'ExifII*(12i8-'-'Adobe Photoshop CS5.1 Windows2017:05:08 15:53:070221(s%HH@ICC_PROFILE0ADBEmntrRGB XYZ acspAPPLnone-ADBE cprt2desc0kwtptbkptrTRCgTRCbTRCrXYZgXYZbXYZtextCopyright 1999 Adobe Systems IncorporateddescAdobe RGB (1998)XYZ QXYZ curv3curv3curv3XYZ OXYZ 4,XYZ &1/ Adobe_CMAdobed            {"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?6hN4'_P$ Զ?5NW[4l5Sk[-yKqnߦ1=<,7k,:F91st]_7!.;Ɲw7%kta+Es Zw$A17m'hy7]QyB{^(6sOq[}@"f7 .?]'Uph<ȝ?Jn;L]k~ -ƒ4ݿ3cY鹯it54̶sI*&Z_a}mݠem =$u ulᎩL: v}~Q[lsHMfk vs[uvHCoʐ?24"m޾=};?*ebۓYSӺ1duO۲_I:ccs,1Ę]q☪d;Aߣ[]JnRH(hѡ7mߠٿOnKq[Y`ͅlIR&^ SDΥ}3SƿʭKI%Oo1[lqG tSWOˬ5V\Zmo-mߥŝv&SiQ1~Fҿ֧KE1r)s\𾱚}Fͧwe?2PI{r1͸E6KNs}8K,feVjı[]ʲ=2./'nnF.VV=~Ȯ 7{.@cՋ[37)@pce4w?࿣ GW]Ys\A?GDVLAąGx[v.֋_w>Wu>l6X9S𾏫>*;995jkݱ4 ;k{ZGYc۔@v?Sӷ>ߠF_@YVmޏѡTut9sw79˜Z7 'Pu&[ ]`)/S/e{ýV6|=O߶֮5POi- ZKk/#RjgYv=I2m_n:[Uy8.$ݯ- 1c7PgLv-eenaw;lg^l6=:4ih? ;i+6=[7ٹKcRe5ߤߧL$ɝR@unx\<4#oև콳?-nXvpdoDkcls5S.e^KWSuZcjO~C1}u&m$9}53',RwI̦u/,7MP5:ѓClchf욞ZzWE0JGf[] ťِܗ2cű]]1[#: ߆׾0>f][졻}kNw"̗-s2oǾ_e{k_Dn3hmc2p|zoEMv59E_Mg$Dt9{5Uِ$566n}}镊sr)eX`cǾv6?w+fbS/n=Mg e)7oQ2Muu>UMտGo$,ꏽղsm?" bΦߣ~ځ[M4[m!gQm]}WWMͿuvRmm*Xϥ鯦v3Uv[}YmV3eݑM] }m {ٿkmkP2ڜ= uϧU Xq8-ߎSb_Tmeޅ104cHHOVQ/=4LX{SnTj}Qnem kg+uu7*eV2[#oE&2=i[UX73hc~벿?vcHpc\}F%ۿI~B/|wIonUYc}7L!*\D {M V8hnkkޥO6gۯ-߽ YRG6gskgG18}?WnlCCnKEs #p-*f獬5En՞G;+<m-.m^LYuuMeapkR72GujQ%1k^Һ-vn=k"mw -s"ƹjƭSdSi}uV^u{mguzNe}cl44:o֒gJMڛ;-5Zr&6KeSU m{@`mdߤkCoH#69`^Xnz8Lc?KUUvaYu^.K6Alv]gܴeu0rX=fwpu#W$44MkK51r㵱{ 񬱶 nu%ϡ$u;(9]FVfHs=;ͭ3k*ͥԖånk\߶Ǵި{.e^EehnVT5e{^U?z{??N-kӎ[]m~jw&lkj~B^FE:ݒZkcvWnvEubQ2.ak?uM7kϐc]Y9'j[^lX>k>e$ۏmn\A>͑D2Z+s?7kGe66+mZam:9s=1Q]enд޵eWsӅhc f/ݐ9C+G&5'?uPkqel0Or'&?F;?IeϚC4vv6Kkha6l۹"sn n\o{Xl嶚=P]{o1:!sה09PӴ?{{\ZϘ\C.G6׼h; c`Zk6w-졍C5-9s[X;kαϏUZKX]6׷vX}S escLl7o?hʉu.˳x+ay#A'F E0}bV2m͏ s}oǮ7561i=X"ˎ%f1Ve4le᠖Ƶ־upR\u8/=d6}Z*62IUuBfYeoK[+T-u#辧TKZ$܆vOY^qª=ͦK=8f?v 'Ȁ,;9cZ$Ev6W¬.*\2EX"ظ=:9c@qZC&} ';V[7ku[~{mnЦT6)"P X{}6k^dfSuY*%\N+DZk̷Qn X\I-he@YD~}=~lXUqhuUu~np{]}?@?ʨLJˈ!}/dG۷mOoq5;c|7흟""&~2 ey4#՗K"n" Pݯcksڬ-%ȗKMwVfdY~+!;d[TvQg{+.[a.R[?Wߔ־{Lr9f׎/}@[F<}&DZ?6dE,c[1 5{۱ۘg)/_C[V֗9Cqvͻ닐͵l -֖O.[Ѱ5ZDÛI1rVܿ4)7PY?N%iMfV8m0m nms -WM'`ې\N֘#{~jk2ˌ zO1nSN]׽$NeeHDMSV@$ c-{kOJ_QZºznceu99決zoѲN{UWO])fMw[O~k^=rTkǬW e Ƿk-GѥERNڮrδ]M6uN[S4^m4:Q}KGٍ.w;ٿ"GQvK7 Q]:oYoCdfcѐdQ}X^a[_mVR}#~=ሽ~VHfsc6 }~meU)\u[Ks%i6kW6^>E.>eiscҺ{_K-fY_ZposZmU_DoD}Y 渹?i-.!Yc2.d~l?vD|LbcWSv9ټ>6q(M =_*p>?