kjFKsϸr{믨i]BhS-#S8(w{sv1sS#eCvImZk^m/A>)|6ZIWWksrL]ֳFr^TԨ CUTfVG]3aoQ?.X]Be_!Ze w=̲;ZMG~ #VA?gʞk<|EW̊(?ݽ8 Y_UKH8?"y$/[7M 4Z:bI(X$PXZ ܩʻ4ɻYm@ri~Y IL{hyӜl |J%4qfoHz/]ֻCs$n d2͏꒻%%DܙYٙr9$vY hco! J9ym[[^&?uϗm-F x~}P5K)DF5^BϤ2 /%IƚDTTG|qULV`@=&Aic־=\m1Q)2PϯΝW-,8O2gSTWt%+eQ{{ڢsWdx P'GeB[]cGzβI&7M2*qSPS&Grca":=IiX骍ݤh]H& "xhyj mTAVF[+/պYYotkf6"i@8fG"D2)urP=]\&%fcPM= W¤>KT5pAٌݲڿ|>ϡuWtmDJY^GeߑeV59Mo#U"F:إB=su^m/MFCo'(TGSLY!0pՖM׵˻Y/t5bmt(洭KK5ڃ-M_/ss|GVawSAOW3mŨ0跆ۛ9eV,&v_i.cxmJzTm˅Cӈ`FzWAJX,.iMK 7!ĩɡORJt%׎#_NNX]Yd[&eteźU=ςl/`e7%D3uwv䛓ܸ,'ܤjR̴nRP?㕍B#+b&[oPtFF;~dㆲ3OXZ1J=@\q}@^D"|Xk|]or[Cb7/K|uܘMk֞LGMg2L5f6DH8*L4LFY͟Ke|v{oGRMD(2E*ITF*X+< Vo`e&tc+3Qي+:*՗WuY,0=wc!"g\uuE>HHG MtdgS6<>WUXwvexՙQS8oksǰ7QmU!h*r8d@]B74xpm7NC}my(vO ZZZ5Dڳ'IX"~==*SW+jdGJ/79u # Xqp$sfsF&#؋$-ӧ)VSVyvQmi4SaMXS] +F,_m75n  EwIv#Mϲoo[sYSW ֙:v9„%ʎ:{ ]]66P8`c5Kx])6!T}AUT7OGh!1ʢQ1I`/kDzHRK .zӮ"]7RYy*rh/*0ETA}OIEM4s u7*ys2LHUGoˇDs#;fh~}FF=]Z\MqEy-衖RC ѽcW&v%$nf i;0<$ O}(ImVQԊӬx캣cZu6eO2aW[~AoQ5-BGm'tH:? 䘸 ζ_?I6Aă9>3SE$hsƔ`,A]K>=fׇL3 Ucڿ]Ua?(8 f*pB)>S%!25+o\KXa>ԇPWAH@-?ca%NT2]G{},JmZrǁfro9[J^ 'Ϯ6a-k {ZRQDQ6VXr}JlqN`)g>?П`'ږ ] m'_2vxS.$YdVL f`-{?}0BbO rE76?tuU'??ŀ.9O\6OJCS=4"J"o.8q1nK\?oxJ#_*Bb[ oSQpOOȹ:V55dֹi wE(867{"m4d ?U'n//%mhe_">#U[:z$!_c_#O CmD6_E8tVچ4Y}jWBR0-bspTX_=ʠAIZA`~νF:m?+־/uOma*Kbm"%?>ໆz笔iW:(NkԂ/R/9h_?yco]?Wz@+vB`|p깵܏1t^ 6yRbYnUmF~Σm'Q\6BDI*H)nn =dM;F/牖~4.{}?A<r#^\8›"W=TRZETDՒ\@2<=7qӞBy bбE0ډG*Zύ)= G))YFJG'S-˦p]EʇP JAU?Co40\N ՙۑKqǧrFc?~}W ,. k>AGg(ŔŇMnX[_|]]8ͭsG[IKUy^ˎ`mbHl~}ϳhl`qf!Gԟxg*\\0&U}modzXh,cmb,>_۟`q`bkU)ݍDrJH7Ml6Egov?OV2p^ @DrkՏ7{"PF JH ?#Q&Kru>666k{\U2) Og ݿ>oAwI?O"ٍo~,?>.? M` 2+.GF]HQvS}M'OD%Ux[^5RI< nPōt.a4FjtQ6hTG4*`8WF#[Ec:+ є>StT3NH/`Oy45sR*Xj!bnd?^ L$RGVRp[8`m]m7hN<ސ5* yZ%!1V@j`_}=I46hK]@&a|Wi,#צJ5N[!OSK*?O6'WqѤeF[V=J=$6Q%MnZ$}7"bM>ËCLd}?_CzV,[=%Nl ܕ&E Ĩ lHZNQz@$)oW~x-mH_;F NzBU ѲU(ʷ e#{k6]] mrB؎Gߛ YJݻijt$aJ\ZY3"R+#ŀҵ[rzf߸,@1u+o~=Gr?L㞐IlVsE/TQ2# !VEͮ=l;:4i5ՍbiK%)χ"ʇQW}O OuS@GB U0-xhxG!^XmEajob-r$cTg/*XyWU M6Q"3\ߒOi!J_W^ְUt?.)O|tW-+?+)^M/,҆+kc;>ݏ7OH*$=B7o^9 ҿeq(ίYNh<|71&ےok:=(fZpH"P`9 G+xg$j7LF`O h#6>AQ[##Te@7#S,Ѻ< T #9y @tA;n%\P-bM [1OCmTO ky&V ÷Y#IeX$B,zJ _?`iRHKbRXA?_a."1&?^]R{gAV1Yk),,u]x^}o}Bj66Jp1@K/=-"=&Ϩ ^RE"j^k I͜ÓVA*F86U\#-iiK$?[%1G4Ԫ.qիY:ȹ- vJS$v-qw(QUrGNcYӤl`cFnϵڞ4 WF+8@W"ߓϰ[?Ϣ顒IAUZ뺸5蔫,.aahD/!* =#L|HbH^"tF2lXE1W>$L SXij$" 2 &%7 !UQS4TdR* X-_b. )ο7,k,f2z~Æy!IDHUMH:W>rk6ΐo>ƶ4DGeӡkեA,Uz}dȵHVA~VR'?ǤrWmS ܻ9/}+skYM}  %_Bn'_khxztefF'g!Ѣ2+:rUq3kAHr?H\lNxO/Ѡ) @c{rNA{ʀy>܉S$=ϡ, PEl,X n?:oٔ*zfE(Xg\HHO〤WP,K_gҿbok#CBzb:~b /$4ahv]UWȷ) amDr=+; eҊ{z"a۶-{_l ՝] M[_LOi%tŵp8 {^MϿL<@ }NGWҀ c?!9nmWm Wqv{ΧjҽCT$"j@qٗn,U34lήU5-Kf>q B1WQ;{^&sݧwNC1t稞qͬ!.|QoYɷ}u Y{NU'S>_ 'M՗UgfU}XOr>)wcu͑QJB?p1$ۣ^ <)/ǵv",fEriUN"|ʭwQfױĞW\2gp5z󻜽c7on&*{6ЭJ Ś{H]JHX[ISxf`V8|t#b(tΈO mqW;wwJ5uUwtҵ8[$WJ]TՃ»~Q汓=l~HXꏤ'i&Έh(dj#֧†M$ g! aqﻀ-QVvutO#NFԮ%Pipc}:K`{'goŞ{"zݸ3Kꤤب5Y.tytI*傣.cc0=D`OJ}3j+^ dlܹ,k8MQ|+:~?pJʤ荊Ijӵ;Ih@QOYHS#,k:M~ьBV^ h?gXߺمs%+G@][J=Sī jVG*T+#YPE>;m7`)^\qTط]ŵ†~--/yݺsԟ-=)>^@ֳ)sap;pb%hE7gxEV/آy.(v_> YJhx|:."_=SfSH%Fi "^䀬Rܐ 3~{żڍx*'I+nss 4Ja# WE׸'=Q׸mC$֫T~4"MQ,q%nI|}P Y:}MϜWqGt`q+|9↪jP<VRt)Myt;'GK6ZLyj:վdI \"?%YA\s6;nY,>izy[4K5VZ^%Rk93[o5ս%x@ ZYΚ6!&~B5*hd*x G>wUS$Q)!^ʥQTK1{:|ش}yqQC ch㆕[)_6u52Y +\n@u{{w1G¶NedsWQ ݪənf&?>k}OhwIuZ =eUVy ]25.$;:[GuRNz,5`0.LQWXcnfҪRnApM9o$a Vj40y3o]ߎٴS?Od3*iC iAK %-ssV,J$+EYT=m/f6z^^H:TGz:[o[k~b V?[D)D1Y~⮳R10lߋݑy\._౤R#RcZFX/eҌEp]p92)Cڤ}`;< tBWFpI<`WAt=H>_gܼ4~_,?w:{No 3Ȱ*Gh^~슭^¾ŽJX"qMɖ R/E@{x&$o j*(eTMnJ!5/XQ5$ ׍OˣVv[iΉi"B7Pk:W+ji:k9I6 H+3QAS@@i574_wL =4Ȏʺ5*R{s=c{rD:x`NQ0r{tɸ,[@:j &Ϯ:u m-Ūݸ,S5CQ4&&*ԴRF}=>٩Yp&gTR#j [2qo>n{;NAz r;_1ͺu1+n=Ε?bi=q=O)ht)1"$ok6x1ۆqRBZG4K6 6U*Bn ۯ}rܡFUb>#mZ(=zʎASc #(VtSi+jk.͛?ilnZrq$Z&TUᔳi6fIekvQTJ]lR', >um&gr)0:j|ԍqn!&X=ͤ\PӣZЉ"1H#>2MGѧI{soUuV )SIJbm+q=Vp9+T"gNՌJhKvenf7L4*8礶)va:ЮJ5l>ZiU#KXY=]caq~gksj|6B]kt-cKmKv3Hcl_G}qsraoӦ$W3@9^|?YwUrX\%~oIzjZ zT`F GT>E$D[@ǽ(j'6;Z8iqk%Ƞ4=@z{<6Cn`C<"|N"3rq{(DB<F'UPSSA"\(m,Yx)YmsC+p%jg_>//#@DFHƫ]kk~z vQ#r敠"v[ͬﲈz1][VejEDw1JQӠZDbTe]i!6,iCj'x7)񧬱WqvU+$*voƞ(fi8ȴ̬|uٯi*DJj>poNjRxp%]h9@F_gz"fNޙ]1}(Xn's]\&~D*j0 5v/d[nlݭޏ-2e!W&MM# ^o6nv|{D/x*/{1=ZPȭ>fvWv;w(PUI%VNOD+{W|mϑ;xs6&Z@du>Ξ905C,ɸ|i#!Y&F#s2,[tV`8Mv^?9W2u8Ϭ]"jfj($w$pX-X[s Dž੣OTBGVH2ሊ,`/xǖ]'H@b]r+\~1P͚ RqHLRRt*]j+C¼8ik3v,dH"S%jiUI,jc(H >B 퓥&) A:Ձ؋ۻv~q B]˙"Dфbzm?l*i URLE](#`r n 9mc̫AiD:ӷbR,v-̼\ rNj8ng;[9nMKs56*p="ۘM ` L#I۰g|l3䨡)+bzX@kP U|pl.Gn-GFR! Q}$:@ y$BF%khlDN;domgot=5[F7'ӿޢ\V3,sTd+ 0yE*đ7LWв*SE/ rGH#s\-`/ow{ mWΊIT*gk廽9w.y  1W`-sN$FNOmXO&؞$Pd*i!ԾI)gf]4x6YAyjyyZ 5:$SS,(p=h{1>ݶrqmG=HX5cB{ډ,ktͽU {O@ӈ'm-}4{slXi058^ɝ&8!eG̟#Tc6D⫳8jՄ(T%1S2A+`y|}OC>h=c7emQcجޙhĻZ\g lE@H[F^a0⡡XɺҪ044N2*"z>lq϶Vi?o~ޗƁm-BpkAWiҫogL.ʃ;j]l;-tKY(i7CnU@Odڈ21abe]^rV۹Bd= vZ3ʓt|>kk5{>Kqc1lVqXZjiOآEQ`yD__qrtAESUFAZSDҬIXXjbMNE͞m|wImT2;+kquwSۣmǙ(Rb{$ 5cnGhvSOrKW$cF@fUN"ZUZ/EGݡu6$n@k_Os5I1TXxp>U#Ȟ>`SރqH$"AXlmYE"UQ9>ҁ!`yXGq'@A@:^X_Z&Gh"`0cH$<ǰoɂ v&AQhE=H᪅ECk ׍~>yj2}]G*1FH涠64,dHv&+TҵmҤ#۹?Gc%}=VnzWeFݭ x皔N梦X":5+pAKQ=rPIV4yXPGP E\I vInXqZWQTF~$K#׈jcr$5޽1ٻYH0ƘLI.ZWGu!T{e%MBX#wEjDY~ѲD {ۘ5PI  #qO/O%էJ*M'bPmKmۼ^[Y+9 YX7>1ɦXPWU!;wk򚽦9T2f䕔p 2W]ZQK< T7U0ZyѓCg`VW:z'noފǾ#IlO}mQ6 Y+ӚI*Na<~OÊm˸6MVɫndSCRGFjH2<,U٭qm@O[^K>0*z)N1~-EfͿeܻ+YڝO؛9C4ut~lkYG,L5 5l6vjˁQOAv6xlN]AouuzȧI#i=Pj<]L 3w3/qJP[@/b흿[b:|og+DpC4)v qcMB'HYgwD 9Ğzgx1;kTR6S $HIa|LmQ# }'ӧvX%=9$0E àuϝ8Eʲf5_/gTIKcr{۠ۓnRhI*"T;CqƬ6[꿴ƌ6&Z:o n8eSU 6EXҥA 8Q;n73,=Q<%HԊ%WҝV) d^/t /[rm=OE][ٛCh0[hUEkFTE5رxK)۱։1Y8XzrXխIYYN'IPo]F`{+3##Ϟ:|M e <>mWҟ&v7mv[WJ8}۶edܱ*(ftIâOeijr5 IXI%<SHapRl֖jri^GSW;"U؛oT%nSVij XᮢRgbt#ݙH 2ze٨;[YT'F/1I$u4PVfsI#,ummU'pU9'^>?LZx 2(ˎWN7E\v{+jðv:͹ÖJ|V#e*bK 1,F}}MCo(Jjzw2cE5+Af(:_Q2@ھ-QG^_9?#TR=nZq2zO`1 _z(2ym1GP$H!"YlIBĊ5i@_omݺ>ΖX#CV!4e "ߧO6ryLӏG5F4?G '-rfLt`IR0GJZUZE季ѧ\3^@XxtH19ej{GȺG7->ًpIQǥPtBX|fZ:+MN+$h @#FjhCu+P f7W&`ǴhG(foO=|â'|(/سTX-=GN j& AGZ=ϛ۶JAFd#7bt#Pssor׳Ia{^4_/ɯԐ\삏ϻC/f,)} kj~}b/T*6$d0'tISx&brT}A CkT %AW;~ ϵ*[  ܵ/H#R~_Y^ޣ{XӁ΃*bt`MˏٴRD$U|O=_C?8>tK[ "MVַgh~6=)k@c-~x&ċ\[ֿz"Jn??G2\9Z_eEun%X0a?7B؂W_1Cw"`},ʠ-c«i}oyPm<\D0%S ^%J~/ד {R"7 ׋oe/ZhAҝ{["_>4vb)vGeju5">  ^@'³`ueZ 6* }8Ssk-nG$OnE)ɐe6t>WyXoh|<[crC_oſ}6= zژrok7=+;r8< -ž }5Rzm27@ WAn6zQ}B$( bmoϻ8)SxFZ3<7_E9&`4}GL~}FY&'=wmEM.I~iy^?]ȸ}?H>?JB@M=ż%vz|:}~_AM?JzE.Hir[j[GYRcUP5<p5k\{+ QW8At0u ٬uʿV[?<{3Xrjam ]EHk5=Tة pR z}TT B6b4`W%ٿQYWsـW|+t1K%U ݇x"}wZdžUž9*?o+~"PP=(vQi%ETb5xeqʡ$ 8*٭~Gq2J5+yu8tmp8&r,$/xׂE^ISZ_U=۾)N3Е `A`zh-K`PWgVBJhݴ9 -~$q6IbŀkE䰶#iaraGFעYVOӀC[Ms6r5` pOo#Pފ7 `megsᲖaobuT]~UܟW{+: 1*g(51bP?S{4ckF2C:M-j7{e-N`*F: mWӥK ߞ?T{Ve&9rKqs&;1iF t>5('u=929bViR`-~y?{D . ݬL8M<ߠw^~{߽u~׽ߺ^~{U jm^XQaeFk \b%Ak,zoT@6o ⠊rO)^.6asJ[,^7Ӟ{&9ChDѥtϿ.je~7[{4&Ҳt?~/>3t@gktUo: Zfk4x?KskO]Y$ NH6'-oIm$؎I+ x%oQ:Nsr.ǎ֩OE:JWHdd ՂF_k} ʡ/LZsu JKOe[~`/vKr%ظP?ßfn Ԍ fb  O7uRc:t"UB4Vd!orH=u>pGTj d=@p?1Mk^>R?nH l:Jj 'Te6+*,[]}LXdzIJyّAQk)QfbS> bl9[uB4 ,&OW$'7U2C`I,Mʎ(c{Ma `ofc7ѿFV4h,tu>-Ll{u<7A o$g.[OIrQRcHr|fU><ϳ33jJ(koՉ$ WԏqE=8/0tĚGI֮'mF8٣ \iVZH>ӫYfi$Qo;{i +LzW\:,PפJT*e#Tb3Z턻ݹ/q!+F]'xhB)@5WLMD6kcȺd NWVҿOW5".MɻJ~M8ځ)/GDq]t, F>ߑbb 5X9". \#ZUO/AЈ\"JIOR4uu iKqvEqs%,$IR J[FP8 LJ b.uOMρ>El,'.+{qx_!t[}ZobI:uO> K(ePڋ!a6<{NÎqҞHc/R;FeY *+yؙ"S*H4*B@$zE{ A >D@Ge1STT1"udfYT[vY j(egbV>OVpz |PW2ztt)(ݜԸbGTFXRSEđcYA'm"yo̚$aJ YԤ{zi$uWp3.-^8}a]N2 ܨ R嬭cb>iZSuPPuj{&׏YGp)c}ϊdPW\zC*#Ie}\p?OlH.##?]lR_U )K3`Iw(D t5ɩk 63!BhG ӯi?~|]'3 uУmL4_b55*4QxEQS\KB]"]Y`G>F֒4K W[Jԇ(ZZ'uV8yTGK*)UI[xyQA $b 3,KXTu,.8>}H4|H'7 & tȁhԤl{~}C3_I'`)f/mZJkX.y1m7G{)$ӡoRsOyo"ADڽ%niZC1 4dkX8:$yeT#me 1*U#]'A*/amJx'Wԑsc?gIfֹUe82- 0{5Xj?q޾C H3}_aEֺ}J}'Q<7{ :+tRUb}XKn21ny.=K>~}jj_Ҡ_E{pukENtV;@ pMQo'/9tI7\2y%<N_[7+K%b<ˬ>s;bdF? `p[e6}{kY+c X}XOŬ/lvqvWtwݽQSUCHA u+AyX6|4I;4Wo\'>s;RHN-@uIDeV:ͮ\nUVUYy4JѨ( CK-ʱ.R=kҝl~ԓ4:]i_\\o~˧WUo|PԱY' d 0S{eP'Rథ1HR.r#}7;ti5>57եśK2?#R^{65FP*i <  MZ{k 纉& Hĉ 2)j̭#k}}<ۦح+ݖ7żS#y3ja>,hh֕@⣤Xxq$,()dd35DI,SJyBAz2w~Wo-LT&%hѵMqcKzC I?Oi9x;΄[{uz70򥝭Z[l/GeZW_? 1Н]U*\&Wː(E}TK$Sƈ*I)*Xl=OO%>4)Shr7dd_ka۶ymDaTy{V,h)+kو޻rBcr-]LB?Ĩc˞, $}8q/t &fw;cGlۦ;N_J֠|Xe4[UUo 鞧`CGW̋O^$zfDi…OsU6G[ <4|4_>Sᚗm;knK|X֒m.Τ 9l߉RO17ch u+0C_Nl%muE_c3FJFu~t d -amtޮ2 jcYO'h/3sH69WCOF*Tx xDuϾasԼ42*:KW[^?ǡ$n<]<6H$UMWzN=6NWkצFe뇞=e'֒+h+`kրF)֒)-%TH}GU'>e+n2-,Wze6vṵ4Y˔=5,`cg(N}R_!7h+^s>*jc,ӑH#ryn@{>=OϺ9+34l c=@ VF6}$mܠ!(ҤhS^슆P߂8m5h˚vFS(\2@iF*}[ ǝ9㔶ykgU5zԟBkÏ~lt&I3ًTbקP(UPTUX*=-36kNlPOpF*³0hCnI_#\w[k/:[z;ckk[h%A\IxtyJg1D.)pM_!feC@3j>{ f[vI`W-+i v_2uSQn޹w-ݺZB"+<73J:xrU_jV(Ɩv66(zGt|mt3Ecs'xI(A>.zwGh.THBy`'^)k{vq0 (&__>CVvnݑOpxivBGI4TRĺ({Zmbad$bhS& 05D$BG-;.϶wxw5x9 g:P(W@*i6{CO_ ΖA51_Î6'wɍ;}7F F+Yl%m dEt VEVP5]v0z#$ݧoYaUn-}D_y`v)dTלw(Џhs!S4Jf_]$|\z/= &`(2=JSMIRG n2-,{~sy}гVl QH?9hnvi~@<_Ug7ךm"8m& q*+?:oyoݝp8j-8 RVtj(ITu X>>77-IIZhXCO\+C"Tm<\ǵ>ų7vW{s5ƊT$#Y+Ƹ4]MljN[+Qi2▿_~MոB큓\I,)-(h(u,!S8D }mi2"qr7~S\š;ƊIXgXd-ncbUT%P惇:moin9~=]r+0)"jj5eUPM=S??(k׹Vl"C*K9u ij'KQ;2(0?bKJ +1,r,Ȝ-S7ll!P;Z0Q,ٶ=WTgmzb 9($`6 _%>٢I{&6nW$}&\-PZ%n=N]XgLRhݪ$,zXj<<{^s[H+I4էKh~}b1l߹[c%D4Ԑu ?&z/^<_T6ܬg(WHtCFrs~3m)!C)Wi1Ǩ+T>GYa[xcjPWI$SgrP͊g* ;W٣~=I4y,V_nSA8=lj'%f.|'=S'ۨ2LnMƞf$W1 &H xmߕj#'nBNRF._jEFj1?jqr113AYLM&q`ŝ -6i3Z,JY#RNYܝK7랟P6F"$pc' Lji"5x`T*ge} q̺E^'c G0QltRk.b]h2|W WEՒEz7"juAu U>:Eo (i Asat_u>۾sbgӳdV͑y1W{\{.oe/fk{ĤknW WVoI̗11iMYѩĒMEC|n>=Yӱ#N=w+ 6VЁ*ب7{F1dHbnU{;ll[D"Rɐ)!*$m&cbCiwn<*VXPj?raHj(dDnOhwWjnzǂ8>x,0n:?)A7}:ee7bIɬn$m9H}YljcOi,;{n\ŹPCx$asAPH$q(;gv6C{)ݻ/&ق* l F`nĤU^I#2M*RKgiNn>AINYB R9,FrK*uc-l i0/hmr53мOCpo9|LkB ]5jκu>nK/1n,igUJTds;huRmpIf0R[ F]͕cLO6ZXcL "e|-W ) ] }l7xZkau*Q^onrn{1 u`&sL>?nmߒ__6?v^7~A1Ua+{-6a% * 9:Y.?$]rISd+bCNPSWSLdXn}eS:@0*@/]ZP -\yt 9Wݲ 7kb|)9 eoE4-Nmʟ7Xi+ 8KŖ OC'HjGю?knl&fSfjj)ihcIRY =9 3,W*@GsجZx'ETu{ `e>axXeaY4fZ)uVeh &ߟ?*;?`vu__WEf?S1&C+Y\ WFsAU-7Օ4uiLN I?uI=)fg~~4P*j{~4}\Ҡ ̿HEuJ)';@5৩߮6Wm,fn Mnߘ؃5z:2*Hr!kiTuWzqHUTLښ^)dOJ*]U@-Sm߫%$I*ど qVk廒y8Б5`TӪ6Zp1S _b?%]Sx+2y#JVRҚl[)#]YVRzWSQ#{v%Aґun} ٩b'ht]TU,Y#qbGg5OMGfr,CEܽ>#+ i# -@xSˍOR'Soܖ'0+i5>U: 7^mCUKVSUTHZXpXQ1b9}Yᠣi5Kq%7^VLiysXZԚ8ᎲϕySg}(>ʧ%3:qq7UylgDo.@#CI nP+.=χjeq?ɐIBJ%i"9Q̀yVn41s05(d5y+R/Y݊C T1bbVg=?i XCŘov-lu6i"yϕI?YP(.}@Mmۭ\[3 פt d#NaGn޽q04oi*qpYˣҠ{M\SQLj`8HcjRI"҂PIjVܟs-4?[%zPtF; ݣd\.P*޿1/./&7)/"ƂocwMYטAg[2VḨK$pi kX9zEv;9cƼp1Z X:!y!܎ͫ]\,<[4ѱ4 S{#»֠H]/i#׹9!|LC=b-8Vy&iJyop<-𘷋!2Ѡk@*tzЦkE&TB(ݿoyfUd0]ͷ11g)9[SM )<2P]M*KjGU6m$hcj24Fb.C/ŜɶZvBe*4 Aþ'Ȓ0eF_tWRUnogr\|8\Q9hSCGpU*`[0/)arۈUS[()IZQ{y.D%a]~pq"-NŠ4'z>diݰng|յ3}&X&ZZ|I=(mzu\;?1}Y 4tiI23,A1R:8I>'I+{}H*lVY^H]KANQSJ4a M 2^9" R58 ݧRJKOH^3tU5Oܙ*M c*::32',qHGэYicYcA+TRʎj`žg[r.A}ɧ>or#$[POvXK%{1NEŽ普"sCyƼ6_ m}(qj_I$R4N$BJeZ݅c=FoGuݭi|DIz7^qi4uH,:Mm! -nH-1K8nA4p8j07 )PY-{v(\~[?KD /t{uAvk~?RYO(rϢ#]$ڤ t[)&MahHTam r?4A P}{9*gFvH}X # zi>ޠ@^?A'Gcw#Iďn0tE?$P}5,"Uz9&s" 9{ٔ7=!8*~~ޓ1CP2oֹ::#GVF"P<{[ep&8M}KSfwC)Vn. 6?_ysdEŬ/kE~Ω%F?K)oM@Sq38ckrtZߓ6R jҤt2,ds{1?[ks(X o6ij\i)K뎢Kjoǎoc'H"H9a]upE,W:2geEI/#9*H^C2Fe?YT@G,==Kn?HM$_?:( <1<[#Ou:cy/z?H}כaxUE*anO7 ďУT_>kdIe2n䬓Fm`A{>ٷfDVDjkYGG۴?G?C#0ۯ'*~u%.íc2S bI7$}Mɢc: \7{AqcϨHXj[{qCQ+3C ɤJp@ۏgo|v8DFk P _H?o4ƍKȾU?STWT}W&,?k$DZCe~E-U&( ,xp>xopbG1YHk^nggO#ٽB.n?^G !-ZJxt~֗ A%BhCk"DLq(AR6zmÄE>ԓѧCcԅ\؅7&{J\u+)*\^?OڻG6c"jR+ý)6 MUHfdr4Vyѣ۟dVFm/D[.GokTK:ϥ fGl?R >@}$فoe?R|b^ٔS u%iПCEYj '*$G[spNnIQsq[Jc? cTm{2uR> 7,?e(eu-9䋞8}y܍P͕?Е'EO,L ^W^QU<)^ q/kہV?[k+/n9=vL |QN@EއϾqQU1}}ټYPti)E=q1`Hǝ ؏Zpnx$#K}I}zMGЊqDߴ66 _BvLZ:<,H~ }p%@&c\]8^~{߽u~׽ߺ^~{rx$gHU^C~}nAM joҧGqjGT4mq\aݤ^ ߫r@6ɹ?uhP/{r] L ttJLV7A[Vϳ9,Ai`P?ב@K0_oϣ0+u)4]?ȸSB!HFG6ߏDzm gE|H|"[5H\8&؏E iaАM͏~?hQpv }yi{V`>kdzesxdd'AGyIY̏Po)ڒV9Gg!W)lH,Eί͸jԡ`5Xdʹ%?<_>C1|#2pKOi6$iPYTV&LJvpI*(=",X`ooݥKv(jcjʸi6|v1 }ɪʎ 'Z>gR=%2G:)H1&^)J'\j:M$M+p ,x6?}_\]{&8,łVA$>BOH8꼋d7r Rsc@SԒ8]$P6Q&fT12 1ԄkܠQmC0XNdoP7Z@㟯Kx>oEBF5u?A`;(2ߗkmOs5e -caoq"LuyUh6;~\r (U!Y,Oכښ:p-`f`lE`QtJ`dQ\9eR*$6@M#ku]L m㟧 LtޔWWY#zEe]*(YQnƶi3b~o9c^0Nu@V0X[7ǿlb?ShzAdƺ]@<`sZhC`^ęoiv_#StQ$+UudHUD7G'ѹ*nbkp.nA`>$OX BWR@,Z-ML6qWvw!