$,XF}.Us^CdޮJWKW CEBz/ӳҭ?mYS]+綷lvVϣoA5nk]eY\tsN/mމU"Ča wܻ^aī25.6:!s,ѳ?&n2{2e!ϼ1mf?k=tY{*Z{l΢ \^3ֶQ]t$z$ /.ڙE~Uό:KotΕ2exc[^[[A_+;r04`v6kk\.X[NB9j8UcMx]E i7okl<: \ln{kw_J8AjHй3Ue.sJꨘkU7;K {*?VF^hƱ6h5=ӻ{,B^e_UwkkXӵRLNN֡3qn-p,bڭk_8@Ls>M~3qp5WQPe?eL>k&d]^W2s78 ۝Q's-c@l߹N2/ t̠Un˚FX ]uE:gY{u5duuߤn=kťgNm(= $>oETviy-p?Tƹ0zƻdN7qVDG ^m_eqYr[ rZ^&ϴ[nZܛNsSZ׍cZֳg~S}.~F{KY${?}oau nK w[7ٓN~mJF'S6m{G- } -uQk㾧C}k>憱fK?DkޣЛ)m.D LZk^C{ewg v:(;Ԇ;s\} DZ]j[sci2CKZ>wYUݖof~P;-5ƞ1ڵ(_C_ڌT\hsF_oѻ2/ [C#Klk~ibS9umhq퍍)eӸ5G mq;QY i:y5UfvS5PN;=?Z ľ:bd5ŖbZ!=KsO]Z+(;vuO./mfLm{VlY{^Xm=?=X7sK.%iumfE{+cv?16 @Ruz~YLK]kmOs]kkece7ֺ/̚20kљ ,sncǽߦއ~UOð5ɞ!*vYұ)?XPJ6=ZSϪ4l8{~[ews&@ieզ'PuVo5h;U89oWUA2,_KdG4nJ}REŢYlC/]>Se7ްlMѧw }1GF6Pe>TC\8YS7;ѱ1v-Zf47e~Wq2c;1z~O~iYM\XslQ$uʿ0=}PNkȭn(N2>m?Kf9w=! *8k xQG:KO#|2: 2M{x՛UK~CK3Z{^:v-p,7Iz;D@iQ om>QQm\.H];v۷ߘRjg{ZZmrׂIlҭY[_W %{\"njFE1Lg6dT*T1cP]}c6+-l;D+Mm`hԐf?{a,vv$P \޻k(ǫk+4{kmqmuWfA4Qub[G%۝?AW:\6{>h&kt-wv9ޣwrQv?leiC4875ktnKOln>K')VH}ľ]i]8z=z{;~7 ^csзm;,f8dvGOc qu'V-Rv9Ǘ:ǑY *'ݾ V0n<։n[hml Fѩ>{v&=W?32`gGy'KڏkOo-59Ըlԍ?pρ\Ҭ3 HK9۝oYh !؇{}=-1ګIW8gJl(ٗísbRwډJcSm$׷"Ebw3h#tjF Ú}ATE1Fmrܓ؋QLs*cU^KD4/rHNN'",ԝx J/͟Z޼p/Photoshop 3.08BIMZ%GZ%G8BIM%]tn۾9y\8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTDocuColor 242-252-260 PS8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM 8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMO 9781844484645nullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM %{t%s@ICC_PROFILE0ADBEmntrRGB XYZ acspAPPLnone-ADBE cprt2desc0kwtptbkptrTRCgTRCbTRCrXYZgXYZbXYZtextCopyright 1999 Adobe Systems IncorporateddescAdobe RGB (1998)XYZ QXYZ curv3curv3curv3XYZ OXYZ 4,XYZ &1/ Adobe_CMAdobed            {"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?6hN4'_P$ Զ?5NW[4l5Sk[-yKqnߦ1=<,7k,:F91st]_7!.;Ɲw7%kta+Es Zw$A17m'hy7]QyB{^(6sOq[}@"f7 .?]'Uph<ȝ?Jn;L]k~ -ƒ4ݿ3cY鹯it54̶sI*&Z_a}mݠem =$u ulᎩL: v}~Q[lsHMfk vs[uvHCoʐ?24"m޾=};?*ebۓYSӺ1duO۲_I:ccs,1Ę]q☪d;Aߣ[]JnRH(hѡ7mߠٿOnKq[Y`ͅlIR&^ SDΥ}3SƿʭKI%Oo1[lqG tSWOˬ5V\Zmo-mߥŝv&SiQ1~Fҿ֧KE1r)s\𾱚}Fͧwe?2PI{r1͸E6KNs}8K,feVjı[]ʲ=2./'nnF.VV=~Ȯ 7{.@cՋ[37)@pce4w?࿣ GW]Ys\A?GDVLAąGx[v.֋_w>Wu>l6X9S𾏫>*;995jkݱ4 ;k{ZGYc۔@v?Sӷ>ߠF_@YVmޏѡTut9sw79˜Z7 'Pu&[ ]`)/S/e{ýV6|=O߶֮5POi- ZKk/#RjgYv=I2m_n:[Uy8.$ݯ- 1c7PgLv-eenaw;lg^l6=:4ih? ;i+6=[7ٹKcRe5ߤߧL$ɝR@unx\<4#oև콳?