~XjjT:Մ3WD2ki4ծ47uf֫}>iA$Eėep"7rJSJz}ʽ8i='A Dhܮ@n b6@$`I[4۟ m>щ6+gU,HoUA%{/O3j-~ h6X!#`ycѼ(VEuӬ+f,%\bnN9x>7EVmP N4]aYCqaWŏáD f$R97_>soe^YS;{k c<|N?Fem 3pJҤ svdrb"J;t(!]E A>=nooqQ,\hN޺q9nPWqڣ5L~R?u [KojA;HgݖX(k6p}\GP+8|gXϾn0;d|Jzty}ECN)X]V@ɤ4+C\{ܚIYܞ/te-4Mziff'3Da.KUj@rm>m c\x/?JyKe4fi8hTs,VCE`$(,ŽC[ey# FTF|۰ۍYlT1F<5zOY*ѕ  &} fF]$tã~Z'AjYr{ݵ|P?vK[a : fME|^8cc`)y;V&3P?3NmVm::I鎛sWQO  }b_/o4/ *R^(<GI ey5h"IoFC+zF/3|zog56>r$$5-_#%õ^x8Қ/=]j.25JJ~ SZ_* ͸q)&Z9re>6N~(K,=sl {qlZNs~gbiCqPTt{?:!:9`:5bsF5Rے@4>|[Y$_:_Ҡ|J4 s\A0f_#}k:B^ڻZÜhy#I?ަR{v|mn?%G7j""B^5*x[1$p;u+68+<ЮcKʃ|#SA2ca6/*N":|V!TAB33Rԫ,@ W^~@Ի)+]^>?)]l;; !%-Yѡ c2+Uu SW6EmܫAwuEX'OvIUרlc$RjѦAāO|.? UY_6^F99O^(Mu+;{2qRz]JNJ#HTK܀B9;հ.FSwK0a%u5zr(6+vGGPY_CV/iGo0#UQ7㭠bZerY!IrYC쏜x=ǽKКq@ 顄SȐR`~|n?iII\V=xj{h~,u&a[V|HB ӦgDqت (&)GI$":ZB !RḎB=xآHj#,H-<0E9p 繿ux={f,^`٦׷Yxt/杖٭p2[I)zj=3UV]NiVR 4j"'+ , <߃Aܻ=lJ c2Rh2Kh^?crtxmk,q^mG4q6@.h4&W#{{[YhBu-(j J56F- TWG5Eմtթ֩$BH3px_,#~ AUb<-s1iB׹Yu[;3B@L|<2+΢oȷҿA瞜Ujf#\dtpHsj&ezD¨䂶oghl~5 jU&R4tt 4&hO.oy7f绹ȋon`kYڦ)zj m7!cҵjh`t $Ъ@i֬k/54QTj 1tՋU7feb;'6F9)@cLi%޲ ] *[ߛݖ[݉= Vicڎ_7QpqJE( @JfMX 9ڝ7Vn%m7,w'O&kpTd\Rb]$p#_U?igy\|&Z2RJL#-e&=mb6HHl߬.'XkFFY ZP Sßw9/w;~g>*ZU@Z$(5-nvKvM.5E;>ltTx|٨ D T`~ݣ]9ݫedܢCT6ZYAqUJj*6כf" _UcY1 U?L!ҎVcc͆ky.x(2ПJ6(2>An`w^;js;o)hvSh"CMڻi%Z( VT[-X@:t۾r\F)aU#2T "E s3zlϰ-G9! w-%( |FH)s81lח۔S5;48@5:B4]A&v NSNJ|~KKQ:b*Xo}!F3zl|VL^rc"o,IKXJ\X=/Y"\ &b*;mu[E+#$Y@ iP:5a/]n> 3poݑ?mx)mfBuT SI@*_E#}(}!VVY吰"7 d]ѡ`C3_]@F^@BDn{hV2QFSJ^))CJK|u0R6WץM18\41GXZ}T$X WLT4CP5Đp8ix)[9^w-g3I2vdi詡Gk%RN]~=5ւ$q{hH (h=:/ fI9e=Ԍ(tւrzͯzGrV'ÍSVfhp~&(2ScdcJ(cs6H&g%%бG:Ș6>z×wMjMu #OR)AQNL..ضk rWzmO\=Ǻ\F==\LThj-}gY&zm2 S8Ԃn r@Yro8oכypV/* ~ ҃>'OіkwNqos0K3IIAPh0<~'Dζ][YQԽ;K]`l~=;g18lG)KlԿTX=drB4i8 2J"$]D@߲-i{faы q7otgmַv:-esxIEM+H-dC$ӕmvXnm^gemquUb: M5*H.#ZIٰ4g| {gsg [R&6muM*J&_꦳[uno[xT͛>.]Rxex[o5P=OUPѩ*K57"  gڬiNEk3Li#6Zj$ROXϗΜ3-6ϐC/,$Q$@{0F<vWsY=5PpHX@W#OU : (S%Sk:}}nI?uVR4/zyb[Z*ͫ_/?5] Y|b<4_0pYO52&ޟxxXӬJUGGh ȱu$ ,>w-pk], e,~&&55J럄?oBf/)'57cUUx 6}l{MӐ/67.̰UA"Ϭvre*}K+cqV c'8̳ãLV:3]^by L,0ÚE=TSʁbRDf 9ZrRA%f}<RdHAW4򌁌dۋFvB-i5RE/ҼsǣK|N?oϣÍT.}MWG?bd։5V'4* G$ llo:Z:QZɪ>уɥa _ ~?۞lwFVA2tV@n@Vd2H"#e+:zi-,q WInC-p*uEF _!}K-ogv|mݤj[REJpk҇jV#tGَhŜ!p$Jf>OpBqM&>H)[% 3txp^C@˕4f+1. OHR5 _JP[207}@ U^F*U#Uq4B%~W$~s0q~#=4T( 7IG--DY%uz:jjt}Equz~A _ij1p .BkDJToH?Q6v{<&鄲e*Б}ۏ@4*_jj{,\]^+ptpJ[WN4Y8QlpܝFA&f-,TAXeͣZ"%b ŗnk>k3aOUnsO>Җ#W[aɑb~q*s"Jj(* 2/*I5->[͉cw|?u@df^|#;tcvWddQ-JW:`0X*"3$$2.^_O*Di:$/I0CK"41YbH*jpCz S6o{0e t1[?g8\ܟҏ= GcSG&C Y=m5tȯ,LHUUhm VE.>?xF:"J\x`O#3,+N뎓]ȶMq2ո}}ٸwDpeU*gYD$qLBhT#UM 藂:**i1yHE###5H@Z5nd7agUVN*ZS EC.ƿw1O1X+7$NʫwKISCEݘv;=sM)ED BM/UԆN {˿d9"ۮ&6YUITJ\>kq^a7v{]k?'w;K_*(4bBVy IvRrځ:oM&ٯH:LK^y{޵0xRozbK.u(iWX)\qŬ?[&e&܂e'K_b@t sTHE$[|Y5TexD. <03zo,H$o8ye@1ؑQc ^'I(V<@:}O{GA"JE @rA_#{m"$/Cn_]3\tZ[X}8nqemӁdf'cah̀ sb ڮ 0z1( . ~C~,9P[؟&cTw =ǨSoMzPiQJ ~,WӞ~C^9NCXAO|&! @Uo,?M$ԃ;5'ώ=TP:ԟ?Sޢ[2b]Cy H-p-=P\[ eRHL#ްdVQݧ?oNpRuhVyp=J6*Ma7܏S-xuyHY8ȷ?HX%,@5I!8^"A=g7uo#H$9mU_"50E7XōQƆ脘\ÛǴNRzEۖI<={E-ܽ\8_Sb?}-z1b ZGĐ {moF la'so/IV>_CE:ѧW]j?~_ҥi`!U@6#H,%nQ157o(jݧU:ޯtf҆rD΢qQSVx xSt&Pn=:I~Y |]eڧ:Yw#<f~wl_ I"EfsghVR:1S* ahZFYI㟲-r FUc{7%䪎jZ?0BuA%X?^H ӪM aIq odOK OWzlP5ӠsrET&f$Bt6an.ݥEMGBY_csv'ny}xit¿Ӥ[IU:szݛr\8抝bcJusas5hI'D`pBE#ed5 zqkRI)饂E)"z(,.,.5HkY#mci_KUhoJz^]0$HҺ%ڏw~SHU,lak{@Y~lF*pS,b۞y#*nOJBT 6$\[AofDI%FaTȋZVb)5 {.Y*HlֻXTqD ='@WɺqtQ-b>OG3)w8,NeϠ ߷1|!P&z~OW\sc3ôZ}>Io;0iܕ`Y vqqF?AGzyJ2t0胯{u׺{^{{uL|[\.́ s=IEQz=v B:r3IH1FFS- C*J:u [0A7TSbA`#o{.B<:ӥpHMLMɱ_cofSfԀ @ YϵmVZ4|Ѩ?^?AVhfs%˘]6f6 H7zv?Jύ=^\c=)tIk`P6\\8vN+v97e7k`S \.EU6?[?e E7`J%P}%':[ <|tynbO},)|l "=B@Eʛ"Iq.HjWq I}GHcY:@ sEH%SXSi(9,B[r>}j yJVK?Hح<*ZtSӞ1kDj2aNDd,}*#K$tP\rP,Cb?ٍbS #gԭ=zrTA$mbJ#fM?k6 -?@?>]TOiSxZf ku^F%=-p-@=MŏށSUie X@,ژT>j,D u1<+\[=t%|gO-F>HqLӐi̗`o}( Ž8ޢ8cF]Fݕ\)}Ǿsjph<|4{YQ1QUYY$9g"6AX(ۋGf$Oh=lk ׌%ikZ-ZF=Sˁ>}ʤ,eYL" * #HZ쾨@4h'W j I&TMƯ~ K1 bN^PU]@ i&IN:@ OTy{=k~?H.V T9/3 VK6-xТt[:Y<DZ._nqKwC=@2 ,PԒC0 ryn"i*ykm&OԤq^/MNWa*̥6u33l 7{6k8a%ok?cPiK)N/%]ZRa_HXr$niOA2$q" _i6! Q>O,u`AZY{!w?x?ϫ݂a^uqWђM/%Gk]ЗSieq.5 %ԟ}FE3o&c@c-鑉O\ R*#$/ɷ O]C=llenޑXJit3=B# h&׶X1aPPp=1NN//:^@Y]Zԟn %%J9\9OiHLyb]OeL*\(/&aPqo>ĬYiJXa 2H%U86f($}?:LH#d֫e dfBߴ-}zu_S8H㍾WK2 p[?oǦ ~8$UHRe!Q#?.?F^&z+Zˢ)?ˢE!^mVTI+J9dQt.5մ/`}ԺuKk+,Mn 9g`W.GFwi(@I!Bĺ#.O<{-[01CCxyRB{KkG_~]A+ѧ٘LVԯaZn܌I\n`u_fMK%Ϥoq^5*Ul\٭k{kIՙ$VO O ‘ 'kK%3$ou2qvP- =(jiȒtAP "߸g)g&QQ~7oDWz=J|$ji4"1ӧVƽGXb^|}j(@y(u %&{Mv;a>,ͥ*?Xn.2wПVjo~co=+<6T*i+jdR,N9E3H^!Su=ݬ@TVGu`¢|| ,%FGP+\py'c~f6xH3_uYym(;wW+׽֯/hC4pQIE&]h))<{OfvCM%Y0޿2|:guߢԵ;AC/{n R 5R#:Y`bUnF{񝼥crQb#zCr%&T=:O}K۴J**_H ULhB!):{K<\"XG_\Ǹ1;($?fzO/m,VUpUK7) =X1c۟0|ķϯ{d{C;C=n.\m:Eu :nnT^>ּܛ67dMtcՏԭ.o;]Cw\5ҝ{[pkJV& 㶦YO k=}fX}Hb$\ G|: |:ƑzXrS?P/_{ .tHLn0ÜlSI+K$\t6WvZؤ%UPYڕGKMn7J @biRZ8꘾V7Ngu6V&d2T6" QjZhiC-?ȿ}ْm2RP*IrV%e<FmOOxias62Yt vw|OSm"k}=@(,6jj~F[=OGbl^++k),jEyIJ,G"t voo_=bgIf*.x$}ނ IamێtIsv:|?>:^> 0u!t?CDzݏؽ&iH-<ġU8y#P '.UF(v΂ƾ?nG|p\s{g$| WX>ݞ|;+%sr\]/SOEA9 ?aSB~9͖Pu1 A?pSá/|q\}$Ui:?Ajlv^290.xiRȫb@,X@w~C6e۱@ Z 8% Қ}Oa\޶濒k.(FY|ak70N8>x?Yӧ:0탵6-P#4Qb zʘ5 JOD$ݓclcf38IrȁYE?#~^]A{Q -F|yc0p}* EfT 3G0Ӆ H\͛oV}vORi"QET|1=ຳ.nIVVVB:(_)V.k: r4`X4:f=2t٬jL* 0x4",GA{*$ݛeqdE]iϡ6=~ֿ0_ˢۅ;hn 6ٻJw Zh42U"Vm#)o`r-fM^ߥ*iލxSȗ2g<+O_y2IGHvofH]"` bCP |^]uMswn*yIjMȥtC K 7<{H|*2WiIYA"SfiZSK~֕QPI_QkqV9-K"@,ژpY+Wd펄j1(VN,6l$4X]#Scaʙ=bt'k|S!M G[QPW5#.قهb{UBZ]DzWFU_ ÞlmMc7auldI'+|kM;(FٵόI_YMiWZrטcWbbRm'r|A޲ٵհeܔBSWM"啚Dd9d_yK=[;ݕ%Vgq(u3QQjY$upUA%/0@oA`/nQIWbfަ(ii7#*P:ioqXlnR,K, Ъ/:G85+pĒ9\ڍE$@'ȿ>}1'q5Q,/OA㡕*2K!5t0!!7}?iomc_RR7z),Y̊ ROJ bZvr ./)}}o%UUcc#Y<%"2Q+r}9sگ7y.;x{SY" (IJn~04f^ HP>!=._ |fuͱk'2$uؚ5Y5Z)^}i6*clcm\ܛ6UsWU5caKSEOY0@({~Ưȿ?涑r$# zѨEccVÂj!uT:Wm.z/cKV7 Z(k^YasȖOʺ̞>[c "0"8hQDS'1Ȝh.l7>aP"x 2:H E]L\-{Ikl6 akEˢ_':S/?ޛShwW^Wb]ښH9o١JLvk?x\H6R eTQRGC94z!iH!WYppܩ .S*eYI|g aʛ\2\K(Ip f5Jִ jn&P]=G[(UqgtWoVحyݧRz|Zfh,w(E8 p}zjRT,3i3M. b$=?Y1`J8ٲqt-ZH 42OP5Pőж m=vX&$I*KP6,2@욈E-=6?-.ڔtIY%f-Wbs4*I&%SD:9nfTf*Usϩ:6X-I%,5E,Hz8pBn%΍Sٽwf7+cR=ٹ)uԨĿb1Sf6+ܘ*t9jZ)pTبCCAK"ƍ lFNlSqVz-}tKgEgM/M@&D$WSTE)@CQ{;6mv*U AUIUhhIԤ AP0oIe6Oiue|N1˷75x]͎լl)!I+PH:]գyVD%c*#xC hv掠KWR`dALr|x55Yŵ6uXArwRGs eP"ʽ|x||8մ-+f^2-Lu^ wO֚U&[{;ULdL4`Žͷ͵r[II4GLCS++yݟgz(bS}D3b fKV>Vdä*U@ۣ=_  Ƒe#my UyRr$&fWa6L]-EyϾB+4#W}ra C4`PI?pl U,8T*ͧ':k\UڥvkrFCB}k]SUlm>kp2]ױ?un K^T%#w0fc״(>2Z]蝀C<)S9abX~SM)+OK]dQh 8 ~:r0A@ꐭ?ÅS7F[ne{h(fS,+Ma9)a N#[DQ6;gdCQyz))WVT 4~V, 'I\6mIx  ):/sMuK+yQcUfRCuM@mp:kAmo ؛sL桎 yĎ'~Ũ"cwˎ9:19(6ZơRJMDzʢ[oyG\=,ϸ$1S,}9~F_\坑4K.Zje ShTSA;g1Jrf YAJA:XhhJŘOfcinI̶K%RM92Fh"2Xf!lm+w*; s.ZhR"dUFI$(jQ4mMH&HQChu3J|뽃%[okd##%VjP۟qfD ,>X)L@qg<5X:֪,FVb"Ÿ5"DWoh2*F}G]WmW*5!4n!OQNjqs3y*$jDi!p6*-`u{yX`,Gc_G紅[?=H) DSQ^??Qp4uT[P}1W i:VdYaZ|PZ\\QiSʪIA.@. C׸!!${8iQChWIF㪶F-=UN׼Ѽ"H| ~5 {Jr[Wp*VjRO$Y 3<ꚟeMgvI^GvP p~\:(sߣOU-Ssg*+~!A+q3GRLr5el,d Rb)u`¡UC Zx4dB]rM%fFSA5P<0?>,|Gr;6r@>?I]S"Tq,ldaA+emUOWmh`$T@i$7TWQJ `UyQ~E6ۦ]Cv6Շ#IL#xMѣ͟kT[Xc^Ҋ#D{)\{oڙuz?mz鹘 tuL\gUcvʺ8j螕j1kjZ9*G ږOp4ŏ/]1B2dgy H)֞1mcg%-\R@ZL/Vw?!ۛV9\mIi|h.J7ERيhE$piQ؃ [IܲrW+S=}$wFVUT=G^"Z5DtUmZU՛'hvoW#Ng])TY ĥC L]abxē[cc^5xᣉV7+v^XiaR"gv>_ ~Oz@_moUhU04h)r0=t;+2x~@e"ng!4ӣirU-'hjUʶ |\i {m7;hc{yfQ^\~}4.XDLt:d{#eD{cfp8II$k nN & OMF@uoS_辮n` luk]MJ[WbPÐG *I %nEخn\xhOb%t#k`8av#4JN#pȳK=n>j0O4SD)iU% Y*fz^XR6[Re 6KI a8-^ y2 W׵cR5.*,^:TAP(-,"PcBdm>Rl8hC&JB}>0UGQ(_ڝc mFFr ?':^y/tj-Z4[4,V::ғj.6}+ 9XezHI|H3+D_} ͬg3#9b $בmvYTP]J{~|ͶWI= ڽm5?p }tBj(O9dMCS<}kVS=R(IH6MrߒIJA5-?4 !Y#kՁ7{4CH au 4ow,K.J?6BB>}yCf P,QA?ʯs1鶉iSpoOjc4"IoWaok(P֊vXfP\x.=5Շ Ǥ>{Ym FiVAi"WbJ٭a <}.?7dDz3WTI } M=Tq[/$~xӨ=z;>rIa6 6}VlmD oӝtַ6^>KB\"ɿ嘑sԘ Yt iN Ѓ`-B8cmNZ~?ot h7qkyѵhcfbqvp?v&ݾ2oT-=8lEnmq6\a@[x~[?lHկ=dfӛ{[ @Pb( ~#w駸ZAKIɲ[ xQ].?[U", ?yYeYX7!]G%~ٸ"}ѫIҽ{+?(ӭ.ی*i..QH#mw97~}wU[ بk(oWWr$v/:[Nc<{pR1~x~'9}KnQ"*_ti4]?WE96),>Z*ij10?{mߟl4e,h:I p/{nr _}Dp& ХjI^!UD"X,j(]A!?@=gPX>xOot.\1C 1EЄcOJ&Y\5>Yq'0@^:2Nso^?< ڃ kmƟwaU )\)_IБn,?b}b  1?"̪yc GtBDi%uP <'N KY55~} 5BNbf{.6(}}(_?`qrWz\{ 9׽ߺ^~{߽u~׽ߺ^ [)1[؞sѱ= E ֨^m{Za,nGnU"{n$`Kcxr9?nmy66,MHZ0>5T}?O6d|̦I}Ol8VxFzAx ~9A&p6eKGLzX[rn68H]RIWlom{}?><)e֯ %l}9D"-JtdGtZURbi@Ὓn]2FjxlA67P=v*UbV?zZ)1)=:n2(Zi#2j*UllBoxcT6V@ .Sqb~z=nB L4|F/쯥5 &XC1 T,IBdP+fgD0M5 γHE V &>)Qvr áWJYl9uw0fiXEmE̗+JO}(CzZȅXu)bzµ2e # -Q7bIexUrkM #v-:tJeFV\ۅeVޝJXW1-oԩ:C}@*,5B-:z:Cz} +Z/v ufP2G!J%$r|R(ȻW~(-/%>Y_!U]*5Rt&k"2Ա-,E3!JX foA fU:,|~IIKEOOԛԿi`iFBU7"_fT)p V*㎥ i$ BVMͭ_T%Mqv~=mt-=d]d0+ذQf7-漮n\ے9>jTO:ye;W.B]eƦ {:bu4',א9aL|.D/!V* i,/[>کf].Y@ o[`~1᎕?zxް,ec$Tvb`VӤj@ۂ _d zz?j?@/B9 A5tDB5Y.VQk{'fh_IHÍOH<-6i4Dgƫe IJqo^Q*[.8b' ʩ#v%&e~\q?ꯒH֪g0ᵈVD#=JO*Uvp@#\uE!u/mֈk(nJ6B$zT䑽C}_I?o7:ҭ&D*8hc)b<g3*ec`RKfl.]dKϷ4` Q R~]_/TS˦:l6ttªù)ImNdXuJ@[)=\Or]%1F̿!UV?O7p0^xtSdT(X~=VGD A'hz~JAheWt,auDkmJю_}tS* `WvPfR Eǹr/{iadz/hU@b驫O&P U"C*M;8DžtyP?ʞ%D]O -rE}5|537tWFղGh$::I.idac7Uw`iweDU!5\YMP!U߀#9ԣ]}?.dufҝZL8D< ?R~G 8ssiK"#)*50]V?lq֯?h澽yejJHdeOK݉ي^˦2U-fJx l~f,nYÇHZ 27\nl>_(hǩHK,BXdb@ 5~=n-vi.ndTGJ]$i$}(:Wb59Yjj=#0I2VOɷtom-pxXXFX=;H'Z~8ytk`gO\. gwqãٳgIfG%Gm=ѸF 5JC#:e!м؛Zߓ6 ~| %Bk\7Jb[u0ϝQ*/"֕vdG8<{ 2YiE9oӏXas'U4_.Bπ̆,,8y(#5D}:ظ/ouAq8koJXǿ{~{q|1:oO1׽~DL" O=4(9 ,u#s*[$%K-$KjނڂONn'RPIZ{lu/heX YP2(>_>5 ~/г=l!rBW?z?A;>\M+M$A)-fB 2˝:_:ŝHY,J J6^鑆RL,m#U xKKno}-nF64*7TC—T-+#bSUG3ǁct3[r^-{žt l헎u@SV92>KXM bkI?MxЃJc= N`fj>cʞ|@:ovTU,2RNTE ɞݽK,qin;cV P?t N]\!‚JBF)LtAw=lK1o:EPLcUy!ȴ[u`n =FcI^$dfc*ҿo`}כwk:{U>a~ﶽd(۷m#)J>m|?']GE=03Vfkj٥IyDe$/[61+JZ"53܅ Fnkjt1~d-%HXīE 1~ϟKf%-&֪*'EZu/fnrZ᭾[ MJ}>LQuW>@>S{q{#fHTMQ=A0į""< _(Ͱ]m1TTCQA?wP5~BbVUVA]xrX}ޟel{S,>*L䳧iB-=β{=FmP55+l5r{mr "G+E@| w_LU-2*\%v/Cj77P.I}vR]MPpK Ol48Uh ,?&yB}odʭ;Gц. YyBj[NGS5YbDզDW]@p܃c][s4mu=E\BIā$g!yt{! zC]5j#}=~<۾n1u,ujVt:zvk%&'5tX̛cFgphƤ٪o0glWVnd5zuH9#Mwkx;Ud])Jme\}=詬(Rl܋sqlw^$3p9ZTR@$c%Ujj#*y ,M$gCay|ޝ% IGUI$yd i\}!G>[^+70oч_pMK[G{CV Q+N@Q>ޓ{Xdd+x*y$Zo O2ao}bA'zڊ4xo0Ye nuH $~\]v=t=V񐱽BbXT-{9sgZqݭCۑH.ۀ_kץ*bl @?,mǽ~$|gMn=O:J)ckJyHQbдB-rAѾǿn7 VARCBÈiڹZt*q7ܳ͆.C JT~fgzg>ޗSd[uV*̹핇PZVag4`VdN6xel-&}%k=ds놾1SA~TU^Vmzu}V_\u{λm*+)J 5n7n,~)v-Jz־:qAMUb֬Jxgf5MйnlRDgj.jI-DQTHMR\,_ɿ;aXnV֐6_tE_&bSN+-ݭdደ <q0e&! `LkSs^6v㴺 Na:u ihì Ǎg7T*47!:XWn3ì/sv9dt^u 5l))J>s??wn7n<^rTP iCEW4ѥLY9(ȲT1e:}gEZ6/TgLN* z ̩,Uu)4i i<AsamokpdQa_96o-L`H]CNTс7nRg7f~;0aAZ)#)7N",l`pVJt)tDK*-9zGiHohnzT,NX.ח&WA?X2C**o*9ZlVӖlfc-WYE>IWYd{k Ÿy*xJyB8 DydB)Ѯ(7~50. C*(B^+s3j_A45I4O7sqó&͗'}6ۑᨪڦvZI51{\ijy5onm6K;(D1Cr罚ZcҔ>~J,fR!i^;é7B{CRQGU DPĺW[>qu5Fo>JĒsӳJA{Q짷5+jUL%KqD?]L$ Q8NH==o(s휤|TA(e(]#B=WJPwW*.Ԇw~3"JWd,-;\ǿn<:xzǀ!u9:!'];|78bmgI *η*5 tꞪ]'6^ѦZt9Yr9#b@CH̪0P1,ak1uVcw%.?h k ͈JQH[5 ȩ,ի] 5#7+ɶsݿ{W){al*^[K3EU&( Kjo!@P C` wTo5dk;Y)r;?em|[yR#,5՘4۔Ԓ*5DP!F< ?WRSGYZڼMGR~:AQ"+ a5h#PSDW3G 1}JQY0@ i*2uxo<}6SmU΢flUd .q,aiM-Ÿ{7_hpttjZN௚Du x;=E%C2̑kt@Jp%|Rmgs BASZ)Yt`]$PѦ^}9nMqpaF;%I1#$sӬOG56axgXJFn?wCהu;b\sR g]5I<}q:YBeM|ե s!́5jӟ>Mג㷻EX!Rkha5 +DwwΠdPv쬦uF}U/' 2^Fx6 [O__+6R1Xj ʥeE>?E143O] Iv}+P8boq (pMLh'0߷H iÎX]F7⧊7"E"SĢx(|eBHpم7vaq=rTñfI4y>JO9Z8dU5F9KXۇȦV*~ I+X Pc <Yx]%PlĎ{T'ASrm ˺OIT 6{9ۢy.*:f2d2G uHiĕk>QkIwUq9Nɵ'Ya#6䮬ȌfJwe&˫ٗ's#l\ðm}ib@YYWSP7H9m3c N5P)"TRE^ϧ?(e>Y~*-F{t;rڒTwL"H$ xC>BJWXDU$}يtAr.۾%_8Ē띿]u¾+;Un2zbpl* l^BT"ŊneK^5 [t;u4̘Vz(ᥑOru"Y4*xeT,9S@E 0`(&X>"I*QTRo (7> {/2ݵ=Ϋ<>k0+wԵHIP;?6#f82UjikX2՟SF)-ksNײ h"߳,'U ~UP=mobG9x `ȊcUٽ徥/x k}/o.0 Z|oW(Mlvl,S;c&jԂWO-:dHCԦ9bNh6/%$9P)\փ/wyllmD+X85-aH^Bb5 Pd:S7^>~Rɑ}QG-?G3{omr;IU+2d0{&Yޞ- LQt/gmJ|fȵC%ꎾ(㤉kM(pr0]HkJƺK #gשm5$.A%hFOp*~!ScJRwxCMMpRU}w4*fS55]S9-NÏuKzj'9fq)^FzjgiD@׹Q&6g%WObi_KkKhdTcScޜj|6{'Lf720,m<\墠$oG2UWƅJBC䏧ݸe7*WqD~:SҔm44uz8 1ž8֏e욊~uK8X&Ȭ-ia6)fY DػQZuXZzTYRc .^.m,ø[=I$R W~=(hw{6!-M5HP7ĿSM"jyuݿ!孚9O1EO]P:$E"rbv9|~0EAQd$Kc&K~ΛX妸4Ѓ韕<>#^?!2?֨-^F +_M|˪O} b +z>GK.XOKXiS$4KgH7ٴp*[J} p,om"kOF ZZ,O#Q[WB5$,g}AX@6pTb`LL+$ ~yP7>ΞROV@0}cj](V;hW ~`˜SӠIMEEMDnH S6Y(ٌJYWW?