-nXvpdoDkcls5S.e^KWSuZcjO~C1}u&m$9}53',RwI̦u/,7MP5:ѓClchf욞ZzWE0JGf[] ťِܗ2cű]]1[#: ߆׾0>f][졻}kNw"̗-s2oǾ_e{k_Dn3hmc2p|zoEMv59E_Mg$Dt9{5Uِ$566n}}镊sr)eX`cǾv6?w+fbS/n=Mg e)7oQ2Muu>UMտGo$,ꏽղsm?" bΦߣ~ځ[M4[m!gQm]}WWMͿuvRmm*Xϥ鯦v3Uv[}YmV3eݑM] }m {ٿkmkP2ڜ= uϧU Xq8-ߎSb_Tmeޅ104cHHOVQ/=4LX{SnTj}Qnem kg+uu7*eV2[#oE&2=i[UX73hc~벿?vcHpc\}F%ۿI~B/|wIonUYc}7L!*\D {M V8hnkkޥO6gۯ-߽ YRG6gskgG18}?WnlCCnKEs #p-*f獬5En՞G;+<m-.m^LYuuMeapkR72GujQ%1k^Һ-vn=k"mw -s"ƹjƭSdSi}uV^u{mguzNe}cl44:o֒gJMڛ;-5Zr&6KeSU m{@`mdߤkCoH#69`^Xnz8Lc?KUUvaYu^.K6Alv]gܴeu0rX=fwpu#W$44MkK51r㵱{ 񬱶 nu%ϡ$u;(9]FVfHs=;ͭ3k*ͥԖånk\߶Ǵި{.e^EehnVT5e{^U?z{??N-kӎ[]m~jw&lkj~B^FE:ݒZkcvWnvEubQ2.ak?uM7kϐc]Y9'j[^lX>k>e$ۏmn\A>͑D2Z+s?7kGe66+mZam:9s=1Q]enд޵eWsӅhc f/ݐ9C+G&5'?uPkqel0Or'&?F;?IeϚC4vv6Kkha6l۹"sn n\o{Xl嶚=P]{o1:!sה09PӴ?{{\ZϘ\C.G6׼h; c`Zk6w-졍C5-9s[X;kαϏUZKX]6׷vX}S escLl7o?hʉu.˳x+ay#A'F E0}bV2m͏ s}oǮ7561i=X"ˎ%f1Ve4le᠖Ƶ־upR\u8/=d6}Z*62IUuBfYeoK[+T-u#辧TKZ$܆vOY^qª=ͦK=8f?v 'Ȁ,;9cZ$Ev6W¬.*\2EX"ظ=:9c@qZC&} ';V[7ku[~{mnЦT6)"P X{}6k^dfSuY*%\N+DZk̷Qn X\I-he@YD~}=~lXUqhuUu~np{]}?@?ʨLJˈ!}/dG۷mOoq5;c|7흟""&~2 ey4#՗K"n" Pݯcksڬ-%ȗKMwVfdY~+!;d[TvQg{+.[a.R[?Wߔ־{Lr9f׎/}@[F<}&DZ?6dE,c[1 5{۱ۘg)/_C[V֗9Cqvͻ닐͵l -֖O.[Ѱ5ZDÛI1rVܿ4)7PY?N%iMfV8m0m nms -WM'`ې\N֘#{~jk2ˌ zO1nSN]׽$NeeHDMSV@$ c-{kOJ_QZºznceu99決zoѲN{UWO])fMw[O~k^=rTkǬW e Ƿk-GѥERNڮrδ]M6uN[S4^m4:Q}KGٍ.w;ٿ"GQvK7 Q]:oYoCdfcѐdQ}X^a[_mVR}#~=ሽ~VHfsc6 }~meU)\u[Ks%i6kW6^>E.>eiscҺ{_K-fY_ZposZmU_DoD}Y 渹?i-.!Yc2.d~l?vD|LbcWSv9ټ>6q(M =_*p>?$,XF}.Us^CdޮJWKW CEBz/ӳҭ?mYS]+綷lvVϣoA5nk]eY\tsN/mމU"Ča wܻ^aī25.6:!s,ѳ?&n2{2e!ϼ1mf?k=tY{*Z{l΢ \^3ֶQ]t$z$ /.ڙE~Uό:KotΕ2exc[^[[A_+;r04`v6kk\.X[NB9j8UcMx]E i7okl<: \ln{kw_J8AjHй3Ue.sJꨘkU7;K {*?VF^hƱ6h5=ӻ{,B^e_UwkkXӵRLNN֡3qn-p,bڭk_8@Ls>M~3qp5WQPe?eL>k&d]^W2s78 ۝Q's-c@l߹N2/ t̠Un˚FX ]uE:gY{u5duuߤn=kťgNm(= $>oETviy-p?Tƹ0zƻdN7qVDG ^m_eqYr[ rZ^&ϴ[nZܛNsSZ׍cZֳg~S}.~F{KY${?}oau nK w[7ٓN~mJF'S6m{G- } -uQk㾧C}k>憱fK?DkޣЛ)m.D LZk^C{ewg v:(;Ԇ;s\} DZ]j[sci2CKZ>wYUݖof~P;-5ƞ1ڵ(_C_ڌT\hsF_oѻ2/ [C#Klk~ibS9umhq퍍)eӸ5G mq;QY i:y5UfvS5PN;=?Z ľ:bd5ŖbZ!=KsO]Z+(;vuO./mfLm{VlY{^Xm=?=X7sK.%iumfE{+cv?16 @Ruz~YLK]kmOs]kkece7ֺ/̚20kљ ,sncǽߦއ~UOð5ɞ!*vYұ)?XPJ6=ZSϪ4l8{~[ews&@ieզ'PuVo5h;U89oWUA2,_KdG4nJ}REŢYlC/]>Se7ްlMѧw }1GF6Pe>TC\8YS7;ѱ1v-Zf47e~Wq2c;1z~O~iYM\XslQ$uʿ0=}PNkȭn(N2>m?Kf9w=! *8k xQG:KO#|2: 2M{x՛UK~CK3Z{^:v-p,7Iz;D@iQ om>QQm\.H];v۷ߘRjg{ZZmrׂIlҭY[_W %{\"njFE1Lg6dT*T1cP]}c6+-l;D+Mm`hԐf?{a,vv$P \޻k(ǫk+4{kmqmuWfA4Qub[G%۝?AW:\6{>h&kt-wv9ޣwrQv?leiC4875ktnKOln>K')VH}ľ]i]8z=z{;~7 ^csзm;,f8dvGOc qu'V-Rv9Ǘ:ǑY *'ݾ V0n<։n[hml Fѩ>{v&=W?32`gGy'KڏkOo-59Ըlԍ?pρ\Ҭ3 HK9۝oYh !؇{}=-1ګIW8gJl(ٗísbRwډJcSm$׷"Ebw3h#tjF Ú}ATE1Fmrܓ؋QLs*cU^KD4/rHNN'",ԝx J/͟Z޼p8BIM!YAdobe PhotoshopAdobe Photoshop CS5.18BIMmaniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlongBFStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslongBLCntlong8BIMRoll8BIMmfri8BIMAhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$}yЫnf~?ryR]$ xÖbO$(Du 9Ѕxm6ڔ~HG $EyDڈ7mAI_*2]KQQu,44>,F\FD"VPY|K=R"C-6و{N [/͸tuܞ=66S<⒢ı\/{\ǬL_booP _ȿ~}S!U: aƟן QӘA" 67Oܯ9Ry!t`X\zP[q#t>ҥܖ[`I)POmM r3JusNe, k(PyQʫϏSiP)C {n)XơnT_X:c%X6ֺYA !Tȸ}?F GLRpTeRC0ÂO?^O?_ͽVT&Kj:>6UnGB֍F:ӫarl$!U#OۍuR:ԹХa{Tj0H, 7G^2LӦ] N,[5Zs7.5[Q.}> Ԝf,]) A?{.%Q#)~57Q"@cWUVVxIRPBp#_ߔ+,kk JG"kRe>4dzd1$_Jٍ\ّt9+څ#~=tk{69KǙ eߤ kC>zO^3b}D!SfRlxĪ,΋3G?ǻ˶??ډB^C}~9$dUBP M먖Af?P?_TevqciԱ1 X76]niUl؎k _{qaooGzQ݉+*>}&A<èǠP\QLM >ڹx!?o%9PY-IB7{3dh*Z.=]T j$a܅pW0 H?qc j1־Σ\i/K}>>R7؇Y~~}@ׯOjg !+ Mn?| ځ ξ@P9G^ cث0?O$+ʤN*8T{^BGYYrG<|RI.=,jg+}-Mt->7l£I?jF:<9# qRN[>AI:z^5q;;P5Qa1]n^*A볥H&un Ip-#=Ů=J_nZMeK / =HuFzIk *4/ʽ'Oϼ_Je`?o>.Wũd<(?J_A@BKԫ}'Q4pn?3+33ޠ1K0=1Vs^r P5܏xլ$"@_#Y*Xrx}#*tYddH*7>:GI狎~}bTeWSpU.K/hǥ2 EKA,}?AAX i]j:olϭ$Pu9TAkkioyZF?pWFWGQG_?^Y /kA,}a6qOzG~RpRM<څ+k>JTʤm6:]I [WT?\˱l X2$zI*fE؏n=vpk >lHo?>B'R0{bi"Oi_Kj^!ծ2mbO@#?#V-}K<Io$C*֣,D-f_Ņ%рj$P=Dzu\^ۿKW; ~I{[Ͼ??=%ߋkr=#1?o_Gkm7U8xcVWqptŇ?_OkNf̦<1{Z>wЪS=f) `fR[C/O6؟{f\>^l(W]rk>>W,N @y6 Hb+ D6OЂy 8uSV5uJIƱ?EϼP:4TIoa]&o?[Y8_>ROXM>O-{ƾS"7XGfЬnI_ fmOWοϬn, BA=s`MMA nuV\y[j  ߏߋд̗QX`@ڍ;W:9?o\+ %׸?$ER8B,T&{mۉkY]1O^PKZu]''C%UlEnԞ52*A 477>#FcY@cmӦY=z靴$I rM}/ M$+016U{=JY~/=KiPtJ^[[}UT zN@"W&7[m ۟#ӡQݢay OAstvD׿ $}>ېC_]:χd @`Aaoa}VkH Ǔ&+oEo9O| d!7 ˥ɹ qO&f1ڎ+ ְo$$#ɲKFߏ΀O ҡ}:rAem$)ZH 9 ^꧑s}IӫպhSͿJA"/;UJ$6{Rs֙ ]vX\Dq_׾up&oy]@XPy [b4bqʼnb Gϭ2}tZ׶o}( THkk@Ib_A[I^noΠ xߟ|FD0I.ե*Tmڙ_N½{HfWbuiO?%eqMluЪI dׁ\C\%B, cnO]O5o?_u}r6QkX^刺RF@d_6duA8kcb8P6f@QƆA ZuWgEgTk[Ol>CuBAp:G}=3ռ z@.-Cn#*\Gr,Xj<c[u+u9 !M\s`Y[B}@6876_MTE?^G"$j34zbcI]GDDXX߁o~Z:ɤ+3{+gۓHi?MX4I< p}8̍>O]To\8U||m)vT2&R4ߑ( BhJ֔m瞒5U5ZE#VuG+? *X"UPUAOPj7A"J55ND3-4I 348b[~ frS5ZK\M%\S9ޞx]I_O3z٢ڪ'(2Bq!$k-ON}^W+vXZ)qU(2K9zG\/6}>H{?ǏL#'QnӉe';"<50 zAL$P.=^&EDTI4=4E@˫I~ooliV5>]>(WXHYυ=KDi M&y _#"L${&A5PS0I-~^7S [k͆>͍ ^6O5/a7K'5,ZJBQEhT_RP/`\b z|2Ze 5X:hT\5=;"Dji ȃOpkEUr1h#ҹzZmfqu`Hѻ҂xK׽>vжѫQQS\q”%y^h®&rdg&PL$o6xHOYXM_?[[n+#顗=4۷ /îqpbk{m8 v")fWDj)-4,ir -r4ϥvr~'qSIJe)EIap}Dl~R=ܛovUW䧣թ.5VSQW1`O8TuB+{0/,?^#M^:d쭷.ڕtt/[K$j4$MkҦ/%<vj槥o?