с<{"GM),q:sR?c;B,,VhfG~YHTB$i! DʍjW~"=˽d0j7 *;ȂIkqqֱ"-.5飬tA_oN8S6=F=kj${2z*L̋',_oQ VOhnw)&J5ĸ&M1dO1=_۵#I.m+xD"N?e5<(t-*<҄z|PM94cRp޵?+QhF8gBʮMDEX^g k h5{|v(TPLRk_A_W Wt᧖'4QDGoڨXr*Cj6nQIj469K4 00uaOm}wO,2# &)Ơ3qpoGPɔ!-\–jIRHU2TJ>!j(*.>]ɲΕZ}ˍG_M'Lz9!e :.?aݭn ^1! pNx+ƉW Nc%`)G]Qf$9u3 'MO8KIPk]kQ̷/z6*(k"5*0@% 76A,VbӜcʽ Q_*}#ڹmTm1%V"(oI2} O-ʬ2̾4QԵBPVYcȲ)Q$m7W~Xw㡢O>ߗN6o:/[7xqƳ4اI)cePMQm:ReZIw`d:t_+<HO{xSZ]Wv?QX)pt5BRYݣt]h_>8ꙡRFZ4Y`bT܏VzOPsсdbXhiSSWe4BDLd$oJ+f]_oMZdbE$Lu+ksvJV&PPX1F;?M"m֫T i &Kr?W9۔TW,50֫SyLQ6fR53 dF iϨsQ`ueE-xl z$)OUi*!jdHڬm}:6U[^o$ίids1 Gè?%6u(>3 8 J僟%nRC{|GKj?}=;T6-Q E 0za@K~uʼnI*&XT1Im!e#v -VJWC^>Y p)+ں\ҧбEwk)KI+}MEGn& AI"[~NzY#Ђ\|ȱPXhBiGo]= S!C?J32% }cl]CdwvYcjZ]3$Wges@V J,v:%S h|ꊵ?o%ĴhɊyRCanI$-7Y)j )OS:]Hd*խOJ7.z;驷wdg؝q"$ghn_=M&FJ*1+0z}RKyo_J-<V.M K^싪}(u iҕ5?7:Ǎ-feԴ~&_t"Mc*g Q%GO[UQ[ tU_+V=&K7KK!\6& &yDa_ ~O}|rsH }Q(qca=ܭ`%|ŀ=@e?*?uo˧y;%V%hKI'9#  hxa'椙 4rȯP@f:Og^`WftY?lC$E!9Xa!ߑ,@$T[~ڔ.cRwB(Lj/f 9hi7yV_M?nz?ǵ%q /caEj^luZߑ _V_ w<:q~ޚj]_֎R.-Ǧ̢װ gbHQz0GKMYBw Hw15Hv쮞𒫫͇X[ܑs[>FU$%A,I[qU1|G-_/z*XhQ:Ms?O${ +_>[M$vVTw\>z?$MTo6{7# wD2&%[SquƗÏrh73..  \kc?qtbBoWt]8:6a?̠eA"|oJj+Kotu1*Eۍ:M:u#<[I,sbo9?S <8R} ]X}~AAzHQYUQAbX?? #Mommo-?=AM44:轴 }-[o}}Ԯn65RW` 5Z7Kfe:apȫ(?}S cPFb/{ sk9s$]-??q&C-ԈjQCqU?gCM#/t": H^*y5-f$QaOSK 2yA#ʣ&;tx'GC I6(Oz~(P]Eu}l- ݄'EP,bUF?{lA,j#$AcKb1UnbOQEX4k H?>\ʵ}mp, :T_t`!(n+3sj*edWB]x"}[wD0KU5J{^Fm%z;g&8H.)֡XoZ?!u0yuH zY,u,RPzY{d,$P#cX`V$G}R86MXǵvz|GBB!0&pE9o,&ױիE*%b~uU: ]}Ӕd@"׵?aQ:˂6o'.ӟb 2BVAR8XkH=` :jPr-snlF+}=%+^eU$0f~h$DZ)#`+]p~]A:nx7 " ~~=;m' p jo {/J4VrlAi{k1xnDyt-l R"R>el*vrL!ZF*m`鵿مV3V?ϠG7$DSK{u׺{^{{uYdmcU+tͥ(#coӓ 8Ņ,?{Kxcg.+=b8.yMx[b6pGֱϲDz3.>}&_?GLP?A_XqV C}97@gX?^]F)dv*ȡ$G"D1?D^hjو "Aq~;a n4M'jlVl呟@WԖL=_iAyX {\K)%Xsa~}>:1LSZer]Z؉6`Mͮ?f\;T#=Ъ_rIjRKH멯tJQ@ $Yi!B8ӢGlMoy' PN6"Pmrc\lU~CcJ5 EUtthFBaŴn?>쭖 |]O!QSMti.o'P@_k-Bh ܪi,sq{'Ry%>xyɧF Wz]% Q-0qB0K2IBHGؓeX.5Y@H:U.:U=:Nu&em,d@# *iH3d\Au". E:QqmZGrz wV#I1TMk+.г(ojC6Hkv n8>Ar[;H|1C ~?c;>`C?B Eidq=)JFZ:R"9apbUT%Va{~4}tڝCx UnUD \ e7_s!bA!_fu/ksӋ}TӏUR VV]WdaǍUͽi,YIԸQӞGeW#E<K_Ҳ AoN]%V:o@.EM^oi\NdqRmCf<4:Q$j]V0X1!7"bjH&5$zPq'\?)ujAU8vƢȎN7f,VvYW 5j⚘IMǪ=kf'jbM6>;!/W_I4aƕIsdU9mӺh& F8F4`U MH=L䟭S+ٵ;yko4tx@@6{=˶ܯߵ,B2BO|ǭyg(][}CZ:,zסf[1 ~Mm^ijFG|%6wneS}.ܕ,mjGj>d {y7q'ƝgrlW^ųF\ak_{LtFd3E[$Օ4ҊT,Je-{uEfB1+вχI}!ێ־qlq˯bIrI'c[7;c$fUF#."'Otukfg~5O1g1S^4@ZkIr$ق+B*5Z}L3cyŹN ԦhqLV,C#_KV مݻ|u}rLFL3ƆG ;!}cqv{=ܡI,㳂K(w'^>N<6o{6x*ѭ* dSM|6}׊DžNzjP/U+HɓVtu:÷avꝗV*M3!EQ,2cKZH&koh%fk5"ϧB ,l}ɢLPCﷻtlQQߐ {NuZjWTG!RQ_2  p.}6͹bAvm=V+[M榊VNp9kYɤk]=vÔYhby֖h[iEMk>Ίq|)qo$U3е4G3haQOMPFMevuTEyԖtP>ͳM;n2%c =x7i%DJ¤PW8҇yvuejY) $% #IujTb+kMѺ|rJ +"۾`ޥ ;'KpVL/ʋ= ƪֆdG1SNftr!]*nH>O+(pt풥OߴK b7a]흝q#Fúi^T7g@!u_,t֑36sSoO:Էu:cv&΢gܘlԯx Dt!6Ȍ(<zM?pI4rUY*u}<Pĩ?ANH\jDde7Q!MlG9̖ 3/wdXN61Tgj?JX #<43(^}./6= F$Y8ùj{qteϵ޵wie'ZqcNXN[wM\>5L:0` ]d ")mLBBso?7Gcv%|D'WS-b**MHnٿr׻tw± RJ.sm!bt0jeH'GCnΡ2G'[J,nF_N`(rYpc+#Y`P/ u. QTZARpKx),Inycaz}]tOƫxX/C$MjZ%TeG5[ӭ.Tc~ڛ7{o`44pGY~a)Qjf's`7"䧲7b +"FJJAzz @ *ös"4[[ozK˫o4QiPx志A[`]3;k'tSaSbt&ITo]lf7 LѼeFQcL=,4չ -"U- 4`qk{5;4;\Qvb;G6(xcYu{$QKZ*_EM+Zug|;|>Oq59j,xlF9 <uT߶-<%H.0ԦWdB%_Y[^X(!qa!.PZJiS6ۿ,{")A*"?X>Yt E6m-CQI_S+5&jf +FP}R4@,u -DJ&$`G>l57"(F~Z P*u2EHo!*]pR qE&WveR/(1aglUCX&9M3KR ` xӖcb.M錀Ue:+F&Yzʪh/3"y̮Ր`y*ܗSQT`IHi1USȳ4$$ 9#}y?a{[cs1D(U%%RV`># At1¨TjƑMxq'kcm"Û}vwga*6tgoa JHQiӵ_lߖFBᨲJȲXQCMK&=L©m>M˹/J " (4Dj ׬wۍjm.lr% HҪ$8@ˎ^tc{3ܧ[n1[r 7;Oso<^ƒ*mr0Fg7#׻.,me"+|fx:pdѐbw{mOɭs"|a4}[lIQc***jZiG56Q#kmi#^/ETCiiiJA8|8+5 ) vf:!J :jjggR1&0$}'rT֕5$^+Xmmn -:Y-IsYY2'!> o +hcTRPC~ػl~OE I'/lkCI5,MP=4QGtIf Yl7wޣʽU1V/wyQ}E,e-%҆`{X>#NXѸӧ>A;3}>{3Mٛeifve!EC]ljy)f I 9Um.<ۆpnʬ{MMUx$q n7tW}BF7[}q4j D-һ{m~Y\JhkLq?;Ww|uǬoCם}wg97^|)JTqe5g3p (⤣:Z:1dsCCJH(`i*"U[{oi} cہT@Yi*-Oކ*d&V5ҵF&@ӧpN 'cY|.۸e>'nMj Õz貑IU qr4UQ`Y:ȷCL)㪠Tѽ4c+12TTAN124,ʆ[,1])WIY^N>ɠ3kWWnUtYyzwtB 2W$`SQZzΝ}6xܿezs,=1 ň,Pl$BTjp)q5&~Ia%*eO%JZi0(g1'wͳێxv%i{YLnɥ񧵵垱rlMu@T ƪ*ir`ieNxnո]);k~CfPKjPVc`8+v抶U?s<ϑSA!TREMzxjit캣i" r^ZnEτ]T ̀~̚ti\mCrm$wCJdTq/svoQ썳w} Rma.~;kk֣;Y*F/o厦8*2F {S)e%I[jhMǎPa&bEhqM#jscmg5ṟY6JȤhhUYH0~^z/Qؙ͉e3R#evE$x1\+'ScW=ML)74GFIRbO<4{K̻#\#QVNŗOQ׶Y: ARg8 G3iކi7$;7Y4)ajiNNQpj<5emA  ^`5|dEc枟$yQ}ʯ?/ݬϸ̉:VDiPBRNA$*:YG}yb#HId>1cq V7_=Ej#5S S.7n-*µ%:j2(5WmvU~㲲& v96'wB,48\yXR9%UC ?'[#A:!( di^}#\Z^rCS0wrş[k%0[2}VZjl GU37L.IvЋ+Y hi0O[zlJ^\~Cw貕yh)N`яٍHMUQB-ROh~5Wt;UZ;k+(y>[4YM*W<>މ^Y;7sP͑59i" UL.5ȡ~.mǜ4yUy%*$1,AM;nٖNܽ4ӓԟt-3֋^W,{+iKYQ>q:*ysYjk_ઓ@B'n}/}KS&)2RUk槊Gy:Tt_lo2ۭ%ap U~#\s_2r\$jG=R>ʛlm۴:*zSyAJfQR4ضvEYQ"C^FI2.TKywǖcŕeOWc|64zw>_,շ=ƽ4OfHQT>&у֯?7;V<.UR\FCKԭ- )5o3Tzu %cmchg|51S ZM+$EW_7WP[oۃ]A3epiv#uټK:^}nm8L~SoUjyj4o%:RNLYD7,?UGg奩%ާ%5|:x("ȍ̖M&M>)뭊ʦ[ k 8{{l9N):uTe󙐮,XW}j-qڠ'JCd*/I5m iy&@B5/es&j׶O24@N?3% EOϛ}ˣC6h9=WK>+n |ݭZ5sPCD MYRVkhkTZnaL$ NBB$A=ݼ֭\d`՗5~% W:1!w_x|nvۋo2VEO_ 2Lm>KNMbԕJ^)#:` N]abB`ӎȤLBga =C[`jǀjE>uȯ}h:L:~.bҀRq_#PL+q*ݝ`ɄTʏG*z3z(ic$P&bKի)Seޢ'3i.7@mB?T3]JESM?Ӥ"ٯ8Y*Y*e \Cea8TH?dۂ imR/xPt\{kOseʞΧָ՚_K)_MPl;53~ozc+ڒYC5-\C=-!WO# <&{ 5 M1QINJm (ŵ}Mk#Q$)QFOӇNo=^2}l^ۡASA@iTz&x$&k}-G nU󔵲H$5u s@N‰)[1cigK&m<NA}318OCjfi!Nc6z G%LW(wVUVgn >& dH@Ka$XpntmS2^!<)HǩETffژⱼ5fi TQ]$Fiޙo&eW-R5tQryգg n6 {?˩}}ϰݔP6dԊ&#HB*L ݖYo7ǘ8FFI5LTU,چq$ntWMos;mS `c֞ &]<֧Qà ~:Yc4FuJzTy &N1UIdJ2)I!T`Tzyr_Sv7-JR)<>\iZNVOOgoL>}[_]>#ثHqxjy+DsoSPD"Y"bڠSFHu E\eh JUUk {kٜlU4ڱS-CB,҆"ua:iUv{N=[(o,dgʿϡc$Qdio~&t35Vc+:_ Er:D^6k7Y+i7$XjJbJscΘ亩GKK}L 3.-Ŝ2C_E)NWmLb+$g0{'f؛m+Y䫋#iz{ske#ؓ-(5P%*3.8E Qro tpx.ᾜX_0jAOF.g1E/Wǧ_Ӎ7ftO0] rGU6ULxԫz|FlsZ"eftVUe>Ŏ\ܔt= {RiAȭ+O@rCh85)O0JjR]Oޱˮ\- l]k%hu* Xc @! A< QQaX4aé!xϰ2s}Ỳ|Kq$V*>@mf&Y-f]ZM5S'tavo3۟{GZxX1=(̆cY죝7 |D4fV#T0"X6Uoo6{b1vv*0'usk7,.i22]C*QP'CgGAa VS7>|edKK$Ð_5DjZa U^ޒ,76FW8Ҡ>:3#bG&)VbmϾ8m59Ѥ/:Qǟ_.=Y$H +ݟ[|@Z^꽥5)3pn2KHG"1V4ҳFGCȴ5-:1ZCUIX*[̧I g},ةH~/[?5e n.OVӣR>t׷ szOm@}V>iî 7r@orMCA;qXo}۰ܲz3K)2:2@|VV]LT}.!ef_gK`sN X-{ڲŪ%:C~-ny+ڂKф. `*M' #_h ]J(M9YwQUY)~<~p?=͝΢M@3^ܐZǁ>n0OAk;zUA ,?Lbr6V{DdէA{ZUn@\Wjv{Hm6[P/a\d+.uuEøxztjx^K`U^~9?OkmQZń$* ꓯ{Zcr̺ lmI+ar {[5c~=A1S{pnQ $ټt=%he ,}2aR=V{8r$*[ aMz>CqԛI~9xxIBZfT1ӚiYokզYX;K-aY` _VGJ߯MhTXH#2ix+B:S O ,m2[V2I BAcT+l@46,"!?tWi^cӎvdxJxaPi,@ >ͧߵ~$Z8\Z Qq`y_aIZEBbHW}\[qt@<:$X <._ܔZ߂ [d NK_ϥCK~ЩCY^rM}g|xsYX>ysoo)CUg8BKiBϲǠO^~{߽u~׽ߺ^~{ڏi;C! *AU,WP2qЃl?׽_OPFIckYԃcqn0R _*3uOny}! VRnĆ6MsnD{gJD/6aПfhΫEېT^=$$}sy^}_:Efq(Q#}ٽٓ~Aob, Y: b {Wk٬ػk06A"NOCq\y~4ǟAFu@bEq`tzO(^H`lLŀQkŭױYX ?|= ,P\%!* ia%V+k }*@$z+5{FVdK#.-e5l.?N6PI*_l@#??lzjHS#lttBQ@VR@i _ПobfbzA30umNuE݋(AI!ϤrKm\_mtNal+pnIJs(y6P@{ }zX݉,Y!ADq\[0*S~=c+vVj /ztݿPUBig1ȥxb@m}ƹF v륮n{HJ¿ HYޝ6Z6L/~|:AzEJi[,K5z_WqB$ᙂ.=c {xлNRAzQ >K /oMcƤ!M? r~O!0D$"zCBǦuRD̦"< p?J {M  %B[{5yWjv=dtI]dvv"gvc(B9oWҡ:"6o; VAQ+Y<7?^ӣ$9gӨ\{U銍f> $r5-WFBc^P]r-XOUU0tKi$kV- GՁzp婃d?3J5^X22TS(v~C 6mv>[/oieco-z75^A*4r*.Uz: V_:.PURA"JZߓ@c?WF!fTJǡlA9O ;1mWutȤi`p.#<C.gGc$1]M݁iEѤnf V$ow3w $p(cu*I2 oܨ ʌΪ!%n8<~/$P 7d!?ZJm@s'npڗO X9'?Ëa(}zI*xg_:cam1]WΟj?XD 'c=_HtW1J3ȡݴ,$2>Q>yOaA+,em ׂIޱhPzgzԊ4ylִæWFgTUʞsQ45y&2-uM Bu~Α\b'ϗBז*bDfFEvUb +ưr?OVjrU1 9$ׁ ߨt`rO.@h 9HP]ԭ\3FQy\8_~ IFbUOM`m*.!K}TF̐ĕ?(3 &1ݷPo}0'T>,~s+$S Bn=پsYgT\" k2CZsݮC4fV-o-6ծEApċq" *(@=PE.flr< d! ,QO{{Nhͭ#>!8a0)>K} [mr _ˬ_{$׍_!J#[EJPe#ǸNR}њCT*kW(Pbj-.Q~@n]ݓ?io ĚV?j4{pch^yO&$P#pI$>W :}CPx5?/Wʛ@7AΪ.:讹d358ѫjY5oPQ..oශQ:\-x4~lg?>WVRS_$$A{}`z_r['G5l凒4%' {+ٹykKe{; >}H;+s>-El*iR¾Cs{g s7[H nBStǟQ7"=#4/8^|“*Il)jY$2PԨ4en$7/7Jy#f PHJ4 Mq߷DQ p_:׏+ԟ$;w6o  ڸWOW6&z# hqt=nFKSo'aϳM:+d7,&=MPBhԫHb;K,=So]^K-tpQ۩֟½C/mߑx*"TPPJWDG?y*6X~[[~Q g4IDSkT&n`gf LRB<6fc䝻dK9ds8jesNIQL+TMgddf, ]vU͵N l|!t$)%57>濼{3YktpIR&ry-=kěu#]DӉ@xD#Li^U>"mbC}FC`HovϊUB8pЮbMR!Aˢ*z+P}әfެ&ڶfJ j 1p*WOmuSUϛǿJ--,Z3Ōt&H[oYgzgi1կI%rJ'yZ#i% R~U+S;OyTǘӼ,&&% CB/-B(Ҡ+=ů ZZ5+`5Z9RO>c{0\3Q, v>UKS´֋7Ggqs9*815X*=-KuD`%N?C#~Kbb͹;o -|fWFfԹTM"TvَͅGw8`6Dj Ѽ;];RSr`Rd GbXz^:vGkvY}p$Ie>feπ&>z"$F,WZ^l>vd˻;N:yQ(W(H/֤ P9< {%omk+KpBP&4>lrI+uPQc !h6xЀ6GbRE*z7*?<h:%FImSS,3,RģJ Z/Jܟ_6`+S֊eIc1뎎J]Gf%-}Kk[ VoVE-$F;Zs5bT- ]@`iР1Wl'!q]M{#-mVJsUn eF2jw)OO/ y`5}_=%>L# yCFI[ y5#Qz 9ϩWtە~Ė 9bBw%XbKimxms9fkwZHVޢqP`MV4svW66itRǷ)*YJZzj"6%m*?"OeiO՛Gz7z⋹m#t9QQY4RTNyYCC]Q#f egJt BFcR~\}Sz|| 餣ƈbdK.4B Ǹ;ۍznn$&pDh *qԃ#Ë1IPvYPפvhu5 ۴YL4RQ䥖U$u0<`NZx*jiPYCRV' M1`2o/pKkÍ?p'??>=dT7Rܸx | <?OqY]yF*fT Z6(`TVVi p,/r3^h=fBJ+v0Y>'nݷۆZPQEje@,?ϢA_E|A٬fk~EhbNhMKHkX Ӵ>>&֦2`}:*3mq2c*F ))Dzcf2cnn A$xL$& 5pIP9e>nㅈNc&e;^Ffb ru%7IV]JcPU8. PW;ћS}i\U$nrek3MY W}45UŨ'J:_v͗qh koqۣlKF/QRMVij*8_ߛ#l43:|iVxzmKSx~U"PSA!8N=K{zphlf+uݩ+QK<ԾjŕS^[J]mX͍z()wDZYlVZ*g ޥ'Ͽn;+^:V)4TϷ=nɱ6oJ Eju\cO:-:#0m{{xR#jlʶZcM&/rlgi^AL<3ۏ{#V/v>vΌT[!,UG]c2LTb6evjE5!IRPq9n=VBwH5VvhUժHO 1W<%;D*#)Eӭb3(fJKf81T4VRVpգ- n/RSsIWNr"[[K]u$.ı/G|ZٍxWnjK.)[gvd,_Qp6hIo2vSog .cEAl409cM?K#A"-DLV#vU]-e&pYIfG^ Ef I$|PtKyKtø&K/rW^ u܍ΗvQY.^ծ2GQ~ PVeѻW XMɜXlj<.*kl\D4tK cUFQ=UWT3K%T8E<-V͸(#,]BO[2hI&[JnjWTtUH_K-#B|C,(a2tsJzoT;r>U^ߛ= }Kw?ƧqnPkEb!, B%/MGb*WDu5JԔ"f54gP鳵u[m9= vmo;aY#QO"3er{E1M9vN\|_)77:ӭ7&*~נ|;ioq;{hԜ"JH4lI2])j&6ALuRX5Udۯȩ~mP- )SVcIo}rR+XtV8k6jIbxhԀԁGs+gfn\pI~U{KE-A5mUSBh _`^h4Y,FMˢgO$@Zy=Ofw|//=ՔU`!>@uxRc mF%0@LZ*__0Ξܿ(mgh*$O$k#cE9CJĆ^I wS}m?G3l>ZDPYJ5,Z첋'ۻPͱ+b"whoR>uH΂$q_1RrAhkAK)<'luT]~ǟ`qnXNNi*YvxYOAYä5zUdQ/!:*m@/K{ɶmsg"g7T--3@5`86}=ͺ3mz;Ȕmq"'C}I ?#F @ФӪV۳:3_yA)p[hUU(v܆ ˵zki{d54P8 |u&?Jo*fDPe1*I%JnM9{..u܋ G] QP?@=93Ko2xO0f2+ !)N: ;w^&ciaqsLdcM_Oc̙tc *)y)T<4ZQzYH2M%܋OBo]rt./8 ZE5F[zl7aW%+!bQV']7vsqy5m]J.ڔOC1S40jo_m 뤫M3WI_U$2:*Y[Y&HbT۞ZO4.M>?jlv~]EqvLY49Rx)ȭ h krxn4unqQC+sc) NSl 6ӪݛJHjpEbN*gjeWRf2ieo^77/mӾJ!2KHxҝKZ[[bI%QQJԒqQZ|_+&k~?l@~'LKo40P[E]>YadeU1)[?F Yq7յ#Eia$RȺfdPO}Eiu[\ l 5?~}ygv"(j5I Q-+(I*X0of{\Xn>*z(2ҽuB뒢I6Ǯhl|+{*jxW'WP^Y7pWICyP*PHqI-{Z>Y嶒2-nӖH!ԶF'%$x U.J<[وٛo%GEc%Emd*j>Ǝz?$SQ,,cŚK=o&*5 ne85FA_rmnuݡhy~иO+w.[|ނL^XzZ"6 * ~W_$)XVehJy'ޔ,:UUU ^܅P @g$=mv*,V`YQ qFqܵV_7F |[͹[?/iUdE+/,8H 8~{ud1#3' e{5?tX[;s aɠBL}qP%G=:Su̶4ܹlb7EuR IBFH=ϷZj\XXչJF mwRbԟs.}qih;A2Fa%qΕ-̱O=:WW{ hu+N!yI{vBPڏo}c%!5 KTU*yjդ$VS*cF |Z|1Zoob_L,`mjmڸ/h&v8tSZ}s(qx|E:+143STD5/,Vu]̌ğgԞɸr0Vq4#8S4(J2u{3wb]-\k$jLmLM_C0MMҭƒqk۽oCInvJ,Vߧjݵ#D[3[^Pm5_\ZZ"If$>CZk#{#Ѩr)t;>*i9lf:д)R!U!aKoPy\mvN*LM< AM ) V4uX45r}\cw 2kBMjkO ~~:A4KhnT|VB%[RZWӴeUPU;$Gt OHh}S,QH*$M~$>+Һ=Ja Jc]QQĚhݏ+?{h˔4G8K`EUZԏt5lӌB(vcXi"MXG⚚9%i,IS3}حcd2z~@>>Si_SXe)abqxG.(UG9DUde6oSs(#Y{ ZXjIfbY]py$O5D{#@sqzVilܰ썰q2d7Q[7!& "3]1 ? QGS5l|BOic o?ADqB 3wz]Z bvSNy@譢\eH-\jt(X)b~B@UhOq܈=*֞oG,nKz!4C28~|[Y\}n-2o^`jv7IFJN,o}@]?-~keo>2mmUprJ)*dzJꆽFnmWݴ4Rt4jHT=+U+Ӟs,^mJt"G@F&TZ)H.?>C&8)JUI4U4q$cIbX"Cצ+rqB.Dkmo(J 5N;۬7O㦿/[``,E%U=DaF ,E_]Hu _PNBT!(#Cϡ\2?QsoE͸O#'6 _ϻ㧺m~}EϺC5Xu[:nmP D: ksr`?dpt@nX ́ >=dZZ67$쾢7Jwy\,o-2%l4[+rT*ȬI^pTo/>=w K1VMҦsv ?O+rI#0RI[+{~ Dzƹ^V$4O'9*oP[I?^ ־3N3ozp+Un \8zu|=\1 ?^CONo"hO-qP97\6NituҔj7o{ yvÌe!чչ$~{zyf?,u5Ϡ_^- @مQ<_eqoHqZTŽ̌io~.mc|Tg?`Kw4B.q77v[ 6"mUh?v.ZɃO^eSwb.c@{[cuk2Im={اB8RLo{k{ 32'5_qss2W:mbټsOWB [{)M•8IB(} yotyL?;>Å򋘢QTrEʟA˸OqΝņ)'pդlΤJ{`,5v`d∫. <Ta1~'+C$5?Uh~۰tP#`ҏ -:?`9$8eRbq` $-mGPe)Ji&?hO4ddl/>ʮGYH'?ׁk_ټԞ}*zMqAR8^}*_[j &67ZhA\Qte+ҪN@{h*o$Q r@|B4PW_tZi=f\\ ^A~8qaH8 -{;%)ήcb=GkA'?Of&&h2}@ [xwP5Wԯ)tYU2ǖTIkV"ߏrb- ȲH$ʀLX_'Qdk߃ڀ?}H ;ۆ.>{-w6ZʲE#סWt>xG}ȬpD-]J<oz.;_tG15,C6$7E?#Fi}/~׽ߺ^~{߽u~׽`%(Οz*(F[;n{//G^k}fcn׷7~}ƛ&ueWRAﹿM95@oײ)@Zr?oMIsaCU :QuG_DE)Lw騕 Қs+33V m 8[,N5&n,.EI5`Kd 96<XnH N_ع$m/xդ{-lqzi[K 砧/PmꍓMGӋfkOM@ oR Dz_4s=iUډ. FXz>>*&G $0/}D⋁*U?æB_D+i3BQ꿗PekQ5i*iVNPb eA-u62⿷ %pYϧhJp c2FҬ_[9GMU []r>J!T1 S Dn ѹf4R{mԠppH[|:dTOPC CH%>Bu0V A ?x֦.N"Gny}G4WX:n=R `Yܨ .Aay{rMZUVYӫ+f_y J0^<~@h:: žޓH E."X@3@@Srtb-MihDA:@YlH<]WRL|:?oJH^ Fi)9c"ݏS0.or{0k"9_Ve_̲X,Ożo=Gˣ+I7xحMl U`I.6' ؖ* K#ΩaT+ *@ }$}+_z~ehjk^^"%aXfC{S=GUs#I)“v:~aM#OQ\@ 6,V A'ś/BKzԋ鋏]Iv7nnJ?tz ԫ"/IYV}@69P sw3Ni[?MT575:0PЪaas|طMw P+[[:[DW=,6gW/f0{3 ߷H K`pB}:n/MQo[6t-F\V$JWmM:9Ɵ#^l~ "zǭ\>O*d-(85 ~^߷ͽ]Q0ԿoxugSAo\, WS(k'yvwd/HN:Ϭs6D)-2߻cŋ}DZHv n>2T3i숤j$+o4XUC%ZKN$ruPXDQKȹ[/?[e=L*2S׵Ng6qʷ[ZKxoFy*ٹ&C"DJ/TJgvCH+vn\JUqw!xk~Yj4&rm-Ve_+<6"zڨ4F $RmIakAKutv"!b f ٨婪kg}mͼj(JzFj+ƞB+2ykfҭ>ܘE}չ3S.z-ScjDU?s.B6}\ݻ/-2A!f^XV8q?}i8҈-Ϩst v{g*GTu,*u,ѴktH ?xI.ꎸK[6-2'XSMK^QWVeiJ&OYu-oim!2UM,#Gd-aeac669 /9cĶOn`[R@4@8Xd>Mq8i'ol. ܭ_{z sgv:9V)fAO@ @:U\Jouۮ{v];XYH=_15(|3NQ܅-4vp]Iԓ- 1&3na{{cgw#{ [[K6ڪLeҩ)XǬ,<ύ_+b}S YzjR,4FȲӘ;F=,'h9嶆Wfjx/|Z}3{q=6vbFfBN _"0[F#υ]w;/vMei&$M'48e\ R ( OT2 øA<}(*+;LϮQ-ȹ"ojڏiR줎єYO(6#٤FUN;ΨŶ(ra:Y:\j#ytIx`j"68RthMimGMj,'cE)&_,UkE!%Mq2ZfCq^m S˙?IehM ZO4 Bģ}߷.a>`.~E_GnX't3۹*]趝qADw$SVX+Bbk);Q֣ArUq(K dqV+6FGMGj TRSDrT#'+OF 1Zms{Q!H2bV SI)UCJoW{9. [bU8[ojo-eHeSL~/PR<|Ѷ35;#Ne*EmQ0[~Y&mȒ"&Gu2d;ru;15ٚxk*z=GPˉȤqFV) kw 7[Y5i=|pkAĞE3ŗRI5j+@h}zJfǜ`9gB1:cj Ŏ:&o;6c+%8=?T%]Rjzy#W,3!T!O;debOjeFՏ 6HmWgT$x@$W(izFd~К=;K{uS*関|~FXldr4ĥ3%ǖf,nA%ywݸ8q^uUIBi!Bb*FI/rǓZaakO$I0Ĥ!nS+Y<.y/zMeY\,G#Bi*jdY'P|罻sf8o{쏹 Z3y Fo,%"|xԦ7:UmLDF)NOOn$YQII@-_X+ˤu4 L.v==9PōT),H!PIE޲ʭ7FvEUt(qV^F$1@# C 6ܒ JyJ9c|>>Cj]J Wº`i>` y'm\Q_FEYP䨠qAu Xw{4JC1 4PF2sM}qm -ӼQ0l2 35Q-CN5/gAYY*Jwuⶥn6yoJ c+r4xmsQ¿sKK9 _q=n=W6C%5~ꤦ~FoB u&fu5J}+Qw7kpFԢ1iY.̭ 23ED11I@f3i*0tmvx{XŻFJUjCb~w]n`6q#_ıki-wg Q޲7d,՞nb:f>k) I36,^2w]qY(%.T.5^rUչaEH1 r`Hud0g(~r#~KsE#0V®OY5lrݟ/fkKBT1̚HBdmEIlIT;yn;1E8蠡dkx⩤|#15/GjZ'jaUF&x$1rN\`ivƀi\>? z1/G+aw y#Ad-ԍ"R VK]&VuퟑI2,z: 5Z-/% M@-%<*38U Aވ<RzG:M(D(<*B 963ȶޡV7%%F׏\!jE@ZC,HL׈(4akv6֡zh2ZLU#GUظi]^ܪt9 T2E < adwYA294gf+}DllhIf`dJT"; ˗7kKI*uQ\PRP㩽_D{楧Vj|$ u$)33?%lAwnZ;_Aj.*Ö:ukeA6}{ܕs{EӴ/'F@T꣄ msg`lӴ*F‹fSx:;QO y/%GB,9Pf)(: 9E(t[+]=fܢ}RAl*֙Fz9-wy;Y$lڜ0j %ݓmY|S6y`rمOxҦ!)G:~x%<@eU2>Hb׿[l.nSJ08 fkk.ow3ʪK) <@S*a]95LJ+g_KSQYٖz|MC!Zf4TTaeHLQA92jBYibnfoY."xx4pb.9^[ sR|>E>؛wOX]c)7>צƮ2lRZ uWeDJԙ ,}7?*/n}QHl3c!`N*]ǘZd24ā eۦ 18>Bݪ8x!♧ )BPy_S{l[wuRl^BQIS: $F_-(?st\"ruDbb5pRse 'fS%SHTFrh\U *tt`ɜeU-#j.OĨjԆeVPGUaa6Y3+)fE%E&\tWoECA,:I52=_4i6l EO\۵=Ioz-K,trO{t1r5B2զ^4G3&߽<#GhcU9Z8*||`:{ uegm*嫡bץ= k7+YK{z;NtolNؘ[8#.0P53,pSPgv8 s] mFg!%p mW=]4X8DljkiMqOϢ#W=)scT?pzFݕjfM QWbP8U>S9h?,(-2I4l$h/#Yۛgfyܚ1BA6`|ob>)_bi↢ *F#)'={YXZJ79P @ƄWρ)w.كw`)#0׽K]bcy"@e :-ل{H;Atc㋆x9<8ץm-1Xꍾ&Һ~޹w`t#ll孧Ȉ m|*fkc {1ʌ^NPiA4J"))Zzݝ$vb]?{e>ս0Κfz['ٽˏjq66k0'>8KYOR#YT +:ǹ7gYA1mSJh*͛bZJĒ TS\o4rLO ᤝC~3¾_!^5^@_?>^oݙ^߹*v;G-U>: &3T^" '*LdOhDm(d^ȉ^<#Q<:(+34A{ >jk+*637̂\œTzC%N?i15 jZ2_#SU,KV?ĶvM?vҭ!| RxPxh9#]J:LV=VelS(|Q1xרH0ܽL_&5/ ?ڽY6SVT"SAM~B/@inH[_-Qa}x-*/r~fytH[k]Y؊̕vMnx2Bʺl4{V U\_OAp mnK Ƹ7oYxiD\6;$me55ZDۘ]jCL$ 3 Jctd(1Xge,kBZL(MpO-v|ϟ!cԌy8{mke,,`yL |bI IONӬ#I]SXЍr#31-ֵosZ[" bW/#J,AGTYacGYLq 0YxCP*H)fk4 2R{6d{ȓPo}T/Xr_޺ThUXyӄ}HChg}M?է5+TRà96jO$¬_c:V4yW#p\)ʥRUaUC#L3jpy˙֦qx)/rR *I ?Kn;j`CS}?:A6SOƟ#v\Aa=dY :+#9W̢R#Sw}*5B٬f:wzi5){ M̱V},lCط+j[O_JWύ)PS}“>I?n|dBzi*ͬ#Ȥ(z2$[8mLB d@ȷjZœM͹{7M 5x0zYqpPX(ooQ)k)j+5ӊ21J *1 cv F}-z7;C`OCkݔ"7ݦv<í%+ ˖ k`??Qqn^(ZM|U̢ )$f#**eܪv.iӊiБ ܫBQl=ɹĹԏ&cJP`Pdg1$@Z<])k ^oԓVFJWJ [ Do*jo<w4"sGMO3rʿ[KLvŘ܈gg]Ou>M+Hw9]UYH 4?NVӊڅh H-+G)ԑ5ʒޮZXG&-+3or?Fkw=zįS )p:sg8Mqtƈt%)LcRyʿ˨iwjSEWU㦕Z8$2eg5ƫҿAثJ40K dhxMlB/b_ zXxk:vS ?"H=H>v$/SLVH}|L>Rhei>dHshYc $,oĈ!WiXf@A`HlEn#9IiG3ԣ^-O!gOo-3MDʩ$rOΣK"V2$}}vvOO/e6:5ԟNE -dD?_1u"mƚPC{E"#,E\$oϱ][4a2;|# /Θt狖<}3:h..>ژkt4_g\h_Nx?3'_nFonFj!s#n?r}ە stfU` A z\:W_EREQ7O}@?o`yu4j.IzH'P_ϠКtN j REcr=e.b CǢ9 :T{~@U؛{/Nx0Cq:IGHې€n!'Ig{RPV/sva{YzTB]ƽ W^#ad k, OoOm{م p>gdEjgX%ǟ{&ޔPk\g:osɿj#s%4.O)mYQu!\]ZF^_[{.yܛ;ݵzz` qo ^n$uvW_{.JrI&o#n( ] s׽I[_뚞I&o 1:-% ?OPkl=@SucVɱgmm>\~=n1V ~^:~|}[-a~*S׽;M"D5>0#GHaj,8BscvE˻bЭV1PJ;_N%Vj_u3daס%;( ~/z` bSS?~_b~ R} nmQQW"ܖe:\ !G BȼTŁ"@ >$Œтumz;yP6A _G"ޮGpyW2ߤ1BߓM1>7a_J`l~y[ emJAe(-v7kfBM@NҮ3h_GX{BVGo@Ceo{;3^?~=-{ogv4Y}i-+&wuUM~-qp-{$H,hmPEJ#MjE,nu ġҪB=\b EYQb8: f7!ꚙoF^>%Et2I$5%T}G$Ag>t?EcQz`JBWb:C#}9[-U[*, p ?۪CZVIc} `/?hJyd!E&r!??>,nV#iW,*&A+NO:x{@EҊqr>2lX0h _=.qөL: IX*0kOueT5p@aeB},K5ufi>HOz|s,STFpGhV ʺ1.mk ͛x. ü7񣨹R>_{=G[DG9=ݽ%Yjʬp㑮*MN4s}*Dd*H~S{\xԒT-^.! u)k_I֧_i d9EYeP5do,RS+ӢFOoM5Ƅ +k[vLI,X2\P,y rmqoǵ:oMe:vlt vԍ$!6QK_G|+ܝ5΢}f[O'Uq9邷Wҩ4UA@]0dIh3bK-o>ؔ g亐qH< )bdBoG ֺzOU+ĵ.O[܏DCEzZ$.t׉KUV]H} 2[W­V#.uV#NoQq L!S=Tbk6KٖtJ*VW(_nלɽK~&+P*aa'l{$/!oa ss6%„"裛-šRr~/O~SFC#I.2f$i%GvaojͶ{)Wpu>S:.q2Fq!:iLT('gvM3-;iUĐ_KٕK0tʦ>5uSufxjxPb5P}B} m{}>>m ˅*މe^~}\K;yq[ǯEW7w,;. Y( Ohyke\$gO?~r-Ņt,se?m կ1J(I% cMְqG7[//I 5(_W>ig7*B=5DvYkd&*zuY&,Gɵpd8n#'ξ$ 5SW:ݿշ ɖ]eЩ5F#H+t{ 79=IM.q}J$IxZeF e#s]URQ4H`!D ܩϜvctJԍ@S<+o03-!u%TiZdA>c:fjZ,v2/J)`3TUU9i,PܒÁϳ+O#9LQKIinFf y8ܓ#[]ܙQG)FoFnlv˽Om13zV&{hTIemy~7j(hXLH?Tpli{y< B"`km]H2n{?>bֺױ@jNb5tQdE\7XnݦoDtgTաuq_kYy?kw{_uwC}/F|,Mw2GppANl4>>,[R4Vn?}>7h1{f$:`#I@<FyGKrmm{3IJYJ +tW,:rՎ=m1N Ɯ0zH 8US040"H(qSiD_S,4SSM'bVJc\Sa|yFIV@ᘍ Ar6E >~wi., -;Hœ)֑FZ2x?Og/ua~A>OR=;#i`4B)9{͙Z;_o"l锊ץ-Giqj):X3Zޔrƞ)WVǙ%I? 'FV)P<5͗"J̜2V(,TO%;8$Mj7ܪNSoxwwۅc2&WHfʫW|ˏf6IRKVKGuQMô_Aݸ]öe+'Wyq3 ܍WǾ휗a-Gh:r Dڵaj~=I\, u%Wt\W <ΘkۙT$< R)ԵƵ/Ȯl5^w!6䤮X\^Aޮ7mqA ~mxێlP[ZZ(ȪcZjWRU{C&% @+Ƶ?,p|鱸pd`28$*q2U%U=>8TɯTbf A/>g;kmn .;Vj`fZ&'rd<ě1 ߳/^(yHDEv`jgR( ؿ0'4Y]Iq00]!4&ͅ8Σ}Y ̡w =ܸJ!Ei0%!s0ݵ;[ϰIHE ҲUQI",C9>~s%+͹IXY4VEhXLJSkz6^w>hE[XɣV#W~kNaɰͅlO oeqN뮕>/dlqc讨ej2IgI 1B'|Sz,sՕiiW {ht]>L+1YQ2TJ4582<[?qdrrdOST2y*+5EMRyd]-"vР(bǩ3zv 9At􉌪#59@N''H %1j=ÅzR\.oQP1t<>6HcgXh ԉџ?g6&On|6fx1OOq|F6T r1h@@iV)w<.i)hh@92AT2sx{uڂnWK(Q5)4:TS̖5%%`U3FB -֝Gc9pM-%O6 I*7IgeH"TWVahs2xi*1J՜F<*T2m-m "&A^`>&1*(#K3՞T}II;S}nYsT{_!FCI J%d#sD5pn>4T[._9xj)qIOUƏ)J)"-l.K EDm 24C/rW}st9/lw۬NߵX:(n*(j[DQY莾*7^ +)+%Ih|K>FIDV9BI);f6en[3ZQW]+8w$DO*K,Uf@҈cd HyN6:oj;*3E UeI*Y)6zmwor[Ȯ VT 5V̐0mڒnO]͹\#&xi۫n3MSKo\f5,nd嬆IjcLj4;)S6G'[Z"ڝ0|.F DRG0$ %mjG5+I֪,zM: %- v1VgIe@1)eV؂qOA_/$u $QBO0Doqī1>f;{J a>+JoEc-Q Jwi ,ňU~p`:}h-K]--4Pvb-V矞;U C< dMGb{c *)pu%:b6ceRӱ=nS+9#%U(Xx ۞ͼbx$#"1S{פWQEE8BԩLZ!N량?xŵ)}F9%;qf2ό C[%h`) n-fJ޵ye^[53 _4_SP`j$n| 5MA6`6[+=&a;Lt(@Cj5ziri K@B;HYc j]PT Q7OʊI7ܛ~nh+d?TxhھRU,q2n0QhV!Rd%bgrUTUz&@DIyH/ܯ<+NjD`)#+)R BB$F n'd3:3b!”URMNwm۽yv/T,bw>['ݘL,z%1]uB$U3$EQ0hXYfHJ6ĴԕåH$O.6ڠWg g3NH$>&C$?R*p {s;09E-*bٟQ*T7ZP5}vʝܘUe2u0豳Wiq4g'1`;b:J~Y(fj7zZ룒: 䆩"0hamyح#CJ2T+HRZML'0n;n[SDH2d5̵ xG[/?{+j }YAHxʄ2T~,],e I eZL^܍zVWO.s#K&OMY1a*k|(fX *W { iyfC^4FB^0O9M5ܖ(i5Ϩqe¾Sm<$Gਜ਼%=L5kUW2εQ \ G#x`nܐd*EE==E0#EO"ꪡ7K 2A{]ݵiDJ1"+hg45mft%g }I@1ˤR ЌR/랉9U|pV`uմ5X,_}J~P!5B?nF!As'ܵ䪛|Ɍ2a4ӑQ#KFlI+IK,ẢCaBը3-]m!K#0:CFh=: ?Ho;GgGݺ]SE6ݲIX j5 Mey)hkvgڙZwۙiTJg2G Dvj9& (R `_.˵CJ:jO(g+E`G{zR6!5@È^g+ۆT,N&66,w%}zڬAP.ij-4ɯBgؿ6>&w^X,^;f*lXvM$liTi"B ka*mN!TI$V3P% 2}_K2ד9bz-Ep# @ ek^ xnG;n߹u"Q1}MK|5QUJ~ [!͇&UTQ.Ny<>0Ŏ,ڕoY7j% bfP*w?t$2-%નh  SzD (\ukFʞ#r(|18x;IxaeґA2誶TԎ ,U٣ Qz~⡭H4RH*\B!WP"y4E\Q?Q>sOd஠$_肠RԂCƤLӏF}'YnCRd6>ܠܛ&*6j`J H-7!.%ŽmH󙣡"E,DX@:(coP^y{q ,8A:X-TU/~^fE$G=:=>ZST0y`.};~*+ٙMMZGJ$f0h-b#ZF4і%xp:n<(Ԕi#⑮!̻^W|:J;*yJ dᦵFI%NB('sZ|Wz\RfjC[y Kc*UXk*ڳ5_;UdQC =GWt^:x;' d2 dDৣ^)l}51\سV+qY&o#/{:8נNZ<=GR?jW4 [k9e|:q[cumie*%lOTe+ P@*=>uS dKS$L.*aw&M#UEj Vc&ֿnV=Un?;%TVoSu`0OQ%M L#p"P~Gڒz>ucxͿl-uCYC,5XсkopH}P %*0NJ!T[jn2{jY#Umx18rPn % $[ RC'Jj)HzCWH2A:E K4EI-:9t |M:io T#xnu(Dr_X^&f(KF# ukfh࢝3#4)I59N@}}-O0A\O"'g#T]uu^wBhamrD01$5:Xp4V^2X؎2xRО,\irEuF~?!jHV/z)\P*q{v%Uv!QQUFu"ռSE"1@tێ[eouD\P!z&I-юmMU]:̔Hi3%->N㡦,Ey卑X LWPK9d,Qb?ie3[S ASq$RI%E%RԌrm`H02m:,@?Fm`#MO%B%db&HqoVe_Oe/iޢkc: A5 iͧ~ OOwYoeZ/ ƃ\{W5#s;۷װe)koBUt:|R[zSr+|xMR둖RM*T Y-M99ue$NQckZ׽_.P}gVSۑLRxQ<IҺ.A`t?OU;톅db33\Y]:A'汈Y9=x }LȠW뜎Ry<촻~F\r88ԱXZHU{ dGdNVs$ܛ| E~X~?ʽtr$eK_dt߿ j}Si2k+mZGS>jV7 $E@Bj,96k^ }yeUXv'v(dH"rf~?uQ)VZs\lSK3 j$]Io=STxid<ԈR"$۟`n`-<]N+)}'<]kBT.x|%;F.Mk#F^#$!X/m9vK [`Ul4m%&Ř_/k.ẊFd8?F)NK5{~:?N :rkdOO ]M4,䖙P_hjd G5-4*BdY<.^H1n M8g8jE3kG4Gv\'oݮ{IGic*sbmĒF#|Fzõs䥢G&#teZtgEF>)o-0/ j43Jf?_yY7t!Zf]bF 'LSN_HL1$mI{XQIV11[ ?O*F0Y Qn<ix!Dn=}ع[y|er<Ӈ}dJ5Hسa/g.bֵNLMGQ X#wf-] }ƐUg|z>ͱ5쬱?xO ݂>'/Օ2vO1Oy׬7'ۧNVugYbr5@eZfa1%l-wԨ.n@'VO41uJz[@cs((XZOo y <2VN?+׫#dGr<7T7x%oDHRY4*pI`gmhwN휲 NSQi.cX*O@nNh7bJC0WP\z wط}ͼٳt wÎ9YKb{jo='}&nA$be5r,ZIqM6+ *t[SCƓoOAXGYUrlA! n}I|Ξ*s#M7{ 3ND{MlꮇPz -zz}'E`Ƕ_8%AmC2N=?:ӎ??`{Ԥ7(6:#>=32 V:nQaۍ?}9qam*3Xŕѹ7zH^_DBq~ٙt[Mc`@a:E5u5W:v$X9',?QկH%+ꕈ{(CZǁnǟ`c.luFwR^5 e?Bx$"g)'/} as׽M̪b~NM{0$#*56J *?yosf?O[!yH Èl%_];dNüIZ7~OAzBzz鮽׺qVS(%~K=PڵF#E+<}}HT?CN^{Yk_ç?7$7ɰ2(7,}mbRdw.Jܹ'?0XQN?Ϳ#g*b ſ6|0P q~x{O#7F)|uXLAH#bOBDr5}E{WaRqa֯c/c{Qtӣ Lo?G⬝?ٻNDGY^{{u׺{^0ZF *"}yp8}Tx"}{ݧ̬n &ַF*+[~>̾58؏$K!Cf&??cVfIN< %E?l4AZ] ~E<9lvBH7},e.] =<?@'I\X&mU.~H-͈B5St4AM|K(UڹO*Ma6j n8}s5CRSJI^E^璦򄕿[8),Ūbː,U$t rt GϧXQ<,dԵ [BHg:CSx+y]Z Il]y?D/J\NQ)A-+Kš8/_7!4f&?EB1R|t/ %X:i_RujPڃlƠI.OOYIF%4Y(BR=*Y@(WQR/cHAI ߞ96I?qC*Xrk{\sRK!. qGǶiE:jN\%eq기pرdZ ~l$K\o7,nn+g--c|ohA* 7t Q$pO Bmiex:iS:>Pte?>*i#LƩHΕ[! Py,l,ap A4UAOEMj*B-"XsIi멦v jJÓdԟ{=å_:=\>rb43rj$ BGY]ODMaŇC!29_C:ƶ){zT{^ͽ  Pcd17fF !Nh*J}#jN~䶭AiYI RLVy q//t:XäӈDRJT$30m-EAVBX* FVu_.TubtA+i t'ZĔH>RuPFnڵ وbH#M#ͽbĪkJ>n :צ|$j-dsX(6mNZ[@op41[(jӏ_F:R@(*X#iO‹ojltU7$S]75Oj#m~ p<='eSO3 4`ܕ0޺@#Rfd~{:W;8]!:UI>Z24$?};*, .r`Û܋[{9nF24Lrt0JlMڏ{rN5BIxPʸ6{F"obQ'Ctehu$8.;۳pSWG rdf;5AHt 1e⪲J"dfT)2״UV?Kp\9/9یm"},5^kCO$ (,Kw.w)Q,ZW`yɷm֛&R%WҴVzZ J:i?K,h"TLZI ћzJǼzbIݤPYB~F? 7tv?BB.&}aY))fR X!32$X{ƛmǛ>b6"4RR#`q,R:2V0?5[%muDi + $[AVf6G9v^'ڟOw^w+D`(4qz ,(HJՉ7b|IcWLOK/RMG7$V?||$pmKwTU?٧ˣuT0 h![_ɣYg^bʖW}˙jTtZ$$`$=jo˜i(Vщ 218PH E[ܥG7 pc1Ԅ9U6hSeWU)z⨑ ňQe}bS16Utu5tխ=< .㉮WD|8?^s"KȰ ; 0ڙ}\n0@$0)y"abE֚ecy˛uh@5~t==4OP 3$ H yP܏ͭ8J}UwPl-fnJ,J0ah;QMgػ/jG}r1Ga,lɵ3jfND7׸[<ssC!a] 6m4~+zr{/ ںTT>{&?%1uUU|uNnX0<5!)41`WĨvN^ue;Sk K@q yQNUk*6?MIw%n@ [>Ncܯ9mkE;F>;(f @8ucS%,Kĵ㛐?^{ml]e2y+a T|*ean "{ؖmjPHQkv`‡E[r1n$'[ԳC b#$4#X6K{uu>ڐ:z*W#*/h`@/⑕c>{n=Ȅ EmTRU2.pH!dS4>fo"Py߽?E;."[CMƖ-k%4uA}AļqAXxHfi#TxjO>lK 2UuqVgQBBCb ǡϽIXpTӜ59$j>.M.F`l;ܶ;{^1 &+-L҂"C, Mnz*csx쑥0uX8ԙdM'a9_Y<nyd۷6/⧈U$]@ SˣS~VwvڠIEUg+q3Fv^BbRIAKP3J,++0QG=LM:#*|A13($Baawm.$m)F;[_޵GrV*kSȓHHͤ(bt{7d㫳x=QH){9)rϓDbZR&e?9u]lgEhɤ+aP UN^wa [DcKE&:j)I'Qb3Bi3۞i7{nY;o5c!l˴1L® FlJ]Mcz=%>-%LSQVژq5#M`KЫQQcǙdWI4QXMA0J1=c|[q}M&J Qx֠ j*ōSNjC06Wm*hb9jmAqʦ/1 1ÿgL97{?CSnZi蒱ijib*(fW# fe̻]; ,S;,fiRJnS]7]r TƊh#׭hhzJo]_+~'zWaƛprksg)nEY&ӂ=;N~Ei%:E֐|ch{cbSJxEe 3 d @Yelm7xLnj~m jh㏞dXݶ Mh=UI F*WnzM+\mF/C,MLMj(ȶ2=pd$ԅ5:K]rp=%N^J̅N4$0F CVmwٮ_rd F"&x^icwmxcVԊVMPT'Sۻjzm\v3bgi[{n4mM^&<~#.p~RWW|oJqQc6v 'ܙJ)ii(Z9%j5/nG#`ڧ60[X̀TƵ?ﰴкHm^]xSj1]mJ⢥<+T'vSo`m[kEvLJ30tX,V੦.zz'vGADnu+pԑlj]RɚTZnJ&s!yWSU4H4+PD>P٭6ƔHG2v*FZz.RޠudвIjEhsZt/wa{;gcwIZH[[9 &y$R 5KFaE} Y ln2X& umK*tM>Ocw$h?N໵ڬ+ŊuT> G@h*'ݷTZCEPbG~Te(7Wgbz1pLq͵.nۙj3KVu7Sog N#UWUWMNT־|Igg뀢͕=o->gݕ(!' yj$1PTv}dj1յLG555uuQDE瑊/P&\=9g~B|YvCy,$eԊ5]_T$`v]/_cG;[ڬnvɬUa%o%r)R%e `oY JBҊ6ZRe5H\HIb c`E/7`NjX#Qa i)gTENG+!XqM))fHi)* UEtlcUV]ɔH(8v?C>rN\-BQ5,Ǝ!8u/){ }4*Z9ʭLjRyZAB|ޛ .f@)uD'h#L#4W4n-ϵV,ږ#OV/Z>9%vF"_^_{̛o۹l,L UfD&J8E)ʍ[Om4L$Fa[O;?*Ru50@*iqQϡ,EHeak?ln=f#nɽqj IPսf{( dI:]=PXkYt^VI%]21LF(צb0n'Qj[Yڃ.Q$cCZTReZ@XqVsZ>T9[cAc;:Z_/QJ垯!3HTF::$}Lc|U1)9'H&bF*ҏ Mݟc}I9:EW+>M)XS;Se"O穝Z5T}MjXN=":^u(U&IJ11U䦧 )+`2Fa *ʆ26:P%Xr_mV@/^%!XcQDrR/#:,bH}E`fQNڇq1{Ji樁2u0Ƹ`R*ԋXi*66~ؓ]bne`El#TV^]\HA`Vi&+Dd]Jt:|m5{AG2WU2jQ=f8nNekGyVM3t ,b@5HAܵ޾?kM,* \y*Z!@umnC2|M11:ƢXb:"h oQ)-kYbS,opEitN'ff:ѱ6$tki fI?lYbuk4,ߟTG )$pұg0$l+o M{O5fO`ҷ5 nb* ZumL[٢tjHr8(U=l#HhdݭKخ%iQ̆cӢ){L}փ> Iefaj(CU*Ă=f)$IJޕMl')I#!X[KY8jZ)M˸x"LTÅ>G5E^$+p=|_R٘Dj씕Y*LQ*Os30еukS<..ᡉHtGdY7e ~=ZQ\1M[-SG {!"4o ?Ά@V1\m4dqI:IYs]|?LJCƞ0*|?>{U,T1KLb-V%Yh:~%ER%lZ5025!2+TVziQ4_Cۛ?}_mO{%US*kԑT *=bUnXZO_dz昰4NP^jnNjH'EFb]i]H 1^SŽME Kb PH%Q1RCb}&`\[}䖈n?%?Gة tցOQaai^?{@gpe!bnAlH*Nkq2SE\`ZX[rE?}Ɇf!8웏zՅtފtf(]$%ʓ7!+0X>dj8W4Tt aȹ e1m9HR9*ob% ʹm(=]YB_;܏餂y~SB|՞v iCupS10b4lWjVVPpG[]C?^GenT c؂#h}Kظטc#YJ5E#b-HՂWGġ׽[jJAAm`Xۋ7D{{f0c?׽^/cBq /{ַ|5>~]6uY~_Џ"שּׁ mBOqpCO@&:`xu~׽ߺ^5#}OE6-R'FVEŎ-C!TSu,y@,mePtoe+cۢ1Ͻ6_CO(?A?EU䢇^ >Hu cϰ@7U " yt V*Ҁ9uN" 8\F`ka}!9iJ vN>&>I i|:S\f #?=o235 /$r{~y܏IzkϦcO~q?%ׄo?7 M-홍4J-_$EQnmuܔ)6R4IoS{Do$[J]!KrMk}?v+Eĵ^O{Iz{^{{u׺xX}D;9M]Y>4G^h$ȇO& s2O=e$/:'}?_f ȱ{`ͮVCb-M+ޜc gx2-cb87__=TQ6>,~ro/u@)3b/P1~ǝ"E9pU;XX$_f/hEuꪂ6$UnI^uOߏgsljaSX,nA`l~`-~{u\{WU %چ2qnX>~!