-Dh)>j25P4H%$_S?Uz =F7# [ G^wkUzW2 SQd,,UUO,'ySx2;}7˚䧯"kehxcd@F 7_;Y0.b4jkZ?`"tzªf3E>6pMOӠ n gn9_*_Wn ݛܘLJ?%%F?g8ڥ$z'[G wVns{u~LuT}X: Йii1B *$.:,T*'zKXSAaQˉlKڸm;~M;]28f5$\j^Gv2t*櫩%_M mULغ9lIT u4*!GYtLJi,zQa{AiӸ@V1TDd {>>~^8==LbrA~բZIl^$-4}1J!C`e_w%E06=ޘ&m @t]`٥A):~F M3v~m-8X%nzG@^ZdI$~ V~oޛ-a,ՌTnHC+ Ag߸aY)9ᒳ#^iE:I&C~-~z϶AN_:|-'4Fz5Iq8]0M qki&At@ZUbw][+mCUObb>RGz׏-bIegʈ.+fJ(>t_i%8!Q!!h8*S^y'y띱*ݕnV*_Fs!=&=ew{G 5%2}1ؘI3Q}[6 WM:lf5(jJ5ȱ>ַ͹^&t«=+)/ J9zRl OvFz7xljCKYCeSi՞fO"=4䄰fKWԘ\ۙn3qTSTg'mh9HsSjvtMq#|">=jKTSC9t|bznRI,v˕WS4ZrV p`K{nL^OmA͵6ȘHT.2)Cp$XA \?W];[/0ڤT_Zv5čS_|@tT[)p#媚%WkdyYːt{G;n]sLS4Q8ww*ExbC݉sc>k#*,]IeP+EB!^V\>yzpWW,[`5r bYmnzݳo=ᢞlV(y裐}kRы6]F@SOLV[Ѯ.0iJ~/^Y[KTc񬖱<"{8]iqq%Hh6V ܹ I ʔrNJlt] be'&x@~mI4TnHVHZV$wkF=O?v]} ɲIzPQ 1jkoS7=ԒmNk2=Lq} UOiJ$ݣgŀ pďZh9*Fʫ<)9elX-2ƭTz!yݙQ,}.8.L^ ov8 kXjd'eW(t!\GdCFxo}5 0h@U?S/w,y}ֹuȪŜܔx!]NSGu:B{&YV#[[5-MFNU4tZeyr5iaP1bDA$_ܭFՓL:ʩt4'U?Վb!܂H[QPWDD$Mb"mFAA?5k3H{U?oƊ\2r)CސBEE@,GՍד`@{gوWMZ9ৣJwfZT":*6vRduu>D.k]kælV3 ~c׮H⯫l935}U^yɎU@rUZް)_鹭j;.<}HWme;/߯/]x׿=Z5x$jj>/֟/鏣>T__M\}$kZ~ uzoЫOJ9wVd; ,G oZiLuزҤjk'/)!{8%~Ǒs36)#i[XW6=6hNRč,YK+6I늲RZ5E~ {Uee(,x $cTu _|XA?X@B5xTI$1m3W׮3݊c/gReb*ۏǽ)aEpHA۟yʖI̚bF.F>>鮹M'?UNX0`.Eo۠5Ԝ?X,r ܋2(7$Q $޿}{^)?M}"_`"hU:ܐ!oo?U^?.fKb!"ߋ{{C?t vzqkNH!]65Y?C,-U$i`IR>[nA ZÃןZ-rP͇?r>{tp0Icc[Ͻ~?2ܕ:е?{X%K(7i`?_Q,X5&?pYXԩ6RWn@_͹*hz߬L !&j% A?}Y5 S3܏A}P#Q)oPF= { Gޫ#2=k>_I*AT ?x9WT:L]f. 6:x_#Qu I1(Ktl~}GxNLں( .ȭ2BI-?N{!<J\ԡq}?^?=vLZCIR [[]HR줣l _ǽ j5u"QRdE"2@5{?N֔kC Xp59T?#ˮ+_Q<"6@SC38K<Ih#=c'~uSNo=e$#!E:e"Ylc_X L_" 'j_잨*?Y|`\ޟB mT,x݊VOl/vՇrҎ 夷E?9Yy)6`>[I2GFqi֋>pH4h@+u*GOAϾLz&-hd1's=CH[߄^C "H]6n~_|kd (-s{~>c0. G!BAO?-nIDԿBSK{S6 rY4?p??&b3M CgϬLRj_Q,!n?=Y"{7<]nܛ)'44 IT qG']i8<)W(Jw:'c>՜qƱPC~׷6^"x` R10V:MĶnGf/ï1>6rn\YL`]VOdF[I NuOhQ)(??N~gg@IЏSЀpC0.ߓtH<-/.`SR.^;!X r.9 PzUq}\ ?^?{J%oW|FQǠR.*GS?ƱǮojW^>}8qq'sC5O]4+`4C0o}ұV*ʐT+Gc+re+?SHzHn ?Y%fbeōp [n}L$\+R@57~=LJ%2?@ Nzo #HC^-u sf t@Ў x{p"_>U*,t\6${2) #,mQn>izRfO^i~ehI.EhdDTXM }nxS*úpk'\:] `A׎QTp\5'm:yz~ ONskKH MɸO(Bڼr1bzH e #Cqʾ PơSHK(-֠E>[{}Y.W96C*#qnE? HQu۟BZ6uzv!R[/{;[ۮCGK5}n>|eB##zjMH?~}?~޸H&Kcg؆f7:m韇9u EҢx.M}@~-?<oуi׏_?V5Bap7y&~BXx$`JUߟFc?^u(~TN<}K!\6["_ݿ?ի13@ {/{MoxG<1bPٔ7Լ_}'apV?0]?:̬%ʫk] ߝL,?^+Ri:x)Ꚉ} *p~C{,awԊtk~7{g?7<d* lp9o/:jU#B t}Gf,UzK<TJ H_oVAuխ3ΎO.O,F{)Rb_WBA<)e6<Mۊ íE_SX"_MZE}}V(0(g+_MjXpիOHWX,Z5gBCI PV@rE'{Cê; îvР_W5 W:$P_H>:E6 H6 rrokn?{Ҡ=UbZa^2*bdm14nTI}7!usp.?A?S-hP}to/7X޾ε-(dmPm~ſ}(LfRu ,>Oߺ]kGא,o?O}:G(:5{?{4lxu, A` ?'