#YH7I.ZGfLQftAqv{rz**ʼPߤmc\ObQztV:Ra֊2N@NnxqlH>q?.8{yNIc^a{⿑H#RM_oWTHCbi BHcouA=P G3{0]GHY& }4f77Ԏ V]5t/[,IQnjS}rF-d7i}@%YC},5%~]Q]&: ji u(i?>֕IXb٧W_^Pޙ$=%iȭfj)${>raz&&d,bm?*E ?WIP߹olIOcڥd:du74U:ȚPTT5?ܠu$[n-V3@FdUC)c[xj ,#ȿ?Od+<+~.>Қ_7'HY ȓK,3pFUe WbREXC`I 8Nt("e:7.K>8%}V!S!t=WC/eYAg UD}E«1 _r6KbKWbKJ\ \/,?óqDOSTSST3]zr)}9b> 8K`Ӷ.돐. ~G[iYcE&\j6%…P=W`*<gZc@OQ*g02BK\ccXZg2NupQRł|&w/?gIzKO -t:$_y# JYni.8?IZ^C"K D_]^2L=#B$[Z?pm(? y@ @.Ǎ ҷ}=+/Rabcek<ӎèX}"uI9TCUX/>Œ-N0:1`MƯ"ֱ7{H2VuT%Deag3X:Hv't*-RUK8*ЕaR> XIhR)W u77i:\5TfV3;N[KV_?\:݇e7Қ8qĢm P9XqkM4LdtZP+m|s-sq+%%_׽2nNBvr'%YaS`ѕ?Rxd[+"\zyt/7X 8^u`{g02MS]ZN$Ȭe7#W7Vϳeq#Q{?Ѓ|o!luj .j8$%(Ό]@)2)-~g̋uY^4r SӉ?.ٞp+׽uáܝU"kT XER9|k`?g|!Ͷ" { aG{|׽@bY:ե)XBV4E`(m%K5ɵNrQ\2ta=ئSu<{=XeSJg*Z" ʢIɬw]lXcck:2rƯ^V佲["FN|*o/?T;v'zc#uE>bLtjeJBI?!JP[@ix XvB^ir1~YdDePRrʦ>Ki9Ø7+6Ǔacޟ^|g8+t(J&>9螝K/&^[!:(> zk6=}ǿrZVkT<)j% }oaԠ+~ߑ|.lv_DHi­JK0U,x  3jtM$)$I Voȥe,$- 9-{?ynylWoJ,vIk_+76E4?nO">>j7MY5x4#єp>#m{Ȱi&N'wHp|V>JvkȠU)<#0Yom][u)sWњ-<4ATe 0e¾gi|~fN1i1 HPӠ(~ oi}԰m. UW 8-#X\:n۸6~~+=m-\)ѵ]ٵq]붩(fbEE:r}ܞԃoQTWdjecRwkKZ}ii u3i`4wj^u ?ҞgYR;M Dێ3:볶_ic+3{#/MQԥ 4İZ`.5 {[!\c#I6BR;4,Е}m;-%1 n9n5:*fmf6mmk@ƵBr$Tle, /#Fe*4WSP(rI5G{v?/N"iʍO?5?[xJO+#nUD HbicxĀSX Kp3}O=ٶxqߩLFJin n:AH55kDi⎝Qij8P$1vcj"/W9*m٭caJ\|~tpn4;sW?v`JJj%-2ATTƺojly5 rUZ:9Q/[@q~}<#*lU}? G?R >Tz|Xz|~~[7jyWbqELx5:IFzl U _==D1S$R,%,.6Aԟ}vx#Fҽ6nHL#~юu1TwSLs*unTc?{ư=VyZ1[CmbA !U)Ә=Ų{Ohuqu54;]NBhi!ֳCH#'I1$&XjL9IVXj:\=8G մ\C:Pz=9"Xy; āFbĔIBjG&u|<'dlG>iaaMcTY)'Fe#J! y).aڭ ֓`Ⴋ33'Y717,;꣪I#XWe sT?Nœvng*&Ot#[ҋQE5N[]W)an:rUd*r*EaN cٔTڕU]OU,MK> 0♟%#?o$~ԢwɪMEhJ E~a{nQ}|^ygFewj C" rMݸqQANq=l#,=+I9E<9\;dDՙa P I)#X8?];V6j /pP8\on-hkƐh;W3MB5"*GICʨfU!qp7+xpxrGIҕ9@5e WSH=ߒ/%.W'0=b;۬;bzjh]c4/<y}|ǕIrt M (o%=aÅ K=7+-i!eƣP}EBHK5=(z33MjE!J yy q= j{sk}ܻh7J$\fCtLiljs."*] @[?kIWaRqR7!M8*іC L̪ QZ._Z3wFDVtfgЂ$\!#aBpi8S& y~v@|gx\Nr0*#r)%=ECGYEG+hR& wqȩDdHech)Gm P>oyoiq,-# CIj$8G2NP3s.Ӵ+$qP`C@uݵ#cv3tbvf5f*5~M6nx㚑%KTM'{j;~EQӈ'f@gt78^0^A:k2ľ&ct*2=&y7Yܾ[́]$4E(5icٵa^rq~~6qFק5tԑn,mCUOU Nṳ|mo|v7EIQ_[U[=%<4-X UqN0 X6rF݄;3IҰxn]%+xƣ@z϶\{Eq<ʖKY$кφFNn<8j2z>v3Eպ)W GQY\φZhR%A+O)HҘ4P! ᢬Ϸq_lN*jRd:E|Q#<) ϧa^ksK/g(>h&Fd*B*rܿs7qpcgH!3O JYk\ Ob _|3;ױs5tp;ٻSo!T6BYT2Zª+_.FŃ;,o(^pК:Z4*[p [bnf`GgGE)4'#=C?6$Id:Cz(L4~f06U&rlFam&*O_HdDHV&ZhCt$PH,䌀TfXΤ%KG 3Ǫ TF8ԃӇRǵ;+smuU*;Is%0Ҏ$eV8RZ+: #s߬M86k2Ỹdx zG=ZX{n*.hE%TѬ~X 4ITE&d[c^ibgzXɦ!Oy$unQ܇Dm@ԱڔRN8WǖGG0YDun N/t|gW|I=&jzD)݁d :lG.Ӓ z*w5QU1ǤM%3YK-_dw3C. `S)s*#w6Z?+5UEn0Tc594*"ji\hصt^ib:W;"tR'Abٜ3;ŮBmSO?c$4u\8kw׀ӆJ~C)$y)$%9k0C0P}-.GOt4y)0KTOh<FHƵl3S/gPA]U+wv#;zv4%CG, {\ۂz7L憮z}JA'{7GnyuwuR"9¤ּ?D>$/Ϣ=]rmE_b ihSdF /˅ij)#RE %S U\{1[mfk2Gƽ?s$Җ #=ۯ?c'bs +Yyv M4ONVN'qfi)7!Șc:"o:e6&?k<[rʑʥGxˡ<0Ŕ"1;nA;Bʵ7A%ܯ0ʩUxH)TjPb}~{05W~Z]PV3v"t钭,9#IW8omϾ5Ð 4H2DW0&ߢۯ&O (I|\~>]nBUn'jٲXUTVJS U*)6&{@g{s+ZILiBS¢sk߃ob=Ln|(_A1^,jſW_OΩٹ:gr$U6"ajDS5Q`]([))&F (+S"U"'*%k 5_<ϨueDru7tr1s q(ꥌH."K.`jL3Ө\ W(x $0'V#^.7Ȥ?F]9aLD©%CB)fILHȵ>_/>~Tf_ $EMQã u !6sF<\632.VW(*(I҉ppLDt&XԕW ?A?=%2ckc8"B&ߛOd;K)9> yLۘJ?h7bG\hNƺI6ylNY+V:(UڢYaQķ&.}[^mYr|1xv3S?``[hhU]O5Ӛ]k?KhnNoQڇLxJ)ًIspQZT*l 5cESK\Z ^.mJy X5l)Z4)\e{_CjH3=<+Ip .NV)OP+^?|j|,4REd;u]5X,Q%02) "vB&Xo^ S?* 靻;m(q^؍)~3__>"uxV4o1iv ǣaHSΓ%; P괪,BdQv x ߞE=: 4*d5445_ݞ^n҃WwY{GSS ; 3fbPxkFFi$O!rLh +&7_W{?FF j)A@6;iii 4 .;q(zz]@ʴq`L\$<MA 48 `lF-r!Y,-!qT۠ga(C!SÏ%6fm ҩW}@eIp~ Q|oCP5PB߶ٞ#,CqzƆ=~ckHaJ'Ԋ5Pu)b%X>̨G(nB3j,H>wcS":hxcwKRAnn7q:p+P(`Q Gɋ*Ԋcx¶(YQz%ܹ>1^ڊWZ__l/GP8)ƿf)S`=K`}vfA3;=0dinY 6"8w\TW#8yt kI1Wņ.MY3x QFVKcþV-?` >P JuU%KDFRXAs='(6&KIct ?~8oPMr_?l-$qHeaރIV]:s[^2ݖe8M\YUZt2izxXHr}#3``wEtn7 PiiFrO}'[%}ڗ]rok oyE iu8ɇJ)X?CNX[ Ĉ٣فb@-嘤ɦG&l.T*j?gBDB7tؑCWH!=6ڊ+0uփTQ ڄS3'qab/?O =pB\tA\so'?>jH  \jAVK@(5tVW-+S|IT,I`>o>իuRޖtB ^-nn/}EMPpMɭӈ۫@|_S^^=٭R?PW= n:e r޸nG?λrM~:I TFFF6ϱCQPmM<OK sӏXh%1۞}x~j#Uok+q3-]nH"?OŎ1׽ߺ^~{߽uj,JUcq>$+Pmkkqnվ*b'G([zq`J*}_=8Bͩ\ T\:IO^Q5>X}xXqby`Q}68kgp#WHGrz?ny2m ą!`M6=_|Ws[/@O(XvUl_oѱg>?ֿ?[؏u鮙P: _6>5a *ܒ `?]-> =t55~-?AZ8&.ߩ}׷mSޖR96%Y'{?X xq:iwB@*ֿ}%9gQ_@u?]~׽ߺ^~{߽uy! K&H5 ߺ:AgmPizA)uU?ß.(Ovm%X?fE Ԗ/+"z>]6x^?ȿj!,n,\{jRitchZH?I=Mpt]MoeSSQ[?.F׷[Bqsm,8#Es׋TӠ6L'I۟c.Ye= 1 l/k$_i$t NJ=+vSTKTpKrNцSBV "w (k\q}wc :~^fu2R%鑉StDĎmŇITaoYz򞉷 3W;mɬ]O73?zA{+rI;,@:N 2xOUƓ\'=?KF~}JiB󚤌GQ{- ΄,kŁb ర'-@s)}luB"r%z\x>]6(1F8 \ {$ޘ`?n-hƯ;5SξAԊ,djz{,B $Pjc)’ }Wڭc_Ɲ&=E=Li *%'%^O+}Po<݀_؆*(N=w;YEJ@alu_i\*-^x 5~~)[l-$)oytX7M2S+1PUê4eBŋOaP>WSΓ?UOMJRK^up4mDƛ{PXq؃8$y穋+ ~nVE`5#C_꽩^`uX[?J؍V~Mn Wκ%+@ y>1ժޛ{"3]^yKIH_` Z=zfiHP*J2Xc+ [_#TꮥA P?׿؟y?te K`4T%GVU(ƛX+{0%?>Ȓ&bWG#˫S!P@e`#$*5 Cp=X\$c`@7 Կ=ݖӑ|5_H@F k`ܭ7K~{U@S`[W !kln"=5˄TG@kY:X!iW:ëM0pW'OkɥzI R6G EzmT/@ql'n-ٟjz)$q4%UOv6|UVcN?|?:tK)ܥme%q6^={ݐl&75tG[.x*{GG)t]`71H W{=ױJU[ͨ36سaM>Å+ys]& ]jjia~aBzA3j (bs'AUlΘ};_m>՝)$ǥ\rI䩎EjG ]Nʋ o鷼y>[+d͔+hEP=JÿmN#".z/#^)teW1) Tx6>_dnN&˜;G?DH(4@An<.6fwh߷ .%}~.d.^T@f,F)U_ū: ۯan͛Eԋ]L榘U]iH0 E8R3~t%i=[AUPP}ĐD* e)L*"Ÿ@$M={]>{#U!oTBHy66pNpX]?ףυSa1Ԙ`Yiv@IW嘳^{uUL$ꄍ]2,q)$5_S"X++K GNr2AܬT.5zzuso#hj+~K)@z# nW]ēgu_"ҟm~|ߡU(-EZi)!y5;2 丰H30sB 0[,5ի|o{=hx4,H~@A.|ާaWIι J_,rM% :Aetl䥎()*gAwJˡd巳V| PKz#D{s*Gca#[ ( _֯GY+e}1luݢ1 Rhcf`+05GE]jI5F[3n.?O(߶^ط҈<4QQAN#G9/Ni y! ty6:>EN{mTSh+ig>B`ŒDFHC+I(xz}Ln?bs|6>j"Kb(Z %pc]D-(\T~ۂ(嬣vbYI'bWFu5Ǐ(&KZon@>۴ۖI4 Z>^T}2ne%蠡(Ć&1Ҵ|v#pbh%3R%\n*eei%W\(KIXmi"2\RdA>,HÏy{pۖHVuЪ*iГM)zQK3U$/rW= cGMFMYV(f%^j4E /:bOko(W.\k*87/H-.]́5w-8PdSp5"=Kn[٫28 ױ ng:MGP,ysu [VKa˜&2l\%IQ$誮V ,B"S9kkGfĉ $(kj5-tx%(Sj,EuVzjP(&'Mݧ䬣+.w!):kTHb|Q"#U<dSU7JTrH H|Ŏ v{IV}tiD9Z5![LtpKܻP'WGI4H#H'^l$k'm6o࡮ܛ3[0]O.:N*(if>ٗY@{*jImQPȑFޡjRI<7[ _/յͶkV h(:t>g?}{t;Ğ!qJ$QUio*Q^cff]׹L]>Tg0[%)1Y=I @PkwgsrX}2IS!QUQPTK<\ˤNIcb>2>'5?p-Q.Ж_p:޶um]GYWF(a5=,}qEK'CEasa/XYf.;H$W]GI0M0GK6d2r{ͶlR4 )V>xYao> 0{kpGUN+Z|U>Y/_yΒ['|۰WӵNTZzZz?"&pJs|WTSe\T8XZU<rѡ8UXae\wm8n(+J_Y98GR/[59/ PҴXSϫ3hkAAEICD%-KO;Au\8;v wG堦yz|\ dM@&IbT*9<ͩ ,eWs.RugPSǥח-4qW Z@1:m݇7m==E2dxlu4XθjY:P[_O϶)\EKR@Y=:dj֜Lm $.^\~!Xc)H]YivW p8!uön+|FP@$P B//Z4-P_LSúV;:ֲom-ۣ7 5r.S&EhZc*,HϷ7}Vޱmny/ƊuWQO *M:nX:Cm.Y#CFM$Z Dl{_]&wD c A|Q㒃%nڙJ@ r53Uљt׬9c!滍ʪF,B5EI'3bv A35]'OC5-ONJ29j݃#E+Hٚ;s`ɴk*y]+j2vqXa`Qo&h$HFRh-*P1TAK&rI"csbXl1Gv]k'faZY'l=-tT觖4 i O{FvRAVVn-2%,(D`pB!IRZ :qx̦NRRQW.*'HF{{oXvڴ1n ʡ}4N2SlJ ܆yJ6'wf@۫+"E,uNQ52bP z@'ɵs6|ۮY5=[4]y5ëˏGl Fhi@5 j5)Kof^o֣q5O nZX+5DҴh͇C39GC1`f")YXT H>|n."dyҡjFC<6ʰ;t1fUBVUS2+Qfn -e?y^|4u`Wn|,u#M%;c,[u *'QA x*Mݨ5T¦kĦZeqtMFSƯog/ |s/H^wծk^g!K[YUMlMhEU QѸޟ%0;?vt6}֘ʭݜvEIg#!LO$b婧w?Q%؏,D:՘u5*jXa2\.GO{l.._ u b(U~1tŲMGmEQZ816UX((ivpԥMMf>JMžTXnL (ǧR"O(QYRt[9'UK'`- Ty؜ԭ<Y"#{M=& TεsFTC$єM<1S5B2#sڑݘnܡi4W4iR{C2Aخ$6`ۡ=RYdRQt?oc1]mzDz&hw^2OIL>~ibG/\8O󆊠c1J$jI'Y!4sLʡ@XdލnAt)@½kV ycx;Ih"@j"dMcjƀu`7|X&I ;Rxu{zY*+)N?QSes*|]Y *=]XZQ +ᩐANiFjWD1s.ٿXEdV;jHUQCOZKA4\c9gρBYUobd!a}ۃ'kfTUx%D5yE4ychڛ7kSh5ua0FFյ㙡c/8N_QQ'Hҩ$Z  O]J6{{˕Y IaCBTцxC}i?s =.0(7#uQE/QG[KHA1߷wck mcrhw(i!yڿ%N>rG ~.QH;n77cl~4!r'xY5 #ف(44ՠvCGdoGZOST{+cb492ϑR'TG=_ؼ7GRO[YC652,) ia>_KF߶rĻbjܪh1 2kF$d6{Nd{t YQMos05,hxӭQWj\nwU>6T ):**b˔Ld$xv A:};_lxu$ذfrivS<BǑfM5JRSjzkgжkT%hj{{i_^W jZlJl1sVSUQd #Ƣ6$G޵9i騪5\=m&ݎ&\O覚X dh%0ox|9 HAr4F|^J-x,t!@Ģ|@ qj )ɥ4]Kwv斧:=/~[f"vj0s ˼34p'N|RK匈cتa>>4-3Hŝ,İ(r͎ŷhw'QQ\PP>4҄$ڢlW:uơVGxqNa {|}Fw,=4E@M JRRWVNqcѥܛܨ@H!ݗEH >ZĝF[ +{hW ^ ALP smw>rt=bQtABJAPfaJ :}=JhD%R3B,I9aXP41GwG\JC4)"0E"!QB^{*${{ JջIp|kNZ,mRKιۻz15>_+KC^?W˼dڥXSK96i edi%ĬSQ !@ 4AZSCZ~tGI9:lҩV[E'DS#@Jc'Bgk+(Y>roEP"F<>:Uu84" ǥclQ3 B9"IQcoǧM]n'pn*,U&u]ݛ֒s ؊i& ![+ 䣪դ>ZHl#)TXGpȰʄ|J2MM<+Τ&w͵Ń8 f4{Cme+sY(;벯4H e>(rJ "H'bX/6R2FoyBMK΂3NfzHϽ +tM)I;STrACDgpĕ>]D^йmG3AL3dQ S BBmp,8ocMzn[TSɮ>y)ז5fqoLqoAE5|⨱SCTyJKf,Y~ :-ÔMkbU@U,*,R}s`E ccυ:#V%+0u`5S4pn kbzh(.[! CXۻvVn(&P)تLE5{$~F#u<;;u_WbJ{xco'H%ZHDh7-&ۛ"e2I:!c#+ki6{ZBGxޜMGzI2Fj?o4Gջm}ۓȂ*uΦ0㒖9[rG-F\)%4 N甂SQih2o[=xߗB7sI[R-d²`G d%FdNHwf6 C[G'ڥ3Tq0,}D-'܁}u|x> uzzuE;FKvr ǏDco$UKPmEo2C$T,݅of1q֔,1+Ua)ઙaF5HfӦ#f0>.HQ~ eT゙YS*WyH3Ep+ˠ# C3ۅ?/}[ܱ݀6#,Goo$d'=0T.W_t*]@BL`Ԭ*Vp^J[tHk_W6C?WE$SлIKeu񦫬gXnܕz7%W ('nOے$.zdSEbyCɥbf3#Yʼ/|}^[jRň%Y'm'tܤ*p+yMQ' dG]Fn}{dXLoe)I#ͮE>y[MpDdxcIeӚ]U8u r!|Hū9S91OvIGMmPԣr*ZD e,ݷSGStTH3#=bHN.G>ۀ[K -Ń07HoVo!ahQ_*SDwޙT2NqLS$ʩXJKOE7nZ_q,@?5DȪ?<y4*<[R-BG`~{Bi.-G*=I j)"㏗Rqam7Eт8yWzNQKU )I-O~$\}xR|)(-k&4.9‹Xϳ/XM_AҠSq^4ƿwyomT) x9"sq;~|2@0d!ԥJm?Soj+~蠒(~& ͅfޖywads@r}8^_^L-V+֥U(4 zܾ>HELRIE "$+x!iU#Pnl:E4E` Jx# cT-`,,A :f }rǜu_ k!=e1HQ3hpkP>@*8o[on9ZkO<0Q"LHwDլ =ߏ8|E" !:\%ǫC('5ZC(jUJ/=}M>l[}eeR{OO.]!jrc U OWI:&Q4j4eZ5[U?=]{[rC$YŠ$,6~?-_dyTt֦]|onsո*ũ-=]wAc h =o7\Y,x$C@>i.@zɛYYzW' &yRGں pƦX9Ii5|=+1PPntbH ok6(IHVnO_bn=8;r2K6Zse?_1JFb&twDt)0:,,y$~=j)t pĪ'.EŏE4KiGJJ,[\~n?ֿ'3#%mMq`@T7|m*X|J nT+ʛ$"*h?H#{&uɶkI>}52ՏI|6]>E>I6cǴN$T][IjT?Mn1u5$}x²=G8P>gSaMc1^ ',{`9Cˬ -5{> d "c}6/1$OV?ޭoϷ?jZ߀ب _1P?֤>ʺ_Г;YKr.arn~{ҖK'[{MxoIν~{߽u~׽vm9%,ArMٛ3Q1&b;u"`RJzJJgvpx[vQJY'mh _to9&T`}Hp_6$Wi:~,5,?#}#p]=V~әz؂ I, ɵjHҬHg6G'g٘WQ>x=W^U 4jͨgakV\- zP'ץQ; xtu05HvH k\?Vm#/i !ݖy,9czuY$H sСC(m?RnprxL\XX}VztS#5=)`G6"'?#2E} ( ΝDIg a|SOoC0dy"ߓԱ$7 ȿkӦy <傎 &Ʌ[WQ&DsVCU^4YTӦړFROЕC??od襷 9~o[aӷ Uaуlg 2{,Gדdzb茫wC4㎝=^~{߽u~׽ߺ^?R߻.YGϫ/Ŀo^fPyѩ7[K O9?zNZ`&Oy> K:>g{}{6urE}lãX@U/r[rE?Ӂl(,@A{(>Tn򷜀.uoU'Kh6(X9}I/#?WR]SԀdnI YK״JFrh*5*x K5}ٴ(hՂ ڀ??:U?҆ޙx+ZYPĬFH+1Pڊo}dyA7PY@ԭƅ?P@~)+QZtM#e~ܴ <3F1FPnQ#-㖞v@ sUX X?{[Ҽ~DǢ6SBzsj~4hp?yUdIA$*M lQ(k Di~@jHYAlǩmȆE`4ulŚxS`޽޸/ݮA{rQf -өE{MZd<V Cr0yFՃ:3{YnilR1YK`FK[ZMUM?^mGc}!9t!ts*<\2x܆ի]O,O#PAm$#@lH$&Y+ƸӦoTqq6 .#ˀEhZg@ri] v`HԼ}8ؒUqOAj@8D\6HChM!m),/7ciW}-ISIY|tZ u ?RУJ%W*mAgy=@ 7CcjIBzeiç*Ycb ŝr%GGҎ?$ɸ<,4t6@J.*SQ{u VD[E?_A.4^Vk;t"RZC%E@9~_إC9J@O ga}h$AH?oe:pxNtyIh$ˀ '7Gz:O['M#_#LSK5TJ& سON0',r,?biF)_zt#1޽QLӟ;5"I`cD%oTQ1h ) H4d:@T2h^D9MtKL/L)r%@!`fe{xW2$6B AqrM_kLGK֟ꯧ}S5NΓƺP<5 xы1{D<9VaǹF"P]u}lUJNkqW:,\KD ?qU vy5;!onQ\-^ %CW[05eh9>(vSekEm%SF#f JՕ"iX;R=T *M<\"3hЪJMzl2!8 <4ܹU,mP/hb즚~ߗtGhVo}u>8z)R URR;)%4؀ځ_z|c[k!1Dț PpJ ڇݱXInkTzsΛء@m.GV^.RJ8RQIVcva{MjROU3FpYTD(X~~V#@>i:O'3zZ/OVu)^)MJ ßM?{ǫ~v4F@-S.sUg^j~(e w c$1Ȃ(O#LfX(r6}mqG4A|-cVUj*ˮq^=덼k @(<{ ={ɭDvJC(ti>.mJLh-peem6sؤr2 >\xsRtc+>cUV)^5Fm"hqϲ/4SlU(fi#[W m|8~0]G㦆z4dy.$xgNý6/lI[OkU>% N2g>t5$fJExHdBZr2s-[Ԋ|LG۟ˤr;kVtR8cofkR \uuӳC;+HDatuDn?; ~~_S70kx톆ic{Kʎ›kTT (TJEFLb08#~Q?vEGwjv"\UlWy u8%OyIl[mŷA(VWQ~ޔm{#cJQZ|_Gvq:)/E zvsW6Hi*h(c1,zd`! D*@k=TM*c?6u|nV9LQ&EAg)N{˲>RWL cZp~v- pwk}\;OnK$C UEP ){>o~ny -B^M4ΟoHw}mi-Zq-@JrB`ӢCwQhtVWk+A.mj(# k@ >ld97m--GqTDoB&M7b-~ ǾUKͻ_]ېV:҅+f]mXfzPԽ-3N5&7?So홛 @#|[1FU7^Lhad(Xih]<_.ZiI(RulJoՋ{41sfvڪcIU2kWJ")PH@Ǯf] ^4{UM(Um)Թ|{oimag U.B0R(iA=p 2i;1rrƲd3c5Im:$6î nmʝYj䚪4!X*]ZaG;<6^NJ-RRŖ%dEuI䥨yQXm]f?4nʹmbziZꂣP"G[&_{~e{th9 H9IHډUZ5L w%o[6".grf'>ۛxepSrm ;r#l;Ԍ2vY?):nm<| C!ACzZʱ$uYYtrF2Qsaj7 1ˑZE,x[}nQ.i̩5#0s>F_7>s~mmU>ide)+EM ]W_ظO,1TNbJıib4UN7?\LMФբ|#T%TPM/,?tBQins{N.= A˝k+Uk܂@ U$V ?|hlOv.lO/yfQGUY[KRba۷֡\OZR(AGW#n麝 8IrL+c+c)&~5c#T`0{+kn导1$E !MMO=~ɴUb]vpQ,v$7& Kilˊf|σp]ŊO]ifۂ~kyfhhiք4 \ Dauf 8,^ͧf+rvVJ**&bs I$]yM˜>֩yHhV@ %UCh 'ܫ̖W JPM>T:Ovz8'{//y-̸A[;{l6J?%4!w@.t/"t\/W ŊlRBE/ӭhyd%mVa+h7˨oH"`T%'8'Jv]А]s-KpFw,$y(=i|۾zWdJs []I@ƪARLG2[=pĔ^g|lZHej$U`4/mvۤW4cZBzh8P(](zMlg 䦒ҧRˁU :tfYM" ɭ]?{2AI1CbZQK_Eu|e|}fK%OOQbgTQ G 4ʤףD+#0(2/ҚIS$Ҹzova"b퍡Q]zne`Tcj4LHPX7ciVr]]m'9ys45;ekWu2GzF|ѲrZ}Gvܘ%ժHUGhmh(G~F&uܬyvH#f R*_d$15l9MwvߙޓJmӸ dsoah !eKo_uylݹt)GԐiZ R:a ìwe2X)y{ci@#BŠO9o1ouuvf~ެFcn7E/bu&#iHcr1 :񼼹*uY:ZjTeT43LAOOPVS-DsRbJ0*X { r{YCga}$"J$.%ĊM6>F={xPT@Z0dEJEAZ=6=$ei۔ǒsH|^B!> -1r_Y2XJ<"XLU0$S4lxn]p0-Iq"45UJ5Z}=c0nWWɹ[ʓ]ҁDOe hnz.Z;[ vn%³agwj %ڕC>%6 >k>O="8E%;4)Y f㨅ܬ ,$KDYMn+dDuW$bʣ :uk{o8 :egxQh.h:;{bfϬLdu\4Tô+wt7%@A)Fg)0{Mqi`M49if4SʑHM }Hl<3PiӡKP@ ?΀:4kK YD 6C Oֆ I#y@]gs|=-Q+Kpnj*M_3mnTBhXbLc_^+!z{QK+<+feviM]$A:62˿oUkOA!F8ڻ]0zr/1mu6&t\XFjHsOBT)z6/呸Y7w}Kac跖ol~ %-etdž66YhA,lG`jKx ,j}_4 W3>"yFom uEQB|@xq&7-ɔٹ*8Lo+qޖgUw\Y0ZVe)^s4;nQ+Ba5#}]<7JX]+Et#]C[HV=7\7T]8 2WՊ#_5?