_JcȊ!hH}O_ߘ5nzu[O$ٙw?0#MީCB1uZI OҲfVQvSo\l~CojD__?zn΁ t} H~ZODZ_Qw2䖮 .{&̈N2F7:Cplb)n_<LBvcKwbvfTﭙNqC6AO[:d[ _"GpCL6[Z9[dJQa~ !~j],2E iVG] xP(E%|qx'i*GIU 6@ʮݑ+=48g_~5 d̚j+{S?;'K 4B>.M+qҕ)7 Ǡ[GȽ.ka2,M%Jqr54M }{/K%f618#UO_)$"H`cRG ܮ4G?Z ׉{iK6qK=ECL$r1/Z=-bOvaC!(jBR:YԲKH{4M H>?|E _~@5EVganN91ճ$'dFg *H+sfb5P,K_?\\}e8z hteǓ6Zj)<5|H-{E6}=)MS3qu$35h^r?װ=C?}u)?j(͚B#$5X'"dhv>-{}c%_p_S! 61dE'51{,wײ^R/oO?3iB0գ?/1럳8AiR4Ԇ4YJKKem,rD줢)sy LȤ5^*괟g10(4LЬ7V8SǫF"xgJ ZhrVA+]`j>¾1Dieq,V):\*ɱ nK+Pn]lj竢C\يGY1uh!z)$T'uH먖UҤ 4\pP I4`cU(V5dhjcImO8]&2M> 3ټVK+jhYv. 2RTkw+JR ,0 55.~~yWof)OCN )"XЖ@.6Hٹݚwa*aRQٷ)6eENuRl65O6Z) Qv>T{"{F#Xr82YHLMHЭ6wk#2j4Ji$y&2{ I4jՈSU#?kN w5(4Fqch80&AV V OQ73&ӷP }5{nbdz7o3QYl:BVe I6ynx 3Sv&uzQ-N~$nUOHQnWvұ%coZFcdSӡʶ,}¶ej;"mrc]&}_ߌ{o-[c1c-DO,25sC"xM<(tX{rDkH]ib)]T 9_=:ʟ!1[#f^8jLIGS:,Vp!5f)VMq3TSUo)Fy{pfjMpR3ׯVO|Ёgq?N?wxHLi1(fXQ^aWr~Tm쌻{sm(YU.E6^(jgJ ȖʗEJm7 BK88Ǘw,C$tП]$gsŗ Vn͹"5-E<OW4+Zd lٺȱ2reoSS%CP8 䑵R(cFѭNQ~ތ 46$I&v RA] A*pgX*ژ7Ӑ.Pg; S66_5wLTG0K$B RXXCpJ3fb>¾^'W" ) *xl jjj'Ŵj391t&ZY-!sm!5_@jzAtUc:mV(i1fz(SAU}IIcQC㤣[DiirRSPU>cjT Yb$WPY/,$}FXOL{ɯ]qfB@}.Sc6,aqjLvS؜fS$" M%E-kŦ -(Wu Z椚.?a5ӨSW#D ϒ9 >+ۗEIH85uCX$a /1pO8#AW*Y4F4O6 _l⅞O%cƜc- TI$S]:_5cP50SE荘r&.qÃ덻U6gQmmMly̽ *Pܱ̄n6a**KӧPURJ$Wѱ7.>w}\vQ+EN  7:y|cЀjLÍݙMAJ*쏓悒}tuzS+٥kG -5'j)|5 rR|Z#5GqIR8զ("y k`.E-o1=y./J9 B/ o2S39]JI@MӴ. dBE_JeoSWHGmdMi1J6Z'8ncr4qeF|X&O#5=E]$1 aKiC h$1[ۅܖ.KZ9p>i1RS@uEQE~ ՏO>1t͇&yL`t8RRIh͝zr(DH!]!Kc<+GzN1u=sS8a 6k) $we-0$l<8po,Q;ڼ1Z^yn/OXRDIeO鼄 r= TkAo|ٽ{vO+LK(j_hrRT\[=g u)/(\ʸ,wy:~!kAOEpÒٌ}.WqefZcxz9ҍWgs=Ioɾ;II2TUR9D6G=T*te^{Dv_6oofJêM>Wo)q*~@Jm]*B*S)ZZ :81#TTF*504qm#HU"4,B ]6]l Սʼ)'-"ʆh-vF %>%>%lx1/N?Q3$WȒ+_Ax9`n'm܃=6<.뫩5J`̷SFV54jhyh:*}Pj #GY+> I`^P/I`!YI]Icqy4z6::*t8)ª#'@S}K3}d1#o *\I]O(pP"ݸ VvBP.^UW3G䊟:fy-`zdEk+XE' ~P>Ffa(Ӗ9r"񞤩]R q!C:Id- jvFTY$/^ȴ 奤wDQJ+&ժFcI(>,=DmHNCpRMWV؉L,7bBݽe/&jP}]`(F?o؏ IU|@pTj] AN0^}EPt>gh`9c'=VOP9(o()Z5ΩupsKdqP?.Po"c*Q4uGˍxc-X9 \э $GU Km guNZlk"=A ˝ONITT,qd,v:HZZOौG@$X́r576s_ly-)3dCG#mGx*w|R EuP&Wkp>|an2*1SW_@FϟN1H"HB'<} Sit折ª Hc;5ADw"?/[{LT)Cv2+J*xJ$(oΕh!Onyεϯ  mLʪYUPY $.Sa:b|VW>)M= DYU <8{5A:ttSw7Z"i^\i7>AhG=>Ǵ^|zӏoaѣY)Ÿ>u;>C_ok_|M:xѬ3F + b5eFo_vVԶ -{=OUU@[JqJ}v,8ň5y'wkI؂ ^>Qz7Wf!@F?C^{h匛:m&Eo}.BAoпpn$#ZӮ87 qm0܄[3pO’q|]dP@iEv >}Pj[)!_RA:_pxHX%TW@ZiQ[RGv6s{nT8]#Z qsvzn^:&=Dǎyh*YՕ傒Ery"׷ޅA'˯P끐[^Ǜ񽿯TPIk[ <UsîR*U؆-s{to^,ױ:5+( mȹ<ߓ ּ5Ů@թMOnQ?l.׸P?>M_uVL]ݵzFQ?