=nMnzS2*6$=ج*7mEl T7;i`KM[pSm*92<&1WKVqeC N䛍\ߏrE4f5 nҁhڔ9mOG{}H1:h*xd QMnܹꚞ͞gmոhcq8 4JQ\Xs8!HhB/޸FyE@G5j+kߏvg,pF\ͯCB©j٪f`k;n4֕8ME*[?P z+ v;I{\uf?))O8:O)2VfPC &{VN<"! NJCq'H-eDrJP&ޟ|qm"a LN̽NBG7 b4 Z( +ZN[$.m;No&Ԩ˹p/1I~S5dB*\qX >̿XmV?}>,8# [N)1NLjuf{Syɺ_[H#Dˉ4"XَS t;ۭmw+nh*h{SK :h(osة;2n+!GQœzcprM$.'uĦqOcgefY 8a"~py>ODp.ST2Bx&P{8qLlVЬ;HG iMrTh[' .xڌ3 'ȴuII.*e2$f'.V~{@W,#4rHZHY!$tek4rr5?I|jִ دw)Y6b=|n%uRY#2$(+Dy$uX$ry];k&mBhiN2:*-6zr\U-WF^dpJ:O>ſFѥLi>Gփu[G{vɣ%\8}6ltb鿅KȬhTs?xd7 D!xKy$ @G>vV0@<)Oy!͘Įx{ xmqd_yo mrY钾:raT,bqvRE# vINRVDl)i$+d 0rA6Cqem#K"5Kdip>]R%QTѺꎻ tnݷ4W/b$fnE͖Y*k\$mB?qn /Vl*a&s36N4ƓRMpIgX[j J_o?O=6r4jyO;`OS=x0ư콙kjc^;1h`Wd5T{]mwmwNa>$I R-HRllXQ4[x+{ iy; U7Q_a'Hӹ6o(PFi+tKߑ&#"QQTCNC[Jp+@6uy#5ʧ^AZ|);KS[f[:.6جeuetEu"#} 'CQi5|]dy8m1RY4~^z"=L2iۻ#PVoԟӖ«$M%A+§PyޕŽq8Y8(I-/P$gpB_{)Kj<(%1*syt}պ)W;4LEFiUzzw_*!eV^"NkUO"轣kY@fprJm,x#>~Oj6WӤ7*UQCKU'{SWUNnWU=;׶hezZ8TUU3؄2./or'+r0t:H?exs/1$9G.ӣz2sdrK0 hg3bK2ce'e_Pe9f8 kHXrvc7M)noP2{;(aXjkRO"7cS ަW8. ,I N?ގIy?>\P]AqєV*}H"סX2MWF$Wkbֽ_/}-# \}U$wZZt Piq~hG:=[}` G>[KV6X;8:@垖1c X8]6C7*=&̣e[N5<ޒlA mh\w_0jaࡍ$hqY?OʕԼ>}K1OJp?{cO1+BOkK)UH4YHm< OIn ŬN1yb:(>H`+oHrpny~r%*ը?s'Gz}+!Ucb4ƊԀJ X:;>+5ESI:3}k`lK2 +`<>l{mRC&ָo*!zb&J)5֑n JT+XwXѠB)tưY$"]AWpYKo'/{ O$F(2<OQt}F OnS)í"~Tu]F팆>+SSN*dddC X HzL5I«-f,YYp?6뤼V4>y|gJvؚ| 0Bq>~`I&"Ӭ#[ AT'z-?@trih]^I T$e*@Y56Co&b&nDC r7 K*Z.8cjzjM幣daH4pT-[Z&Fo7- O$vk[2HkĿCAJѽ) o,b<=hֽT&BɖV&mc^[?}h"<]lA { ʲƅf&Zǝ+'&=r6|B~9ΚSf#J{6@>ӚT,wtIr [?q8Xُ֣SoEтjRTԈ5C9nuX KsI6uI 검4p>=Zs؈c#?1ѣY_YAp3plOOeFS*A&CShIC IISԖw0˨ᮤ_#ir [Ib<q=pݭ_Hbpj ~Wo:Mջ'TF3 DMyQ>W!"ZTRĥr#+Ҽ([#9svYl _HO.,`cBIzTVҹ2$ ad ]pOɺ}[&⮦B/vDG Tfa[r5ܗgҸ8tOnIMLA8@g;zԊ:S]HY Q<'No{GS(k'吩 #uyrD6+de dI#dz[*Wҫo *GQ`IGV^MGfvg[pAŹmo %PHkӞGuM+e5bۅ%ƫ?̼x _\?yKIƬtJt݇A䴠Ei$ø貜zͿeARIyJz~}d O?^G>Lm}<&5x` Xˋ[nm7om<W6}-ꆭTiTj;P~?W_:X)FryLG[{EI{^{{ׁ>׺d+I_k+܋ ,/϶,GBV[sCWWuw"xaP[a~9#gFFgYz)2s_HƃjI}Oⴅ jְKy)~^}v{*V.%.?}L^m^U6$"{^}E$=JߩSHHUG?[ ^?zX9PEK#^UgNiVg]_K~}]FX_H j cu>W!ACWGm+$Zd%}$}/7 Z9qEI\H*~fYM8tvWÎ|- έ-*W5 F25@U$QRԁ>hGN`TtbNX O[Ai?MB{\\g6|S?ˠ~ AcA~{߽u~׽ߺ^ص"}H u~4 Dy{sV1@sywj'? ?I}¨ ~?(Zj }Z+\/tE$Yxtt^="'$cm% ѿP{*E gZUX.|.؀%a?Q!Zׁa"U!F9$T|>2E)P./s??8mUY}E7pW}8X%hYNHertZ]N2 $rI7W6Z+"^A+,X#o6.O]i0t'SuU{UAY`MlUQ*G{0}n*wk!>+ma$oKiRE3ѕbU¾c_gD)L38W}U#IfDu1",mfk}Mǰ[ ;S4#  H>gkDᑀGߏե>P>y䤚QQ7UGtGI$ViUC J/#_]Xߞ=E^^58>ݷy LW>G]4#1,,E؞\e" 7=}},fX'hjAY\H2Gg1DE36xFsE~WM_*ܓLgHke=0 Ec[ֿۖ棎)uitʣMΣc_=駊_ $ ]pU]E )bKcJBA NGa :T11:Ct~Ӄg9`xtO=J s+j8Pi3_Kj f o2>J*`}LzO&uK7!B@?g~:#t(Xt)tUGzN&r=EѮޒnI䐌yrt;:LfS"xWǶr+#5^?̳QrTkHJ1v6?}Zڦ+cFM&Զk >ɷxKw]i5|ktܕQ"KyU*VF rĩuW/2K"{kT.lkq-=<0:bj*B.355Q dVh,Y4ܩp=@^Of+Vbh%KvKKATjSAVV?os_[_\F@r?g|\YR#$52M]cG)bPdi&bj~K#P*y>6ҫB,e7,H9?DdCS-eDQU ;Xս'L.y>+r +LVi$EֲYp9421b|]-Ml )y!"}!P mV"?"QŬE-"Y$=תHM5dy2)$ Oiƀ4 .TzJj i=B鶥0,u,K7GI8gX nTvYY+us/;vqƼ3$Jƿ:ZMYPSxk9iHCB<=~KQ+k?e p 'ImD>嬃}%>gX}'*dF*9&&HyY_qnSP.ח 6IGI<F#%oȰ+cG[ԴȬ}YΌmsMW cSN`ZxAQS;Hd%R4]A`iѻ~HDHu&XD d'\ix\aO_Ϭ1Xa_ŽwžYY0B'56ƅYXӆ>;C%Ŭo۬i=}x\5(]U8.htQD]+S&II*{ϼDI%}ΖGe$4jz,#6䭣ƴA;f7(_Ge%:L[ѾF|geI5)ƋN1xhD%YbӣMw?BOeC0]鄊@I^>y^_ۭ`xRCKɗ4럜ɻcuzӹJxӨoѝ&l3cOAifYi b|ؘkv"hA) ;k Dj_Iew3sػ]垝5ȱÏ?ҮN]}n\O Hv1Js (e52$D4t\u^z}V%TX S{{_2rRMl~ xqti;"ǗGWt/,䎕)I&5 ]4(phwݮteVU )Dye`]+jM)7ʼ:.w! +l$1STYaNV S~7;_yόLm4rJNL1O9Gy%ell}I[Exj1G"7 qu=En W[Q˥w`.O&V:׮jhqKUUE.T>PH|O~dz$)'L*%},T(kyO nۅ]RKue_˨m6]ӗvB?xΤ )g:'badѬ"|)QJUeYWGaWAԛxY#VŊ̎"74Ҽdxc۽ɷXS_TCS,}wr\SZ59$8SE7oͣ]OvE&o}㇩i!|eE:jU+$eMR,qϨi򺋬}<u0" bN%(muEs<IuAUO]F,u0m$A3*  1N<duQ>޸5{\Iio zՙʬHA?adendyf1;Xԏ zbxܻ|Ku|?hb~ط%W n -ۃ=]Q% tX࣊ $`#M1+iEgvidgSȪ *V9QT_*żl=X5}o5ۋHA\s]r>ukOCY 3~:9%VMzNn{$ ڷ*L go 8,bl6>dOk߽nX"F,Uj{X[3x pQԓ/TT8 סIGAKdA[q{v׽[>cNjf$SB+y%s;*G,wL$g17ksGj7}vGrd@PhՊsa3zG8NĨy Vj(i▚#+vKݸY>:yU%T)FUR#Wg Jyce|;? nk ѲC\~gҚA-JƵ ZGJTE{+%+r9-uYziC"NG>wi 1ȱRVrx.=G-bcB Ԋzq3)Ww6)=F twCE* [˛Mm1cnRw&MJMn LQwr%,LAJhAXM{PV0qィ(!ݛrՕ5-8̔rbck: ,Mݸ SI>@DoL1h;'~C0݌ɼչg˯۬uCFI1{G!{smοB U4J̽Fi)hR~ w*xk{?Zb{0z{R} }ܭwM+yi kr҈ uկ盁aa?{لQa롼Y(֊oVGK4RPVK\r/aBX5cf:,Mm W3qJI_>|2]BWMhڼ:|C#Y_Fy },y/..Sv4phkx#1$]k#Y[`dЏjRGF , 4m5YS$5U%M+)WNnl pE c[vybaFOGF6[juϙh&"oqL| "} 41qQF!8X@?}/gk(Qb׋5zLRjpK":4彾a4Ώ CfEM{Gn{^sp@at )iQiX/?FτL\ok/+xGh!1x'<5T/(xʉf?i>ٰƵjGMS+M=Tgb)w~4GܛC?(p,bxuCT 'Tv%Rh9J斆2%=M%%,CfKkbs>!}۷qm{;[#B)P*(:pm}hܜ$,TFL4`UH4Ƞᓁ?O𝍴wLςJ\dICB>#p3͟kb(3)bp$$1TOnG@ԣ0<4jC Z\`*jEj ;:6\4rCS%fVoc$t+?mډi;2wkܨaV.SW5&j̼{8 \<.­ը OQ/v>Tw݇w i%pLk wsCޕF: 㶖x<)c PZ@S<4Ђ:~*UhuS96/wT/ۛc|!`0B$!ӛK|~O!֔۟mՔMOGV,5I#IDpʑ1nq̞oy#5גC2Vj[5ɔ5j*2w]֑}:ݑXQ\j4ZRn)C|jS3S6I߹ykjvJM585s$$ͬ>.u'jGCcq ].Z/ Msniط)m]1z@IPgX&Ǥ[!i$Kjf MH *u H_3cYMϸo%95e*bWIW I1ֵJڔOĬQQE41*4%iGWf\}GsVWw[XngOWJa $^f~LqXm@K1+N X(nڷ@<['ۛ#o}瞊}չIC q4 cV^"xn߷ii1U9)aһ4J* eB|fq Y^ee\䶭MSrҥ H$;o=8x1eNiYۘ~'pXRyZU-fBS5w?Gi;Ɵ,i+aj\&*c:*#}Cɫc%gV1\N;IP[,(Rju:JHWj6XC#7VW[t-| E+beƢAK Ĩ!? WץۻsoSC+4V,eacHhP1pAQK?$hoٝj-7[]*1չ 1y W˵㯪%UH.¬JXx~z˓kYe CF^J7_hu@렟tvyNܹ7~Vt7YX*Κ4$jR>7 ֔8~띑ظ|&v),CM_W4;v掶 5tcji5 SQCS_ >?XrL"UQ-Qfx%׵>{g-;P2kHV} OD|k=o;hګJ#JDt#UXT+:o:|$yvLNj5kq2ɑy:w * FpK'*MJjUPUH?<^FؖoKeǎ&5"Z6荌It#s,Mܕ{0)qs~OD[TOA>z~zrZ v &<}J(a(灡m?ܱfMhy,&ÍZUag e97uokѨ_c9-tŸދB%,f Ug_g w^l%V2Q}Lj豳7Dn8Z{VN!WJ Qf ?=- j,KsԇKVG[Cd=x牦A6<IG Lx<~99SpR![+i)(6%4Ӭ?$- ~drkKp<@.~,;osTŊdfg G!lAQC!ݹ54)cLJ]5ܝAN)6dy[3OZ7%0\}C&{bqPgBJfPtea#[TO-vfb:fTJii(Xkat~I2!—u.,f nx׋{+tE3k\*34%?X1ٞD}LC-Ac(u!(̋k 7?f{*N6"yDzi"EEQTXAdzoDw 8M}RJy~t=nϷW=~m@^ej{h0WwC\pQ].9Aj`BSRYMse._ZİOb#8G__[I= [_h*+yt gTJI?C#d_aEU5Yp6akXٹ]@|p3'Y!r=}|d!-,乩S>O`dEj8' SX t?Ǜ{ZMDYioO e+rI3IiXT ˫Z),H@,M}3Ԩ!kJl8:P[횦WӬPI$لQ[RZ>]*sr(_/eAAN5xKD,٪߫]?wQ5Ҽ:DJ,DJl^7(/pZqeoR/{5UF ]_WKHeO܍WV}fS$ߟ's_ߙ@ʌJCLZ!PaopT)(-Y>*f[[prG?=iZ7K-]17 .UjT C3>{I?ߎr1/#!`;zQ#bJr P+/eIKSD-p궫0qͭ=Y 淑iQ+< W?zd)r8US7C6=w`2xjt'$L 6`?u) xν2J yTn:xk3߷&fnu?~>iumjKLiM6T +#H!f {9W$aORnңR?<;\P-O"RlND#OۚP NR5EDST*T{I’ r@ )U j7SA)Z3AjDGԣ}A _X)f,4Q?_C!Q@:U@$!T3$I6b\cӨ]#C#Ir0.ڭX 7&ի#R#MXBAtlɩRF Ѓ_.=;UYFP <:uI$5]uvBXVaSRDdiVtͪSs?o p+%#C?48ytNRY6XFv1<<`κo@JßpjO)FDRM{H])&Pg?Q+9[ik9nH FEGEkGJ*^*#QW0Gt9>ed_#`?U;(.ԥnV Oi&$iR#-F kC {+Z#CRX,I|Z=%%\2 fx,pOR/f3"_dɸW n/m\:GO>u8U3ώ{Ͳ)4^3Wȯi~ά[{6)WJ2J'KW@' ϐ^* (_:cGM[,QTH tDz},@+vYlji ҫ4m"?ڷmYunor' ޵WGWdUSJLTSJ9_I_)Wc{ڣvA䔀I6ܳn5L)]s|-9c3RF٠,*DG I}lm A ]Ϥ-m%3EcgڦX*ZWY:.X{GpG[U]  N Ƿ܍AGFrTf*ߌ Ҡ~VְM% )O}u)3dW"en܏JtKJj u[؀o`E8?TSAҜ]Hb9{9TTP:rJq҂1 T5abZIʂ@$jTޛ~- c.rk՞9 09UbM$07m?ąHnXTX3uI—,}_As؁cm hR.5-s-{e Ъ=^O[WOUS=7no `G@Q6{ѹ4nQ˩#*MyÒIC#bXHͮOhRh#GbI$?ړ#7Ђ>괏mWMm_>{<5e$]J7ͽ@rwter'u uǴ4ه Zx{^{^ï{v.[hE 6&¬{"݆WC.Zǹ[M^>4e<8fG9 m)PFzb V6^[TfR MŇq q&hI7*..AY!)k*?M2~ōA!cyb8 /81}>a}Vt`FFCK7mz,AS 0jбrM׷4oA[{%Kf3kUz=bVj 8́sq ? Yo7_"UziwjYhX'Ez vquOq#-EK ^k[ hRC-8~p}RVjҤtW`JesOxوCL77^= 24=H SU? D`T-4[Nl~AZGi˷Hk6 >s7OyZ`ZF_J-$LȞadiiԟ96=¢Y B2XT< X$^% k^RU@?}u9U$7U=H)[xC.>TVYVGSo΀^{{u׺==lq{݉_N2(˨m.,5jB@ ~H覟zNE`ܹjn¨yf!},Os ZAGCT!_VUA?_<Xi bAzW5P}GFAyJK>ٵ c@q~} QӲ( "O<MDX2@nIC?d tf`xM X54={ W=^6xb?J-n*7NI2JjP5W,3{0DUW:u)#;XB #^|<n2J##ּwM;$ j1[FJIξ(mk*G>9IHyA !9{spaIiI6T{.YbT 5"h Z gX*4}_9658 sa/~~]&I137AoY n.k/@n,A X/Ƕ'^FPyΫ@S]8+ZF^Ai"Oc@龥e.̊Y]P ۏ5=Hfҡ }`\+k7_ae2xS@9?gЏofZy'Ӡ-jKHdACX)~j|:GKPV|.dAE٤}=z?NdLxj6 RGKU`JG)wUbOϰzp8"2ԅB:=AI)zJlu-%wf1Hb >joiDt(ƣH#ƺV*w}n,y]Mu>hD[܂1u}=9,/\b4Ia#I$ ?^\hi(\8[,v:Žjөl>nASǧOcpĂ)_uf@۳$4d7Sc b ?- #[ >?:S[ HEE4,1:\!p4d E`A6_es>,8?i~lCD\n.'7!ů{X_I7:5Îf<4H*$vϳ7PF4Qс8ņ.E}@)Lt;b  3JjUI)>ЉŘ$U܋6%KI {,U-=, P7s"jm++h@#C"H!V#K++_LT*2(S^cnG'´-:1UainʼnN9qe.}WHoMk(siKė*%Sżj4'DqZ6`A  o"p_t#˯t$l]ZJU$MLJo_5BVbNNBK9]H}ց("?ο9M&k~Ʃ2|SJ@)mB5$Z4`$q5-,OϰPi_/~r^u^wPV: F4!yP/פpX 7}n=/6ׇB\f{FhNY+O=j>BÈ3#?W]K1Bk#$Uhı4G{#}ٚ2LODEL7I$W2 EkmxV?5//e&݄B21yqd|-zc.MGEQ|cXIc1Izmm'ި6^!]h}q5sF#X%9blO߻~o8(KZ}XgqcCi6ю64~l>:VZHg4V=ߗх}V&۞LXUcc3K,x:mq|H(OC{Y|<ԙf JqV"oU+gfg; F#,%-ZPQE2H\P#y KR[-P%LOKi<X8=WV<}yGv[}滖V3BO ~ka E;\.~ߗV㷰knpH~S" aREKYC2?vF*:\Ve mO8chAM"%EQ{Qu HMVtV3y^Yzn'hH>gtV? PrTIqdg!Qhi*!yc!pmn׏boF]au*~ iXP$ ߴt]J=M\R9o0&[!e־ܖܩO=-US{H[D Lep99o lB{u-O~Ymz!? ԥzv?"fG}.^ߏj;gllunM˃R)KaYxdH#XOٶ=o Џ Ep km'IYr綉Wqv`f*Zm'pb楯j3}ۏvϷTMWk*2 "ժAĚ<4k}5{ɱ љB$eytj&Boq Kh͝oY|mD'|GGJSUr֚No1CLzK44ֱ5u[xhTR$i NxO]nv^uD?\dqSNRlTejI.CF|Sevuhe3KhFOaԿy\-a1@@ϙ$Q\ xt(궽 =+>V|6 &x6BC橃HyeKʪ*4َMٵ7.#ɝU>Yړ*Ԧzjjb`zKi p=4bh{s96jn\ZfK>u{q_NlMY=15جOP zz-[ aUVXqL}.leeI-t1@4oMU(4ӷ;gmx:ڛymZY2ibhX#RQB7&:}k$>Eq/۶Bzx⩯H8p46)m{)˩v#:2-+ g)sP9G8>2r8'xOCl/ >䎻 CWwU56M4Uu4"$TWJoObŭݸZٝ`ɅI'$%"@y?Z;M Ǹ \vWWF妍4aޥ@i]=Sa0$~r8$qcDh_%RV͇_zwJye3;j~'QQ!ApBe- oWr+.]KԮ$}#VqoV`{塼r5P04PÀ8.TTsix4Ԕx.Bha0i9#goAK-U)0Yb]Q@Ml,f:E=SUE icUO 9Cy;f׸`#Ď |TA{.͸76pJȍarK@ 9(u:۵~nm>NoNץN6Ƨ+Ucjmژ!cN`t 7'fuSlcmD*Տ'#~u0 ,c}NT `vܒIEP]Ju6 4nynTmyvfyj/5SáGg-"6 'rWP.Cˊ-S[-EM XZ!IyH:CHd{OVb0vu9 s;䄂P]Y wI{\HhQ#hF(]iQ-}4"{=̻5xI D9ARjIZsp_Mgv93{;E[8;%NG;]WG**Id +9swnNᣬjl}T&4IG[G[NҬnIT fڷaUjjq".+yϨ9Ù7M$a:I tWHSYu. EEvkwVb:ocvg;#2dvFe`S h.;A=mE?<}[Rw.}u.7⪬gs 㢬3'R7I3kA/IqjԱҝFN41p7._ۮ]5|IQEY4(| aWO|^=[|b jd`+2]ymܔŹtfP Q9.i혳r>4dUvjsy䊞3Y_@ң5`FU_K8W IƻW8'im[4T.VjV!FC>.u scm3\[*:8r~b TuZTސw_ll7#{KVUx**x'soT UHxwM-F&R5ic$yOevii/8`V@yrJG@Auԝnwm{&m :u*ƨJ*§JnR V Fޟm~o |=& +*()6&ݴxO*dI rsmE.Fe ˶˷-75OZ< "3^%\6;tw OԅPUcz`qλEG D .#w('p[gMT ꭗrir@յmW3M&Z`H)xTLꓜI=OUgv1Pd6Äx2qJcJCO!V&Vt:`vczȵ>M(xʕPd[+B''")Tm3mUhvvRアRya8gWF SZie빲U8 6Kdh1RI%M<5ll杂]m]%[ͦ9T*miZIf[0$' {N0)E~W:ڻlm}Mcl3oo N(/Ƥu0y*pLntޛf1ލ]tjӬ;SS,mE[S"ŬR}Λ=ai|TɩV4ĵnhV;E"#MbN+M5/e~5}nԃjev>u~˜eJ=H0E z8?H {ڟz'w R5&ٻ͵[>|4@:*$ӊ*"Ze & c$Py nƛkڻרq=wGg׍+bpC;*dUd#+k{܏c/Y&]C[$ &3)`H#K=5DM$U+#,fPd:JX,}ߓa/A8 _SyqSwO#JpgˊӪ6Je*i6G}l¸uE~b*vLu,t]M4<؟k2H(>2&cZ!{AŽTq+gKԒYv#4 juJAt=d#^<_XJ"E1fQUuSXxЁvWA|"]Y=6D =8~(W6 pVoVñNY@#\S5MifQS_7 %߶cx.x xH/QF"=vsyk X-k+|2j@Hf>%j*T&_z}mn}5]M^ܩVqoJ1Zx*34jx.F* NOIլ& ) FO%#ltp1#?G_n7YxesPN@𧓻פWNVo ҝ}Y)8U6Dt4pd(!GCCyRJYgsv/iej'=J5EM|\IT >>WaMlywrdgU#ux<Jveg ϥYi|8ST碭W~Nc齿}: $Ʌ7UVgUs9њC%MD"đ7e)GuUȌ潔^NoǑH5(Jquʗv0Ž\̻\ (*)'#'{ah!{QAJKQ=lI B _w!jpUeZJlVEa;Ѳ8r)+Xw ȢYGcv uC%lec)dGȈcB_nQw+zvKidF t78Nwx?:vE1˧Kw=X]ǚźꥇMSG|EJeZ$?ZTٚ&B] ׉!!.ro/_K"0] _930QۘFRoi2X,Ko { 4yB2*𿳽]ԪA9Z}>cA u]\"oھ<+pekˤXrB$VXڢIz[*jR)ᦦ)e ᴢԆ ?K(\Z_9{y"aO]$?i癬fG\$O]-vO%<@P+*nW}ݝH˞. f:GSB&]>q)_Ledy}NT}%2<@)LE-Ua{4buyůBE{=DɃç?wmɓB-?~nȬ'%Gڕ8W'i Iwo>ªUV^Y*F7'[Q$ cmYXA _Pz|]V~΍Vq(%kKT:.nO6q_ayD]AdZPK+SצْKo^EBXқ> D?_ֹ{}),ck\\`>}Yj|](3KR' D\@,'NS5{כ{5:1Їڔ jO*U"ޑ}FVԥl'ytڴQHFC4T%`>EEC_?nF~Y&sBNEV:=?GG/k͍?zV#I<$yP˨6M-0?Csk^rŪuq:+4>U:4QX ab~V2k.>mǤ;QdF t 2j-oV tgo:x8[/W˫+'C ^{+oU^AQflE= Й*<קFv4,_R$,M:`In@[[/ xEhڬ]KӄЦ@]VC*{,6@UG4t췎y<Шo`>M͛ X&9h#鈡~} y[o)o%P( =k%6϶%"&IuIFY(Y$Ha,yQ,Ha,\ËrZ_/-}:"6\]R@qTyyoZRPfàF$lSZV9YadHcyzFÄP+QAϧi{oW;%>iuj WmYGSEtư ViSx\:\=e6BF맨BFM%6 }6ݤ6wsnr5nq t$6VhX*RCic{?*ꧧVoGoME嫤kҖ' C3DVIB<>l *])he~ԙ5 B` / [ȣ5* 1^-7oLwۙtAX!޿WFgen*i&# sQԺ$Li#I`A{{˻c2򧐡 us`I4KXҏ w9~d 8 Ӣi8gɦ;ٚO,Zu N͐i.]CiRQ1Eu,Cjf2LEᏝNqP@TleYxx+ADž#ONc2*LHf@^xYT4t: _W \AR`I }*~GƄIU8X?O?|Oip&+$jA$y5̟Reg0ٵ9:E) }}lOH#<֔߹slCǸWg%5D<q{@$('Uxm9:CulprMRc88WemNT/sGc~EɌe2?"c> engſ~SCzi)@]-c`ǐUcpAOysFRYu:hG 8Q כM߈T1pߺ{*Sa2@M!yK+GH/A nޠOEz0ޖEOGMF+vpU?|AܬvkOJ0>,/{Kl)QXE%|'^>jHr]})` 1*},5Ɩ"_I}M@6 R XݩJ,J Nk%@OnM?Z슡@&}>k*tެ|+JurTi!T^~OxB [oca͢y]Ќ2ܻÛh-?-k[U?O}G<_EW-|J_%w}u[NϿ;:@X1H{q3ѕy~޷ԨiB؎IWRIϗH\:}{߽uy"ȶ?OqlqZ(]&q"/~5 +~]R[b{t{ݙt>@ cv݋j}gcu6M$F/_#wMsr}ZB)tS}-2pPz!jOsO5Jjs,EZT{mfꌷڱVD7*"XODzy~5 z%YG$gE#FQTb6[o2@ߑakyݭTZ&=WԤ٠k<@)?R{n, &Cj|=$1u-*Akrֿoa^]/ᅾ [jHd}ewjnM6<{D <Ԭm"t!8 @$~y,E sگj5%E@?2ԎG$!>k{Fήďf_?Cqn>S GPa?yܺh$r؀>7OmGy"jN?q f\rP*R[ a읍db> gvӎE!MhQX4}BpIS-nyޝ_-RLtAzHHRu Y6aU9SWK]7׽ߺ^~{߽u~׽@#eRnֺHJ vNGY//g :'o#݁b_-{k^Jau?[-}R?Px{Ԃd +G}|~٠5{ὥ@Xˮ2 cr=>@I1P ʎ[ roHy@jOE$\2!lIvC5M'H>l4坽%y?n4: vN<%b` Y^ǒ9>g$Դ \DH ,U:63uiĮ:G6N̵2<ͧZ 8<}7KP[JjNl4XN?0l/q?oقWN7I-"TUV%FErèmWm?a6udW=C[żdf'=7,nz LYpBM 33,jRčA#{aqjk~x#m%pN5%&8(7%c2+~=WY6 IP @y_Ċ2ڝQͯhяb}lWW_B|1#cӤֲ:*iנq̗zX*,#fIO?GSԭ9[g~uM?,UII}k_\]DuRDKktH}?K]Oړ6JF1L i"f`Ie]WV6Sn}ZpED^0gU:BzjfzZi :!h!݈G기{gy QB\im'Px?T ѪO_Dm|p)fWV6*/{fȵ$@ l6kEV:qV}K~$I+io]5{rX(17<>*N>WM*FeС^)5?&#6-#ٗ[:zZŔP77#QAbxGV͖KoMlG_in/Tw)׳q/׏@.Vea-pOح.ge61୎}7O[߆!j3yW|h:qPЉ^W]3W@ڬoʆZzi9"WfRMΡ?Ԫ5[oO zIm%^ o[۩gi >%H+VIYDX8Y7+[O%O6f3MYqeS,*GW\хg_#tj̋uDQ:,?P/x*OT/c6RBEzJ˧}$`ΑgR챂V!bx6S bmb9"݌rx~-+u_ϯOVšVRuoǼJ% EPSз`駖7ܰjԟ3T;Ⱦ2Ky^Hc$E$h$pm⚙ts?A}WVfRlnS-)㏷ 7{IEK#OS(J0L],kFG`c5 '=˸:H9Ӌ}okn]` ]H8Ϡ1oz;K |<}?>OOxnmKSCY4@< eW| 1>놿gʆ x=[ppSiL~/sUѱS%]3һ7vshP4RY0PD%Uu-oX{ڛ\gF]] ucˮh{y&[(5Jpe\4UԾ {*Iٿ& O,ӛ&vK^Ǐc{4,Xh֌YS_vNzVVWxX)G<>NY;0mnpԱTi(}]xe9U>G=uh奧B1P ϶hmD^BѢCP R5Wy~!A@Vy Zh)ovnjMghJ*IH?,Od[z?LX5N*4|+N#XLa22IKk-s̋e֚=C~0waۥۡ;@Pw6[9OAL)T*ޙYu;$Zsa,K) +vo5/ײGT\;1u`Al'>>栦f]sʿrۧ1UW$ YЭJa,0rp|%)[2S7jx(!c-ElMТ%8C-G>{w/N[ۗm&k UX)$%Cc^]w`- P[yZ ?c0/mu t K< w%*U4+(M#+[kadӊTt.JJtj\uxKE,NK]wM o]]FI-L䮲9!WcGId\=\ haV!.uHREqo]Y+sJ\]䫡%3L2e-~>1KJ㇅So{oS-T^B,~B%i*R/5CBUVZzQUǓĀ.Cg|oM䳙* ]AZH@;>b[Zxa!#EX& O'khP=7T5U9iV4EJ~xj;x=[ew%jQgxaG%Zeގ*VeϢe_͚=nwMVEW盛P¦ JVZ56 y y^k8xzT vjz=@=À^R̺hI,k@~y#;'UvNЮLUE?ך&Y%]f%5$. }ӻUh1bIfȺ2;ǔjxf,K<\q\!M@JQJ@kK{v}xIE'Q{@h5N=%^ɶp)N٩ RTIQPʘ&⠫vi*2DH,1%}+s~opTGWJ7l}P2_k .qnnyo{365BÈ W (ƵB&zR{w.Ȫ$LPkRqhB=\.hU+Y^89ڞ`˭E}J۫om׹ iQgV_zBưLBF.govQ~ҟQ8-(+]^_}o6;3TCFF!SH PR| D `WS˙f6FLa544;mj,2&AW@*#zFFnUc58ٽ*MDh}:i3ukۖdeQ (W$֜tH\ Px"%`gAPcXE+-_%_K\VOݔ9U.쉳f~ X tk1io39)gR'%6 #$RȳNZ*rN!^D[[k*RH,TK+Pj[7nWgqw 2ekQ-`ώ۷ +v[Vu3kGWXǣc! GYACMOIԚe _7ovl3w5PEۤ5-T"񰹈fώ_yakȻ.ѴmUPtUFl\"[Y$F[yCjk SfjUA>}r(7a`tO fYDmQ$jVS(z~GlN IK*d閥Y(Uf)^[F+M-|B F$@.[Muy @YW aGc()ù!}˽vo/G4YLDIJV,QUl{Nv[{wQnnt|> dw欣OM5!t B4݉cbn[{.X>J!XUIaUcԡ$bjJPiy6= xW~ kCdqpX t1뽵caڻSS#AWT4M?SU1`}(+U/^h7[f3ԋ|[# v.Z>>ȞWw "<@XZU;o-[϶y:ڽ9FG)SI6_gVZ\ȣG NVJ[,e(hVq2WTrO\5} Lq W,*  0rEnsGTkStSPnS^46%ҒI$+EWU5Ht54`c|U'6VXLVq2ޞ:7دۭق5SHӭDm`]$̔0 K@Ŏ9sHQQqguwvN.ԋ&~Q$|OwaZwq#I@eZΦ}?'weFٛCmm*}uM-f;ʃ>scvm<dwثI 1Ì0ҕdjIM4Rj o&6]vvcE j |kr m`-6&AjWM0>\1s U߲;s`&ewf6;&zjdo TC:Ƃ*\>ڟ8p!Җ? 8Ec]7|gxC6.5mR.jҰh,ڵjgH5A%0rHŭ6R#1jziv^ɴپtG(I(Ƶ.W%efk`W)ख़Dj^i6ic(G R:Uێmye6冓\hN[<2˂[,UD %c:e"OYB O;&۽۪ 38M㫩6M㚪dczUyD_}WB6A6g5¼bKuO$dm[K@YO08cLp]Gno2j1i>0{uPEJ'wAHz)$\[iUny$C*NJ[I$y;b0⸄}SB4N&u}Ŭ|^-B%ZU?usK70g'%K i5^^-$jG=ewllmHጏZʿ˩!W:3u9%R֊(p'ejL Kz]c2 8Ib 6#^!w II%iZiᲄ!vPQFENi*g*Y(K1Rӧ %r Mad^?[ӔZpLXzO<O )ٗs=7Zj*lnM`CI[s/G-n[Q_{{ j{b8&"Rm(u [kRO˕v!)?Nﻩia(} cɴʩoCNV0"HtNrMY25ME\%[$ D´Һ?n}z#x3jzi`WUCM ԁ\W#;GJ^%̗L"W:c>U̬Ԩ2Z\"bo!+ j>.?rX3q/i8_r憺uTQgU[]\2lT;5ZꚈcEPjVF=Ř(ՠ/CNjOAҏ:Ƅ8 #xfȈKȺ ${XGV(ŴOkAu2kEC4P'PQdT,X=5TX-ž Ǻ׫ 2G8(P@k,{%I7$+aǻ8u`:PA]VI  }\?^ڛ7a$ {nLtB8d}j (l$qsx#8ENEAcҼcd.EOT --Vk?.3M__NF8n8 }-mFrl4 ynm  v>6!>I(j'??_t^\ػ<4&`#k_ZBV&7#_C0Y[5hKì*/D9b @ ?s5Ѹm1F#<uø_۫\\W7?Tz|^BPLխGJT oC%MG_hBLtH; 2I6v9/Z?ݗr% b^ 0BO)cm5>$r"x>$Ѕ?wƳ1&؄SaJzV711כ^-m5e=TU+,u4n4)8jQUUѫR rb]P?LJI%1>}dW'[|W\C2x˥jPIu[ޒĘc3L#~7B<QtW`R+egԬK`O[ExzSv;& FA$*׆Gt޺|l%tr\idG [D`2el }E[pd>#]Chq-w |ĠU4q)[Rɥ!&OW3ePVU 1Pyof&0tV}*[>ΐGVhi\&zTTJe$??U񥯦s"HQb -" L@WΔ}c̒]]hbu_/SR_$卮 H k~%]?\5GʒHFY>72%QZpɶu\MtՍ+ _X 3J@s{YmܥBA 5FVE=CE%"8 {dW7DA_ϐf8=XE1h1%:-:" qOD7>- xP O?o>ܺRke. )||]@i$Py:<6RʘjcY|жsMTд[+ӴQ$b7e  m+xy\,%xH}Zf +*8uvw LFi Rz{]|٢mMUW J=A (dzb$pETFW 1V[P:*|Un⬥sүoL+f$0 ,R+`;aqf5>1C p/q opnqvH`t܎xck-zi}:RbjEHեOHoǸ(*rX pzNp0[pInbx<~?>굵M}j_{`sc]W*}D?؏x$Gvn >2o0K\ t@@ßx|F@ZAۀ>}M"Er$41˧Xɽ'G߼s6}?PZHp/~?ߏчpbJ\"Av\Ƿ @p 2/=iin5H mby +ZVEq^=z{^(.X瓥I76O 8R({NZHkZtve _ϏR/*[w=P *i ɫOز{\aumW?.ݴ~5 y'owMҚJĨQ cnd/z$?&곻VLTv3(g#ȿU+PnAcdxz!Mz'l`OC8VΣ}/n}M- ?ߒ?͠}8BJc4<GkLu*`}r*^Aa{zTkkt~l,c1aW}" eq@|tVzZMsͿO(kXP>V{HK7oZ9Cn/žvp $MԒ-{1*&sN 0?I DVc{=Ӌq{qvA[rlO6{)&'m[p8<_cS2҈ V6ǚ/*6ͭDzy'=\YЁCOë~ 8.Ǥ*-Wة6^GDq}a(n 4ej,]~xs(ʎGȱdf8]L-"Y"GD%h @Y y+I}0> ?['odS:ߏK,|GCIoÏat/YB~?Mx; AйsG$U 7ېRTv #233C)=`JXA؆2{PI,2`ZË[x)$SXɽQ#ۈOQ>ck b; AAhĊ,N(U>5?OR%PEp{\q =C$k`cbu@U@?~dwuu)VNl B>Pp1[Mhx[XB'Tzҽ5:*..:iE:RIAetW%^؎Uڸ(`X.E?QPo.M ȍQ:;#*(g+7@KŕxF YTalou,tc^oHe5@WR9"Y l#B@̞x@e-rzɭlCm-Y3xB~]9tLeX(ʚS#HH+ }GiBJ*S>ȍ7]ʟG>~L\HBAӦ֢p!52=bF3HoRuoX|E9(^)OK *pH7z\e'cBiN' G\X[^oi cQ}تZ"o`1徧\6Ǧui$)Q9iKr ֺ̀?ko7yz7 UstnD(Gs90mL֒9š?-,DM0xۀn.$du岹,TX*2nAh38W*I[ܫi-VJ.WbOLM:/nZ\iG|&{j:Y)RHa"GQ 2v x5-s\'Jө#oi. xsZWV~κ 0*E GK`I0 K$.Kҙ$e*?$Op&rJ0WR:O_ֹRYX]ZB52@(GT.ob ٻ gkjYoul$ ZKdԪ_篷wn)j+5 "ØS$6ZR}_ rWsfv+ STgo-!2x= Q0؊8h)08AsI~cnW醙炙y]tQPc~IUG\ n<|X>UG瞷%ͯ:"xc/<B:*]Q$L+f:'R nj ZՃ"@;輌X9 @] `vCdRI!i]AN`8 W|L})â7vHɲ]KOIS41LKL]Uk0\,z h,ԁML/OJ:ߤZX{-ϼr 9u-Ya~k^W*yJy\PT5_萸^'keuiԤS44TR[iO:"$360qg9O<{ ui?3]VS~G%uycpv&=Ye|hSCeY˸ lTp#y|sҽG<]1uẺiSQ6>IqA{j"A>aj!je2s"R>X |v@^$!,ίOP2cu}Mg9**8ׁ4z5}_a9EM˔Vp60I- TɈJoBTl+7wټ4cIpjh (]4])L{ s<* K<|N8u#O^cH@xTGub ME*٪i*І֐m4fT0=1opw$*8P>3D^%vIrѳs~#CJ V,u?i6>[ڢܝpUW>YQP 4{qnt7CjdDj+)dE Kz$ ~s/0Kch3(Jq1Nߣt\rգȽ@ WǏ=]7ZmJ:o$B!UH D} ȁPOlOd{^Tei&LCңqOu|l%Q*%A+_ìW-]Y;0vy^sNR hCweYU7ݿoHk+AgYBZSZ3Q#:Fbhw&K}`tXx1&h)rUB:ĘqrΤσ|vaIԕc1ʈVf$1eWRKGbmS뽩Y] ]9U# 1?{nA \/L)~OmZIݶm AG89+|RQ@ґo,tɥ{}&;{zVpSSRI3l᫪h!2 љU/H_>rkyl68 -$-(† Wu{ɶ{$* 4QsřyA:&˻o]/ݽ-{9^JQ7&.Aa%eb5V8eX Oݔ]Տ{o/V8kk ԰;L@\v9yeiФSѼ7^^ڃ>}lyYP?uh#UW|q'4bӝy8/deVK98ړmmݱQXi򻎢z 2~m>G !1>j<`/,kC%)fV_#sx=lVTc0# I?fYT0m;}R}jiB$=mIJƛd?euoCNp3.BcԲ0Xi4K}?{pY3OpdTz鄋_Hٞ5wtƴd&%WRAu+aZTпI#?5:2_MO%]td IjgPWRE'6rߙ*J[)I(6u3'.eF r=O~|'+ZF1g=GKL_(?'rcVs**q4|Ime٨dGO>5Xѧ;GKNOw^ѯu㒢 :cJ l9*̠]O{7ݾ`ݞI0ɦ5X+4? l{u5iONo7U6ƭJt9֛SxRd7"9ܵuL*#2PLj(RJ>_<{24 \c2⭣ڞgtw*iZGp=;s5ۆݫoxN4ajz?۾ơ1#1+N52X!\\bN#zBjxV`$Y+؂O%̚M_tv$xpボw գ>l:  RPH:أa|Q썷*uXY+Q4\!E$ y.9j +UV '4WX73G8hc1HjB ?mY -`avq8|=xLDJjFVgeհv?Lˏͷ}ibܻ:ZcU56*YOGJSDegVss}%6-cEц3rA4`H[ilhJ]@ P훸w~)s`j*V`h)rijǐX%1: cwWunoiJ{iG5)6> $51V(*$de =vc+č3 ALzH{+4nڭx1.ZsPHSᯩzfݟu1Y*$w\wJ F+T8_#0bo鍹Z#ɒM[< u FvGL\ kn^\!kJFuA{C3*peW:@QS&0pA@z*{w%.Rm㱠/Fҏ)=NO $Py*VO;Dl{^gvfFZ\,{QWCirPPSOUYY.28iY E-snoIkb !9VPY:t8Ov{l˶d1VGz,Zz9K5Iv#qRy#A;S*4LUCSI&X{;o 2L'-SS441Ś Zj1)4DN#_,I!F[ܯ˓+^MB1J{Pj3 .]¹b卲p6bF  uI49U_8wb6~i[%9/Yۻo2ZzwmR%mE(H/ lpQ=MZHciڤ鬖ȥ}eXaoMxRIbёC:#: %+]$POאcݣ`o!45jmNI*o޽c8^n]6pnmI-Lv7Gfru]5*eEhۋ%3㠎#iq"!g̩)xgkp`!Ki5%Ou-?|E$s)hT!U*VPHg?}GŝlEK K7nV[sR9&mX 5\~ x\{!08#ǗF:Jt%~:(޳evȤ6]mQ(4KU#+_S"Kf%6i4 UX˥MLB^nR_[FvS5;֯c6PVuNZ%CؘZ2qem!V/9&HT8 ڢVBRj &"-3Gf6U.[[s9I|S&u&W; = P4]Fz?!7mg3Pv%vk.hɰfpXF7-UWzvR\_Pޥ{Gbਣ S5=UJIP< ܏ݱGZK/9)cUmi1pGD)q|NvBIUvQE&OK-L2$5nB!"*ŭ"VW0j+_ĬgӤ"fJi$YI<˜˻2s/2oF\/FI<9B1PToeemͣ4oiI۳mHFm`0ǻrmѵ핔E+,"VE$VaPj pv_rsvh9۶|f1=Ol>Φkhvabj(3tMOV)#iuܠ,^fFc2 d)7&$2AƵI`HB=>jzC%<9de) 1QH9}a=gcb]Jj /UICQOf]{~Jv~om׍ZA-逩Q6 RJI4N/igb䤃zlPⲿrx6xi'Y::hcmN 9\2H(>ST`;-1>KnTg2[e#L͏P"Ƕ%UE ޕ1Snj5 q]A}tR(g2ѐGlwL1z~??[%<1#UU+*kS@]l}S}kz:}c~n*&t mӶN|zM4tؗȫ$1Z\rZ0zg>XƄ3oh]`BA[I7kKtڌ-ݳ*0"e'Oc ^?y{A J ʝ` BȷZavSOamv=Nے߻;%ӾّIlNڥ\NJxV $[5e-ןېU.2+LZU$TS3cF6e^;tvF]ŵpPO.{&_ _vt9J-ؔ1^Rr9I1u,u, ҡutvlؙ(abB``=L$`Н &/ ȒSt e՚S5=w{۹GTD DHu|kz#>z"|Q@CS˗mcS(ᢿʿdkgOjDyh4q(*{ y0KVJ晖zUVpB*O"o}G 4T0*IR`K,HLEm^k'/_jL#>ޒ>].yz2Ԭ4xmdbT!~NA1SCvzjUk:֔ uy VAo |J#7]Ʈ*W֣-+o{%bq>!֩J-Ątk6 oӕ$/j?K[rW߿ՇNH41mrkB(6N~' /qk0[]W_NZWI17YCo>p9:x%>ɿ.}jD[L蠱i l59UGrE~9oaZbz. WWەR}6kn9?Cb^{2=,a=B1s}}w@%*]+ZSalj, m;â% (*iLK5 0kowѳi'۸fd$$ɡT'JHTQܯ"K4)?:^=O'oV}f 4rO S<:vTw砌OAγ)Ydҷ,lvM:+x߃b hɻJʢ@s<ɻ}2Aيt:J㲓yZWGKpj[_Vc}d^41# bS\JQiC:z X6{A~im_aSS.hDԱUԟUxo*4\PD'AǹN4(-kRn>ݚb\4>bt=O"!s[(@56,~Oei f$ X:H"|N`׍8qM|<)+Qxjtʽ+Ԣ:݁o06P? {5-δf/!C C<}})<&RExp (Gq)ACp-5jzl.,I /QД!Ehmuԍ#ݙAࣵʱAooSnH5xR8Tw~>teLP-5CT6%TznYzzRtRtmþIcm#(&b xp>y13DmM4s6n6,\AG.KXªǗ ~ _F< ǫ>܂Ovw'B+1iLyԩδN.$ >l6HbE3(yEɸ-WMx% XwףXk¿fPq'G `XvADƔv pk܍CO>r8k9e@V},a{9nxS^)JSu*Z@ _/˧uf飒hdVG<cޢ!UBe7\ԓdp#"gv2U4y't&Xnb8PZd&,9.iUekOOGS_w !WqPҤ ^[7[2ޥ'xdթn `?Q-ev '}tjQq r0oe[(:AƠ[Sۃ=,P~k) b2dz^ >α"H+%GRlHoc)Qvhc~oA FLnPuϥ@Y +kcZbOO+3ZV4oroae-ǣUjv)Ф݃MĢ_Sa`AI`x$K\%yX֣b}xIk'B9 xPEuuN4 KZx SGM$A"?u jWتW 2#Xcn v-k{Z{xQRɭT1<耨7 _졋 HztfiŖ˦jeO { $+CWasJX{ݚu6R]IW4rjjǏIH ?>}_R4hcT[ӛ[zguUWuZ=T'Raň7 \1d}! n8[eiĞUB=}ģ!osͱ&'5J3Ɓ_O_bI#kob>-}WA:~.R[ƷjC6,xFEcۀd5=B:~E6[r@?}-REΟ }b <ʈGi΃Qav^/ǥ?+k}Ep&Ò ?OWontuԿ.ͯÏyf*E؝mbE6f4z7X^d]dz{^{{u~`T׽v@zְj r+I.eW^mئTf~z~aX:k>5K6ӵKbP7P5j{K ^B@u$?7$,Аick^IpB,W(dR@+{G cTXSK#;uCžt^rK`ʬB}?GiGe&ڮ@HꯆzvQP 'ֆ]-nKie{Y$**{I 6qGEU8SCϣ%O]ȧTS/;UvQ3rɷZ}>LyDD z&nj@Ǒ+ j/ە `*c9s7"f(b " 1@opaր V? _b&Iy\3T!W~jXE;UJD @T R- |BNq^NOYj YJߴ4?\Ab7x_N?ڢTqcwΉ4 Rn)=DE QQp6/>FH۶_µ_Z%Hꠒ;Qi(.뽔El`t*AͿ#VpzS9KsyONƻh-olݞ*S AeD;O\41Y j_W,/`)r%!n2(ͭGB+eOz;F)ˍ "sQ1y-ԏ`jGynHf-soy??{,cWD}pN# AM m(mdOGQiǷ ܛO?~:UkFl X^K}+b,>OcZ#·O}=7R?0$VrTYAkW%K0/p \O龕oR )/Wf"ɣ4k)֯Ɵ8G FVN%ΫɿRZJM?hE]{u'$hq!1}M@kc =?O}2&Ч*`]Ñ1 ^Wsg"1AoCi #iŠt Yd@Y)(mW^=#l$ѐi%},H?>A"ꮭY?ZtS^P":c-gஂK\,G"R_7-6\?_> ~!8.@^OoR<"8q%PƟ:J*c%pX+yEjc_D̯N$q:2:g}`@}.8N/ ]HV@"{+4SfbK~.@p|I"LsASR_ԄY7'"=mmT_nyK]fV2z0z;[WRT[rO;i.@G꾟txT++5`G]V@py`k(n`y|G'WXOG%\́$dÇ{{N!PƶP{lm<-.>LE5Htz5fIdPA<o>d١7;}s`\iˏt,ܞѸ\Uu~U MÃٕǣ3y4r`x/ͫmDqRC+2*0xƻsͮЎP-:<4_?\gg\[#*VN-救1'3ӻWϤMrQa:R_c+:p]Wٻ&zJLU[HjhliBUckXm~#'RPiԊ!QicWBdgV6$xlX˖I)uA8['?5zw;[V۬b`*!j9bPuBs{7w r|X6Ei"q8Twc S}YPVm0!GcdUod־sʷfsgm4]lr^AC JTvn&W@cgfOZq~mC^5.%ʃ:4SST JŕUbK[{w#||U<8& G")#ͣ9gޤh.MR&ҿ5=Esr͸2% (ބgáCRAzfC䂜7^ZXe.)t)*@h{2IiTWTIpNܭ`7 RX#ղ3'=Y3(5eB{[ 3CwichnISy[MIHӚhik6>|8})N4sE.[pVhq@ibk ,Oww狋ēESkcW2ͻ t3'j ( AZI@zX~׳*wvvam_ZITi)pe)A"JxҼl'ݷU沵6w4e"hS JGr@A!}g7{h4Rͫu$T^WۮQ$x'B}J CZ㢕?̗Jꏇvf?0`w9S7p&6\ ۇ]ɐS%==(wGOdY7N7O_drPT*i?K$P1땪0Q-* ;.(m\NDWÍENNdY`f};9?HDةݛ [BNG![KhKEfX|iZS,aSRWl;&PE:e5:ErX{\5PyӪ;fn7>6*=YZl.2 3iT& =3;6vm1)(' QQQ[G,r$cg o6-!X-X[y] cIr׬tw'ع8w˗&ӊŞmŞ|>=we[_||IUO#ZYi7 5/"A&g޾Zxhq4c),1ޞZ>]Y'ʄi:I+Y_.g^2WA-1/fv0,Ut]"a@rh$+2w4->'UUQC=,5rx+AX.6Zy4lSȚ>7{^rio*l!0@ tP)j\ȿՙZso4+_oU7FFZe1œV$&ev#n/mF.KMI9f'i̯" 4%J-4N6VNMҽ0x VPFkꑺ07r R7Oydٔ4ض))"/9,r43QI%F{[sOT EA]q5VFOj}CS5IT]W)p۳fv6;7>qo)%wx'U`QP,_;U8( ԕ``3&zm>ݣdXWQn}w{=n|EB 2**=5'4=jcWPJ=EO$xy8u p+{# MV9xMIIDWAD&![ST>8lOp϶#D ZۆK AT`aZ&v2 b"LA%I`+VAU>{lMVcwF<}^3n'k3jsSc+]{ ~Qbd[pZ|}FlFՒRrٺ9fU0Bĸ7޿0[7̖vrEht-)Wɡ $CZcN K)88ι_R(!,LS'hݻywȌ\vF.}Xjax"=ً9Ip"<IZȍJ͕ "HQi7+]x&?=(*4S~Ym^{|;m6*H*!4[M(N++S`ܙLgǞe7mCn.Ө CAIICNRCG Od3{qdunCճv!(t> K23PNH&7\ma{/ttYU r5jʌᾄfm[ۥHt(وF%Sc'$]ٝYײ7ݷ-ު ݌*Gqb馥!Dˬ_=͌|5cjb+3xYLeMME],K{ f(n=ݣ7W4֞zWt]"1s@ZGtx7XMYvgfucre6wgzTaje:Q\rY ,'ƍUjY2?OJ-A[,?hqi[,yGsoϴwIqܜ8-v$2?|I v}`۷%C,Ƈ=o*pbh04PqP?ξݽssMQdj$vLlTS}medXU~I M6Iz&WixƏ-GO%LXX'JXjCS$ yѹWq^I#t1x/ Fl߁5Qc߬ ;ݍ̈́w :4!*( },h=sCW_]Qtmv|KR;j~\+#g*hhsO%9HLAAj`Z!e PG< co{,}po6+Bo 1isiFt8uS!,Ir?);#nb:`oM۝)1dmA(I6|%uN'y7%sML>WC]<4b(#zfqI+l:oy5o CdSx%dRr&4b/ǾN> Mq Gմ1^jɯD$ܮӸi%ÐKKsrUlHZIa&]=; 6_WX19]_f)0h~#8x]UH$?>|/0oܳʋrMpţEIf'R&~!\zF'l-XDS '*4341gv/;CWeOlu:蒝fj׫0WKKtE.FaJ"54V4~} q`ҵ3?f,rybߺ[m'nOraReM*PWPNB{U5ۿmUs=؍ŘAݘ͡X-9zzjt!*/;2)p;;rwnѡz~ǣjtU1*M;*UVf7}m-UHmucj:e˭JtS][vg|:ޝif7f2-&w!.nP"91H-dE ڮ ,[un|3D"j1@`|ZO5<ع$.;] &UP )`Q+JWZMRVw`8b*xy/϶>aO~6be=]J; &ZSJ.bxVT NH!60L*ՂjeXBuzgo#~܏ϲ( VumLK/PI?Sײn<޸( +ZY:nù{'%U=&&kZڨbE5t*OOݻidxa'ʵ.Tߛf[Fomĥ?՜u~[|;RE%ꝀdCGK撞uCt.j_`nFg`L>&ޮO4(0b{W_PG3*_b IO51,tƌwfMv#P ?^Q79y*!c0X<-4@8bb=%ӵ&򑩌&s`\#>jDƟJHoB6R8धV:Ae%Icm7m|4v'0M 9*?LcOW{4WCQ]QM! ғ[j'WȾHר_^%cM:D(J }"p˨#UBa}d?Gp8UizyBI6z>HC$i%n~_s<͠zkXߛjefcNƆv tū_}75~B z<RMznQLL5K.-~jj+SLQG1;n@-p>oҡj#Eq] `XU%].RH,9 P\ dj 88 k6>ٮ:oJUb ޠ1R>XjܵlȽ->MOmjtjbIm|}iCO6Is߁ϭӬR[(ֽdt$9&cz<_^}n9EEA@RBP xOĭ-^ӭ7XU\} W6Ty\~fcE~uDCb}24+^O(ER}@ }߆5}QLu鸫Ԩ\X"u_@y:KpS}=EB8#Y%UuC/{(6T6 ʦěl=6& (FӧjQBؑ}B[yݸ$pn.?څ#-🳫gJZL)i]V(OV?U4 }_[l $$}ܐK=1y+_Y]* l='fԦrgaSJRִl`Zxq0Z%BLR+N!7f-_}O_[ j4C}rLI(.l_']Q6+Jk{3 $de7 cǼakh.%Lqly_!pzOo#M3@Jp?|ۻڔZsUhmwy >58$JF],}c j &ثִP4{As RW_|q TŤes"/f5Vk3+#Ihrմ!mt+[9C{R >9qzy$4JVpA$RN5ZPe@7̬ B} H[R@_{oX>XSFeV_ٞeG˨X 4SJ?ohA~FłIb9:N$?׾:U!Ŵ\{U'>X=[o7wgoB38y8pKq ڈ*A1?="bUQy@l˲3jaA|H]Y!8FxWSInsM={iZ|8OHu0y,tʡocO_E#X ?iF O>־h$r(Efyϯ+gø: fYDD7{ [-n=xL'.H.lHPh s*G1l0]G(y$U3XE 8Ns+$D:C)d\RcbG"K-jr:<{ o{rn6SPkzg1Z8b#]_ĿN]\+Rd+߁ksQMRe,ly6-wX&U8zRphR Uśiy{ñ ^X30a:4N?zI{'/tr5VZ|OmvnW>ޭG{EtZ*{kVƠ^H `kKPiΉ,O Z= O_ˣmBJdzPMA+RH0-z p`@}J|㲛6TfX+)FIs~&g 摶QּYq|h3(q>jq15NE6BYcfjhOi[YЇY"5_gF&`~[>5}zdMjW?@m5D7:\ܒ *>KImEЄ`̖U {ҕ'+WI$WHQEئ?o[T*PO)ca#Mk9:[~Gl}#p(GFVTiӵ=SI3` Nx#{~}@_H'CdqOoNHT =_Oxl>VEH؞ LלI@bb>0y6:卍~U#Н&{e@#F6qr]eKp5Ba{kI [M7nmZOEڨJ1Rxxmq,>X>c^:aڦIߎGnHMΫ?kZo>qӧHok/+7!7eE_Ƅ.2D^Qnǰ!