(4Tvoђ|J|Y붉4moN^5Bxawm n8S: mPP!F1jI5*,k%riUuԴ=d+}FG)tm}aeTHpu4$Azr#}tu%hܛ{_}233y_V?g!ɱ7pxnxl8S}0?=q?$KiA[}b쒴\U@ĒB[HchX Eu[Y1}Qſ~cȕʺXKVZZpdP&·:Nif2dZ4>~c%%o dg?5LtuU7}QWZ/{oYae% 'X:׍7Kp"G bc`l_|S dǨK)?PqׄWM : DـV'J,f\>e$}Ʋͅѕxjn ?B+.!pܑeNʝdC(ӡVv؂HI2JT_k;؍$(cՎ?D׮iRWوOri$O -׭H qk_W~^L|%>]\nybE>${cbUsnoRl3>=[_I ?OxFd.n o~-*ċ)ҷ*=%:IwEӟx" T!Pqby9`OU$vuȲV`k]Yncqϼ&O! -Ƕ&:P7$w2FŴR0~j) mhQb~r2nScE.6xFrtY:RTROTN8>io?QP7n.G$Z# ǶJIVbw JEʏHK^j [?>52Q"䎕$ʬjH,x[uv }z\?.X5:ɖⱠ).Yu}RBZ@#$GW#o <׾ł]Ȳ [bMxӇj$`Qt5}C{s_lXKC1F/{O^-G[GˬkC"8{ԑԞB#Tmɽ۩,hCǧBq&`Ic"rډ6׿u᥸yI~7?O.ѷ-`n줆פ>-y^@RĐtmPBxrKXXpo/ϻ!1SOz::ԅt$_yO}n#4dG {uW/nES,$}~6>IትZ ~=n/ 8@m_ K{_"ſo%0qǧb-pG#GK](7kG'21Pu9]H466}y=^N=pu@ TXX0B=+9ֿԋO~η'8׮%uɰ'64DH IF'Ismk5s5?wM,0^S}?xF3uդPy?A6P\Aڎ:l]!<ß~e*PO7@Ϸ|yר??uB:Q/sc~R=f?xuN_| M`^r yX$4(^\0A?An@\|6^Wm{)_3 ,M}d'NIso PrPƯ0盩!O H#8]Q4YC&xeS2NZ6m}@ VKJ֢?$uI oō}?_y#YBV<ۆc`xzbheV/ЍRP!EMKS@$:1ƒE:Y.ێo׿(Z=t޶+Zf(*V̎R}W{B@I$3XN`n[G-$r.CUX,fGtDH/5Ic&1=T "%ȸ**9@o{S*eFȵ9dbBɸ#󮓤=mZ %=\$CDiDnJAF=@z:C b$.XAskpx)$ Ȏ@CR@=F((tHփGEGoYprܓnmk?VnlD*:ZI# FRꊎh%J#3K!Q@G -`yƅI-֪wU'zwe)!i2 "K' 7'x脋MSq`Wu/M:ǤDlTʇ<t&mgG 4YySN9'B#&,,4(Ȫlh iI=MX$¨> ŮlmZb4VztPz}O "NYēK(_j|՚ʫA+I*_3-!Jh:bnXx!?9zLeo?Q~Y GUFsEKEg&5$dB6WɕQP̭5\R2TRU?VͧHn5*nYjw|'[YOUyZ޳ݫ?xmz.?|4MVF53Z@l3y)GS tp,V$ {BӬMKICI5Eo!;M:t >2k{3 rHrxla%Aym##G" m0O Y"S_ 1\#r`.}}SXyѦ I.r`9P'%Zi%S <{I{JTj)á O,qO$O!caV("]W>oȹ,\q2SUc#2S5.0!7d]Zf|:eOH˶svz#&㞯T*s8hORe_hwTO↞RˎiZ|F=3B@d`  3w*ǀ1XCG:ˠeOi*)k0WTYHZI1igÎ"|W?xx큎~έҬآٴ67e"l03ǹUcס%" kãyrTjiS!dfx7}u/׃p Ǻ톱6߽O]O_2QAME:JyMm䮠_z/U|(~΄R+q{ILk -!?ϏΟCK%EKv\٢O˨KTvf̊;& .^ K x}*h63 V(TMsѬO$4,3YlkIGr!>zr~W>srRu,Aӆ,GUewWOSz+j3u3{#+%1 ]g27%c~{14JYxq&2Jj9#էLdK@4?:17顩j0?iըR5e cUMO;Af0YJB~GqVUTc*Ϟ@ܸtZ-=,]Wp=w-m.U|*WL+E3GӠI['aE=ec+RԵu5Dq?΁'I>j%ٻ/iI9&:?\|PU$u!A/q jjVc_|c( XϦr>}бG0Idp@dE%1H5}Uٷ5݁ߡǽ)/ga/QQO3-fi5atoRUd%e /=7;UBN)]>D~̌a޻kvK[4qE?e^5BP 0]Q+zrcyv܍QU9z͉mSJAE>}zۂ)bnfi`T3*Đ}nhuAQTNO 竪m4$z?=/?dS¥gjQXLWvI I'oӏf'!5Gw#!Sas ]Nڲ#fU*#bmR+^[&|c|:Lu Q4:mI=떟{|[.Qu\TIVwbʧ줇?HB;zKh'cj:\f*D]AW_AF:,Q됄@Ru_=BEzuyXOq8W OZйu';{KO^tݝOT-63Wk2XI5i.M5 FjW|~")Zl^ExĴNcybEWӪ˅OWom:"@` '"<?>{껯 znqԳۛ-8eWVƲ! u:ڵv/omlF,bݝXG`C|VwP`zhxQH2@ϞO͙ܘ E=;Sɑ/m)Sɽ2IIN(MU9(%|j#6'_Sd 53ƺis}=21<4=%BT./K؀[=WV?:δ-vHc>JYLfߨn̐RScqP+1j*o#2UL#5cH(r9((8JMSG=^BEdjZxFE]1KZ<2KdH'}zYq,nGJi?zF"= [R~!,+SH`c N&E-WjVݭDEЭ $%?i_U  e3;?v6Z=vJj`p@?z QSS5nf$i`7HwMX1p'^M>CM988 GFM~tA7J]ӿo|j3rxXu1TLVO9U_) )2I !