{}FzV[ OL@ $PE5 Te0> W)7{e6&[؎l?mjF o>H/<\9_'QX;zj-Jd}. ɿ sX?#ođk _f æJb4b"#7[;#ix{HP = ~?cr~# `. }=r*ftH2ܡ$E6>}O oE{z pqZڪ.aƃШH b~}}R-!\ى~5~фA׊7:Կ*}ÅőGՀP)x?vXi=RJ#t'>AMe:>/ mWz-g~{^{{u5:%%<~x׽΀OZ ]IELæu=t?P_-_?vB q`nED sW`8u$G^=6{mf$:"N+OϤEFlb} dHR15W6?גE7>̖G?[%A-k{E&Lʾ5uTcdPorM!hnXV$ C.,rn'+j?#\z6LT*e%$ LeLN$a+sa:u,2D@ڀ(aca:Kէ6qޣ\'2)x_XB1 ԅWQn}?ӏ`sWZaba{mA9jwt |,**RĖlQ~~#kcB/"?ե9%9v};":6@y":=D<~"˅uRMȷ" _c${ OϹn #3}9Px<|EřrB 6[MQ D~~o˭T.Lz eS/m?ǹnȸkq\^u<:zfBRV AS-bيRC(HnX+1opol6>ȣOk&` Z~})}#]kO*V!iVRUZ {+(Q@e({2zB}Exxcb=5iIVFɣJf)Tu3#I,=Ƽ)]ec*R$TgΝUvTUeq*dx^)ֆXt ,u3]ywł0bH dYu+jӨ3)uD6GaOrY+rJpX@&(zk^>ɖJLmRSSQ4v@[E_C=ՙpk+dZ6Jސ<wS㢢LXsp81ޟ܉xcBv}8X )R|N>}#;{iwva'!g3G<.ΧMvY*4%qO!XQ׫KG5@'Q6W}jjQXB=zαzK[.E՜_i ȲO)KSJ PB0J^ ,x!BGqA2aa±Z2Q`'UفvދEg^g#6(GU>KUOL4g7W H[GwSc 單Yu8ji$pM>l?+/16o\]Q?P[7츟>zY>Š&<>Vj:Zלrڗpg\qv&BI;Σ{Qż,#]oƋ|= -HƩW7K=ݝ>QhMec4Xqo{L/`s#H%h!c-p@ą٤u@T?{w]dKq@䨋-Pz}أ>i5LLU4퍲ﻱQiMQ`^4RIdU3 ؏7O fՅR~P٬c!7 R|Bx-2i!_|bF)!GGYu 0T~}MMrVKw>u6 3yza]s=Α*+R8Ԁ iQâgNn6#q1 rW fC"iQ1b Ņb*XȺgW'I%*dr(YX'_Ps >, :H:xv$oW{KK{YƵV&#ˉ489l?s]qo;k$V`%zy#5DuY:"U__=_\YJ9ꥊ!i1;l6X?7i'GkAYݻxaہ:&+'Ҳt}eYLܧx,[JtcAV})FTUh࣊(| iB(B [lLӴ3]#Gu4relNc)+"D. Q]_^ێ *^pd"Xkiqp (c&*Ho<WhJ2iMuPwUcd .nSą@kUp# ME@b 84 ۤq ;oNwN=ىV}~![9 BŁ߃zmSډēREEOTfoɍMqՔd!UM"CNZ"5hϥBa`0s7nLCV3\ørlxŃ1UTSں;zkhtNo''] ɔܰܙm^c7>J#HiBQ@`ۛ6 K9,Ѫ64|eur\Dyjz|z-"S[۝{xۢ" 1:|8N+\.y,N4vKb *4cR84g}umMrMp4– 76{nm?ݎjxnέT+,!j@t({Ӈ2s\RHՙ\+ԒTed^ Pf~eES* KjEAOj~>*˼=ĒE Ev};lW펭֑vчs1d(JJd#rGy!0_Q"sHc2r:dQZ㦎RB86Ǵq{ifo܎i!{tw:t0Ibi>*S/G.[#:h#RѰZk*RhTuC?)~vWvJ=wEg;+g֘ڎ-hLP)$ꫧgG 5v,KcGIlչ*Hi&HjcG(H-(c[sr 1EfRPҨipTICexgP:aZu&< bVr[gN-44] 4D\42a 9$C_APnv=OOɊ}D㩫"Ȫm:kWeUU<1}dB#aziZ97ro2/o2g+im 3DR"l9 Zp$j=W\GwF=سG'M'dy(v3PULT,tgr\D{ ;BpWǓ5:Dqd1-m$u.BjZO$ ڎxiܹ~[{ +!S*{W=:Kw /w6;RPJ*rA &ZG ؘL%=v:K0&"7zjyh"8Hgs5d iKQ6Mp} %b.:XjTfQ","JĜOetD2#oOz~L/NAV<;NoEbA ^5NˊZwF6 n*%D29[S GbZJ:$6#=GY"`Ҥ 'g*.28 {TELzP$-{Z6WV7W.5:htQ1Ro{xy{bb/}y|(!$d\LOv(R3ZuS[Gߒ]UX:)˭e3la۵fzaw>F%(!oQ:U^/SwEUM4 ) )} |ͻh3%BMM4A٬Kz K/%76gk c?Qiel ae]ƥQ@P+V@LIhr*-Zoa) ,E˖ XkgʭE>Өx]C 9ofnG,eWTEQ)y*ZjjzhMҪHWm2)0?ng%љrTpբZZgApL%\;;O'r- ży 2DYC#ytąːŪ@on;KoaQkV(c>uԗZVOߏ} ,vݓڻ-a6-|Y\F[!1[ 2:1VQH $Oun3=KgUx-%QTzdOKޛzDr)ȷfed}j됥J${ -$̈tyWH RBlw^Lxt퍯&ulܮR %e\0U$B,eRX8M|[̵ij ,O̡IP&/a6/{%r{p$WU#ƨFW&d}$Hp4 E $)־7z{7E!vkw߆*&iuet1nE%x=MmڊޞbjTUCVSJ"* Z7 6\˖̻ܳjEi VPUM$ #4".waXHB:@@A@8]7j0v6 y65&ۧ iQfS=&୪ZX`oIRu1\p)b]PXE X- +G -Z5x}A\Ww~fg";y$9C]]ŇȫJߓN۝/ٍ .+`BhD){#nͷR;Q/MShI$A 7O 5-m'tк@ԟ^:$v]fm,uSRTdu4WTRG~M)a Y$ UH}cuʴH斤ªj O{w~oٯ`Ŷ}atkp:!@?)nBG Im@`jH9c\QZ o6:ڜTtl~fqxlKʐHn&yV$<I&::xZ'YN=vF+JH(-?m#\o$ykd F2F(0߈p2v&y[cnP7KumnoYIzJZh!iVd+H{6ާUf4TFdȳ)\ThCCIxLky}a-7mטB4A`nkxbWaIt+OM;;ˬj,Эɝ,gQoz|;BҨ}?1[ɒURtG59UW_R]يuiM9j8R#!JV0A.yryemR PA{tʒOlf3 Fz=TXZ䥥ˌ}ˆGEQԃEaI@0;IcZ٫!%]E]bڣ%_XFq`"G1" vl$t@:4=C*TcH=¿o<RkoǼ2z^83mDWD*[e23vE[wahW¬v| B.ʂo[Bg)ƕb}Z|-6WFqj|kդE+FC%Nq;:o%UX~,rҠ NnŮH[-cVW믶sJʽ*6-5C==0kJDINCjWw5Xy:m` ,?:_ҊI*F@$zDSҩe:g%Ȇ珥_MDZ(z0u0X!#&vvoq? {`GTxD* <=1G;0C_e.r 6\@[ܴ.Df%TGu7mŁ ?2,l&ֵ"ĮQPhxtʀjI|Ab4cjak?>޶=&%D#*ЅnACbrʺ9"?l_>:KI!Ҧ7l?6bT?= lGcN.Y@:ޣ}D[#'u%*}@EOxeg xP?ךN8 @oYH[q);7$j7[?O1PZ&XiJm<-p5ůrGbIan}ԥi^0R5wĨnT}9¡Trכr97_v4Irt^;դV%B t=%>OsktqQj~&v1p _M>-k኏}=#P"x+ӝNG<0 d6ԊǀBZ8Os>>A>ދoҢU\+&LYD:~@)Ry @#`~m_aZ#ŠDlνQ䌝^ n+Jb,եu}^ l )T)b꥘XB)df?GPuFmR0%kJ7Z|a[*&2PFd85۵Et G8_'ۺOgFrl-=dPHeiXHLRTj}O ,$RA@}q.w웤QsR~|kt-m d6͍qOG:4PK D_T;3)Odw.$ƴ9x%*4hq$0@,ADZ!Dcmr-JI1*zo|gLfFb}j1^w򩬛p6)QRU:pgXiU}jI~#jn:)(<'zbv*F# /܂4y>a|ynKbV1NڳִɖpnS]W2XN?{6c 5VJf*cV-r ^&SYTJzt7S$<\8Rd,ثcaqoBT>|p>_>?̃ʅol6ۇtpkƴ%=>Vwf%SOI*tZya, \]4_ۭEBFB~ARXj$jا5DBiZ>f-vt>0:>=oALSjJ**`"+HTB"QWNB3!<`oQԣQ<ͽGSt\gˬ6`[ ^ )ZpOibFϤҨDjd[\p.C7,҅I}=XIE+^ۛ2i=:)$Z 8E?Z$R?WԟnpTiACo] ;I睚8XeǧqB~@sZh M4ϡK hZѺ# B.Op},w:#SjܬnoOX,f[U*??O; iVk >HfID\'zu ͭr?B <`!= jLӇ 't>\sOui{bkVzZZƟL2̋+F:?n^}^˧)}Q CjV?X. n>fe[m 4:q?Νdݿv-8_?q~O.\T *`d. ܼM3Xt ^]:XOvHI>lE14/o㇧zMX;Ջ$0̚v؀Hoǰ֥LQRoc= t.D0[^d[M%-76?Gj :%Izؠ#ӧkTߟIpO_p>lHOAB~y>a?V8\ru(EŸ%d?K9G2^'=8,86aſнVm{[?OӭTx>~WW׽=җ5KhNu8'Iӣf8N4aU=zG n8ۢ^jb?H/_z)׽Zgknmirݔh8FfZDl?:EʧFЏm>4[N!]1{^4U}}%&2Á:6@z9"'ԋ#壥eR E/bo>Fd3H|*d@1=~/opH"4"S:p:ˤYݹ\[RKPoEnm&i4-&P[p0JKXIRܒI?O`P }E[^ +CjvH Nԛt/8{C( bT܋il5K_3ьOu18bG'@9DMئe~}'n= W.AA'moשժױ'q~{q}:t#Maq ~'߱R^VlM.O_jmZxÜW/dFY/6ӑ"^8^6{LT.!C1H ́InPRqc{zOמ'dW+TӢVqVR[@kr}0$-~ 6$t+@X 4V:[򶱱^֓RH-qȿ-B BHÃt*ћoE׏cS౽Ź onI@ʞ|:GS=[{u׺{^P H*ï{;=OGcnB}VU<\-k ?O~ݡMx?g^kǨ=F@>`KYG?Ͷ.dXOҘܲ?  V$ٔ`,O ěVbL*i AFUQoUʎQ%TDmA7ò+Q Tt1LL :tXog&idHIR=.EaćO̶Ro}?mOFJ)ҝSrWLټZY52uFOIa%GqW)4P pC b{A&=zWEffqRVoRUHR4_ϰ8.' ˮZbIX+1!ǀoϰ{-"i]$osr )o{샄a#ի?la"$2 K0"BhOђ˧H} Sn=]- 5t_N{Pj=ɦyR\[$lyfV-@@J:GxԨ%V'SDŇ1F '}>$8?JfiER5i%IW}>h*)9KjDEg*Vu$X@[x qcӧ#j8]&*)e<Ԁ 2$J2ebaaogr N)$mk-D@ן%6W"c629Si yp|^C*5TwQ!Ad[׹Z?:3^:ub2;G\ 'J?cP65>]#Rc,Hb( 6 oӶ`VknߓXR?&,ҒTYYdcԶ^Z;"5RoS733R -o?+/ߵS2k:yuͮakF?reUEUP }`=;fU.&@$xe!t Lx7?{ǵ6 _^{PLjOv˸*dN1/5P50,ѼGWW;'Щ:TWqnwl t8%]wwXv"䤡h RH%:];ӳAcpC"OY4shʺ#`!2X 艹l[;eƪ;mCFha瑏]'8xU U2HPM*%Tq:ʬ)j%Yr1} <9:?Ojѷ-m< O{Ŵ;~b@k|>11\{ 2D]!U}.mP^=Vuy>~ow5Y>TK׽ַem9wSɕB&~}(4vTPplT\㒷]H!#Ӆ@={I`aaS-DS*/ 6ňLP'?ϝx|ٿ>xrq+?t-XD*ҾkRˤnWqkmaMDB#)uQ#2E/Ϟr2͹pUrNhZh_ڿt]e(,F|w[j1QㆃM>{t6N$T:2S_\º[F]?_xwfkn{$_ q()\^ZvjA¤k+6Ǹpxzvޣh+3 fS3BLPcK[4aDnK\*輶}Vrs*M%o!&*(Ԕ<3Y#fX >4sݹ*I2$杦O-7u*%nM͹wu6H! Q[Whؾy)Ngm6ۛfx08\v*'qȴT}*R?mMI]\r50ӧA*T,|f q)ys2O'pν+m@BkQrA7evsbm1X8J&dRe$$-$$ZÒ;X0lӵe}-D"oDMFANI.M  [X%׼TwS/.=r3A&O@<2+N*2ɉjdhѪ* /Sr"QroUVN')U~a*jHQYDe6og/p~kW:~>Nr-5TZ TQ>Ϥ3*ɚQLe8 #CYVC5kU%<#QTi*q^`S%;Jw'JjP%P᎓jډ LԚ֬5ꪞ 2-ཉP ZI VN3bLTufTO44NER  ݓ|?gl:6B<503R|]i*V{vݬxb,cVQ)Mj ΃W7poeeq 4Պ?gD: )YͿUOC+RmѸzJɿui#y ixVV @魉.Ssv@w%Bc|R#JY^&Lc}.Wɪ>HO [k|HCUO}NGM7ku;LǫDjpWR70S@H$!|@=gQb(--M=5 Jש"!h$]UtCoY?-ﻵ/m/"^WMAV" GvFR*508b{o1_0^>qJ8%QL VsoJݵڛjJMY&c .;kM3TJtx"Lɉ)7|5 o팔 VziSw4(Po~{˺{qqimq9ЦhT E$?:gn}w _Bd[4#ըANR'Yl*}g0vfQ$+o_=5UM}"+%ֱGivqa\i6Դj*뒮AI%2J^yLdl8ɛ+c&($Jnݞo ec2TiZM@W=WKo/[w&!I(: o4Os_|6k2Uڲxhh-xa 2te9iXh, 7yf  BsCi_4ӗi5nqR:W*8t^}e|wosϲOYtyw=mUERꚍcFcm Ufb¨kcR|{:GQ?ZxJ*t7~B}sKOJ qELPh[K mobUIjD+Oԝ[8ɅƎ-s)241r$LrXMՔ1xLYhƬE#Y1rTփֶJ.EϽsoqyHhTrGtq$׽-`2'Qi]EQw{ |,~v%+1չ:sTjиܳS*iB]SIV`,fF¯'TcdG?F#RCM,qT:7[g sD%XU\(vUOD׸;0[Ԑ3 Z.T҈= ˿f#&v0ߵB4)Kcॊ,UEM$*|IQ {/8J%DQc9GJ}WA<$zMf&'=>w<̛L2mCM k#j\jAn߬p.-uWMO 1kH~}km\F fZE%모LʔAY$<UZX{uETm:!BjTO&21+1[~~\;\OM!VIhhYΩt$^zdܭآj⤭(b1:+_5M}~S&{'Y#q !Eu1,JK_^cbRui)ifH5HC!R]# Y__;KBuE('fZ03 C%dF~ 4 6y;kUYNGQ(tӢXW1>j{$U6oa^"iUS$bYfPᮋvKYv:Zt)?RYQ ٵu&ezn)%nM[iTsUs!^=N\ξrm'TXd*0gMH#bZRIL`2E-KS=ڙ]-&> GKQl0Z*jbybzDI [Kj13]úPAk|/%<_DM#F' Zs䜕rO-B7b,P4= _+~3v}㌡_vN"cv+-j_=VjAYF t#w^S;F6ޡSI[4J d= aE]EZgsnnLCJ P5. п,Kpbe .FTvicPHOۧfez}ٴkRlWeaisROMHg2Hb7X;/!Of=XS2)̲Tu%Y\ CҿWmW;VIV/G2O#,r>[u`12l7h`x܆Ǯߕy V;> okiZ 4E!MjDRS/fOW/T4dMY y)RͥP3,F 7o uK$P$n*КUqݙ#q,25,1rl;e&j砦C5K, p ["ܱ.V &1";FLc u ,NI+Ӫ;c-+ڂ+JziTUMh3C C^8Zc/gYdhPkXϖK)mF&RE5q]D8PsUMuhƻ/ث?tGG&JJ%1BK$!+U%fjmF7U!Bzy&䩿'=@Lho*GF)/VZpM}qP V*n5irqn`NYV{Xrooc(""㺝(bIh!C.YETjnA:ŀ.AڐkӔc[@eQz-(e9Tn4ȵOn7Z VaQx&opQnI/ }TE2fB+P唓`}CH $-! KZ9xt55ziyOEO<{⤂9}?؛?uԒB`y[X~E"@$\~<5 ENNլAҬ=>+UC}D=$}RȦDWOU"%WuХYغ [M=#pA6}[%_Ext=#1v &{X}I.O?Uj]3~%I sO}=okmouԗE\7+ ܩ[[W{e9#.??z^I_QomaoH3Q-Ǥ~NXLq7m:ƻq!k%.Z׽z\0hJqu{ؖ,=<VS@=\㰝uW, ͩ9qauck)@ rH6z0IL`÷C+%bXG{H=7,T@׷Z4OAc5*oƟSG.H4TX lm#i$MCֽFVm2?nTPT -:uB~#B c?{s0IB#v5vՈiފ*E[Y~F\34UIU:ZM+ΐ-4Ѩ) U߃n-vK,sNÐw1oA__ˁ[{:rGi'p)TF"Zi(^߲r:E V3Xu/1('|QOlr?)Oyv|AASⱇ{R-IC<{ 7+6n፥eESikTRH6y_7/'2x4jjh>~?R+Xsjԣ?׭Kmu 0,UU}57 qtUR*4/F.4zU>=9' ihₚ(2~=_>~cHǃWbt^մ֟ˡw _UOZ'J/gCw~oMVZj44./[t}-[;|q1FEYjKئ9/ς'fH?p}nRU&2 ޹)ǖ,SdzsC<iVdnN WX"ma4why 5bzQD.U׽.Dy.숰)\0xd ӣn;6Jq+ |-u_zm_y檰MJ$>ӀHdHP!Y$fЫQu~}T+M#*cō܆*;MbDO3Lҵ3W0m%1Hx&AZIZ?45EGD^PEF ׼i*NIoi5ȿPA*=M`([Ć)ބ?I.@<\M6{Uk4*YjuҞb 1]GJm0~$}~WJFo~}WO05km\ 876 Oom15Y`Z76uc_I } HPn% YP6B-=q0:|&z-k]:@Xķ_ED nn8HK#K)Ξ5')Mx$/`QŇ>D9`= Z#H [{ k)-qb>]s rI37:y'Iib"h ?MXh~-=57_ZZ׏u]Y#5!(z~~ ܱwqF֬- | m3rkV:6~.UoyvyPݚ5$k[G66 2?t2=4HPXC >MM`b.db9!&@.-J8tÌ,ƀ-scx7xc$${ aA{}lny}94Ҧ7oP=uǩUvx%Qy`o؏Ur?PP_JQISƽ!\Y#:a"!r_^>ϫ%f}?$~=;3眅#]?^oc{Kp? `},l~/t3)I .PLܱaT sfm" .*|C ]# s-K*E~gn 8Wn[ Si+I'xx}u~׽ߺ^狍~q`RnPR?YG^tMJU\ k~nE4>r)EM5i??vQC., ~l~WN!d:B=4 _o_c@ ^Cǧˤ@,E/n.?>̎  4͇ۃE<@W=-BjNV>tIRMmqSٝI LJE'uZnij ά.o-K$FM[-`,ET.3]hk^ YWApo,mo{8S9id3f60mJUYujP~hjA_4KDZv֟uTߊz\HR7_O>K(6vnml2S-$Cwcb>kݬ=1F\֧D%ٻ[GC>Tӫ#2e: $=lP7{MOW#re,ʬMf]7'~8*`zB*SiWҦKt[j:HUDi~_ޫ$):$U],9yDr| n $oO2=Z$zw4R>U] ݅ܯhrl,=ؒ׿{z&,J:8xhj7qq=5<1h 2cu?__%[)#Xȯ' u q51΅r4.8dc!,_K C}|l9?*OUbEnE?Ak/ؾtm^"'WzZ3U~-T }o)YQx=B*~JAN@qhXMx.oz&nxRdU$_ԑ2+jbˠ(>}8 Zc9 ߁~IF炢SLUoVe&cU څMʞ~( ~ϥ5MbKHTҀ$^}L/i冣ary,tIՐE_?$_4^Up >mM]*SơIQubNڙsɯ@=~<}IDUb#g{Fd%l i O?ٯZ馮]BM})g ]@T:zZ7//$4x)$#oXqY (ǣݸ-/0:x,ӛWTSQ#3=nDţFeOV:RYZŬE5S:vo2ћ8C `u*Q!bF迏L+8@ߟhD3_1,ƺpedxXܮQsprl=|yY)ɵʀC)[mϳX TY?/:uZ4/z TOzt@}7.ɬ(7kH'ڮPٴ{_z,E}kWz lvͦoWQ W3Q%vdV xHnlmvumm--ELqHdҤ}l mN |]HFo{Gyp紞cD*X{WSW=9yp! @{9"ȅUqN[MΤ~λk6ۏf/sّCII RF"t}t*ye^o#4mL*++i۞?X}9O^$$X(&$seݕPT!h a{Ȫ{8=;?xʾ0\ːKg++>8nsPa6p$ J%tQnb+kM5}v{71~Rh9_׬} k}YnoԐk91CsI2%yEIQ{soar}D)6kVĿs oX,U+FZ'TwgƞƢX;xepTXYCSSPYԕXYpO_ܟOVjNJY* R5E[ᔨ--m~s1}&7-VtJ~кYg{^FX 24-Y'FTMv~_rNj>.zڙe U'ݽg6^ShbPLJ4RhJ$"'B$}-*m5<4.bYQM>.VIvrC &ޘZ@EVzl?X*x)릥TDw* $~]X^K?㯁OQ#H /a7yj-x hS* RMh:~gaIُuH A<<=+Q[H%eGDa(PWs{{M]N33 1S$_!fHVC!6e`M6߉_m|UKew$SwI$QEOTK.28\dF!)PɭYqp)GMQ]4hcUЬc A<_0{|ptS??oBqc)"F)^^W-u٨jqu&fH_*erzeGZ`X[[z1@+TtCq9,LްOj^ئų6RsPUf2&,1ST@5yίn='dl3n[ mlW*+:x!Y5%.Oss M)\Jͦ}~x70J25km ."б|ExW&=muY[3"H6_e+U{v*rppۈTy,Ḻ.7?v0j^UYɻPIgJ5L^(tv>6[]s))᪍D/G ߗyۮ-m*X1o2j YOm\YŎSm\di1w\q} WUR2GUŴ6?]ˌ6)*i%na S>&4FrAK>cٿzEdo dB0^ O)1n+lY8vur,AP pc{׵wߛrwgVTo^ݴٌ&گP&'c!aWOVxS뾕\Rx(| "ԴJRhMpzbn\0e1.StݺM*13$uY,KQ=K"_vx e=+P)UIM ^Z+$Z*Ue8_w>^;;x7eiO 2ZӢ}Fm-gݼv[dki#2>Tc=j;~^+m콹aF7V|v/\Q0LoX԰>mn|v[6jp\cGGSE j8j椙*2"~=]lt\M0^@h+V_8$+uRЖ^m!Zq2?7W/ >La?pNG`mvǼVZ*qx8ꕋS*rS#^7C=QejSkJ:S⩢hDP9#/;^3i54If.t8zmsDlO<& 1!*]hw{6mY Xf?54; w4zhtXQ-^;4TuftېKK qUVMP:JVI2y^Xtki*J f7~cc&㮧=8LM4c.֚uE(!-ZBc  2ϼirg5f$ӣ|(hess~XsNnn>uJTf}WOeП06v#+_Hy]:ꗞz),։j1L5ХC5;f{ yvcpbk1pnEU?/>Vpd=n7d,m+9 0]+Jm":ҿ1ZR-]z$SQ]{C %XD6pTL-v}={&0[(3IGOHITF#&OwcS>!xUA}ѵ#R^y^v6ޯ1CKQRG8RI?׋zyr۶KYg\:y$'-hp~/EЛC1v5"k*~e)$le$$HܩlG>MՒR2 Uu?t梛rLuF]R2\b[[YKFҪV+E]Vw&.(Ɓ4C%MA%Nzle$lRөidHEdJx"A)T` vUϴ6;{#Pk2+ƳR#Uc E80,UU^`Ӛ-eK%{[Q<'Dm Аc"ݨ`Б j5** -JtY;mӕ#/&ϊ|,aIaʠ[%$,nd/%3oظlZj6 [ly򽃺(%[SFυTQ()>}\_Z4 VhipgѤgIj(j}L_Gme$"ȭpZ:g`ZȡV*xЃ׻}6ާɸj*MXq8OM<0TO3W :Kay\ƬyeluVr* d0z|u,]G@ t`UpONB$6cmp/%C@,5kEU[cV!>Zl7<ơNT"sՔE"Ao^*GHk7e4/= p zZIl)fTTTƚCjf#8uU7֭M@%LEP%:iM5~f#3I4ϨpScK{TzOt^dfN/i6 )SV``#Ԗf Hb!;{콡a/!ۛ; {{vd2z6mƚAߕY&*g24rOUS4`+CxVy5)Hǣ~}w^Pgzk]d2+DrBX !T#Rjݮvn[)# 2?*E4eBsY'ƍS쏋Xm㒦[C6KgMQvel5wȠ\UR2RIeRG2ht;xڬy=4J$%TCP-NUX@n@3ja!,tȨ[R`Fmk8V? z(%K Oi2;AM'C9ZgH[|d9϶!eiǴ{<:@D~Z߳<ޗܟ}E$s?O H$jtZC(%%6?v[%]O*) EV(IRpzfN#ǫ[F`ջ&X樆#R $uA%ZE>㻝6Hu3Դq'>FVhEz>TtGn[IQ+.\q_I]ڸ줴s6)H8(-5TQVW%sŁuQ֤gzwdh#POp^ci[Q~"w ƽ`n:d\Pp`Rsƚ>3vuj>N|v0eqovUm޹=.2ZvIɝ_ =M*#D9Ҥ"ֵxXm0+p iCZNPw xlIY^(4V/G*@cLrT{ko.۟ڵu/pO鳴(iZx(2NQcV_)b䨨$SxUzzywSGtzTy`_v_vuv4 gJ%(C fpAD] Am`?S6]Yg))1=>$Fncc`;"vn4^Ѡy CI9EԓYq"d,sޙ7[`vk)>;n#DfJxb۰䧊(3UTUGbIw]1Y#C+cqQ4u]NKk OݷqJ!RC dR8#`QV};:-=$ž?",5cԚU^nVF@$nCyT3[i_4'6\X17>`[Fw WSYO l;Knscpx{2Eu!Wo <1f :^: ت%Hry H^:YRUZ  WS$3/p贚@G'Xߏ~E!q?^^ZCǧ81.G2{I n8o#}5_٫IS{ȫ!A,*G$@$6\$^>o u}q0$Akik`GXJXy~#άGLU/,,~=$zJWȻs{?ov2z5=2I{l [X 5o}@q+. 5gTn+60 ~IS .Qor 뽬 d|zL"v$30+IN}/9 ?_뛟uDux$  ?{d$}G7Ͽuu)('[@R k؏=W_ٕ "34tx xj7OPg=R;w`gHLJt/7ÓuNA7#H6Ӧ%Xe*$:bu`B*յؐ]{ߓ8~-@ O?O feMJ?bzdRb_H$T#kܒ \I_Jh$6VP;}F mI<05Ck2wXfFgX'' "~I''=&wgbFjU \:ǵ&6`9 {7+MhW&B=u;91Fmk!*?{Ž_:G)/'S56{ ǮgMZPq|&?0u1P,ZB%oui`A{3T P±] #*Xɷ DzS) /DXd~C҄q'z()WjėҴI GrBQ⷗Ju,rFv ~dqO5[nHx'™劦9,$6WA'>UEf8 BfB[EHp')u%5v!iq/4ooMǨVh3