>6LSE'V4%1R<0m6Q%Uo 4fВ)RhRiIV3ǥ` 1X/=[3ț{*cK$%r>( [RG!HP}vo]ޭ~ZX衤N>A}~ sD^:qf"=GI/sg.O> (fT8%UHLʠHL̞5qru[q*q¡(qQOFH Uv (n72LpUߓAkIVd%pu?Oyq?AK6wNSQ@IJic#V!9- K6CK\Xa$=ƣ7oZXGZc2ϨOi%TGP}a Ī'3RgYR+`NGg4MIJ 8'ܤqZi5Ə# OشxjZ.˵Hݕ1wL@i*M DK*R{'Ƹlq^Gtj9c_(_1Ǭ`}ΖVJtC20tc20 <dbXHjCXRHjiΨV!%9>KǡW_CrϕN?OoNۼo)|w[/ի{{{I]X_|C/g^Ҭ@h+ t׃}Mؑsu,}9{5jl:-c+7$BI6_z}c5 j!i`-s +'u $j:d0opJvtӷrb9Q#MAo~$n 6g]<^Ǐ]py4"!I7~~{俾BY#u#oͿ?u*]0Y@YG~Tc)3tԆ@jn~MT_[0Ry'߆ " t/9WWǬt ~SO7l]7Fս"^[vV[ػs|z(6ḻ`wN(IޡKg7ެҚ++FڲkuF;X?*ٜ~lC:o=ۛoٓmKY(WsxyxBg"bqjagpwή/GumuPSdTX!#I#4Ȥ"PK-!QiH=&\ 9Kso"c38 K#p y EmO r3w9]I-GKCCUb1)3e(`Jjp T$̠;?3gǽպ;gO_v$y!NQ$i"W{~~W3JJS 5HwUTK{\-pV4 Nz|w.ZkS^g]Ѳ4Ɋ*lsp6b%YYrd+ːȿ?=ۭQkoy'8#!&Hr/v){ܓpl: :mm>qq@ :_..mǽ4)ӽEiOQMkEn}^VT~E[xh_NӮ$-ۤ2PDzPtycqOZVt>'l{ʤm `/17 yo~^ :{\؁߾TQ)f,ѐd-rp~ {ZjSxz܀P,B\#]?̯" UI{_ts&76ج5 [B%0fs[rz<>er$c;h&>Tjjh^”WE*GM#15~Ȁ0* Ut\%J+i  ?wA7m{cmnn۲c|j~)*4AbCMzz ݯϖTs9f:|]gjru HESgx7 yպ\o#8AIY ."րR\Nox[ѫPGpC)4~g_7Ϗs|8Z.체u+-l>L$HBI*1;z ̚BH#qb9 (5Qq??Ksʋҋ{[:u)[Z„&]k WITCpE[Um7RPXbZoUutdcW[$م@$͏[~=澙 o!ԊRŀT~I}ԒWx/j&EͮG6*cui#CJFS$4|7ЭWVue"OǾHYWK,HkPX@ $muepJHEP/GA{Kt }:]*KʌӥmREV׏$UMԡlM^}P?qɱp?؟,ѐ\MXnq~}X-?VFH 0AC܋{r?>VCO{o5\'mS5|:G7{s6m,]'X` }mqAQ3t~ |4r5E42I `A CfaI]41̐}A>E[${.3ө_HL9Wg=pt8*&JyUI*fCL%*cgy2ISSA dVCFSЭ@3-DȮKԚAP A~~~~}'W qӍt5A\keޚx&Ih-NT𺳢"$}||X7iAq콽1nO!|`zlt/8Vk9ZPN|*D:cOԸ.Cş"4Q`{[yUrTП3ong^sF[=e"p!PӴ=*.7yXB* J2jpSٙG}켹YmQm6{H`u${lYlMVo:tv.tL`'CF4E14jUi)8liCY3(]$YBUP=F_hHkbWG$'l?4K\ B WΟwf%j,' يTM>'TzY8Y+sx?XW[,ɱԠ+ĠX}o<Wd3=sٲ/q/9f9<nhdhiG LTw+;7ߴLiq$zUUQ554'$^2󣢈T9V jǻQSSvC%8Ůட6GjQ^CxLTU2WϵYl&ݛ%EIVqTܻ1IM'=2y#3Ʒ«ߋ;p|njl^zb8m,uE&)OGn`^_#F{IicyTԒjyYڕӥ@#psѶ۟+\RCj6F1=~1}ϋ뿐x_YfcxmgЦEUTpWcr\~y Jᱵێ,grSxzlټѴQIPaXXpqEmuP,nEl,}5;OE+ˡksj:=MJ_c˅-_SRbqdrPˡ 14DwUX.YհZ<&sb`pul+mLOgyV ] Zy)LY3Su\WV__,P#\ȪǧL`-Q<Xw~نڱj\D>Z*=}zϺkG=_梡SGb*T+x]:%DJ)FRFRaȯ"22]p/o6 {“C@VM=] k" (T+boZ;>bu',nYL6䛭fccvm]y|m5MZ,zGE[b X,r=m\?ܢ2]I$Þh{P XSAe`=7<[r66k38MMMC-BC7,2G42"sufX@V3pۯQ_V%#hMxA"rbgԔ8MxpR sl7VfP&wW X+z#oc% KՆn)6nWnlIAY- dRJCC8T&۽XZLJnReW.uxaXPAA&n~cݬ_(^ 1u8 ,?p$@k{;Swˏ꽑\}ۏ:=$T,0V*EȚ$X[Rf͸6*ۻ;h&Lz3,Q2•<8 ԦFIRX?6]#6^9VbWi]_ĢMߕG8"P`UBc{hhD)x@IR~R6YE ֺ4)M,sR)A ? =õjfSuO_RbX$PJK,Flu7wyeKwFmޕ{zL=2`2;o@52SЕH?_bo[Hw &1)`EA`# SO9g-.쭣DghڌT!C6Ӣ1rN';Oq~[j:6rrm̛2,uFH`s 8Udq|b2۽kۣ=֫vhzLe6q5utPR=MD!p1sVhJBW=ծncA9dP餫(Ăl5 Vgk;{vح׶%}%j,N)#a)S%-=G-2T5SGS t$rq4SRqZĶv<Hcx>}?=:WV=ʴoie=8t+;d)2؜<5x̆2eκ2CE͓;v쮹^mŏٛ3RTfrQS5~Fhz<ҟ>K':+?gXrF7Ȇ4q:S$)(fZ X8#wT= CYm^꼢 ;ƃ37}a'EpPupJ [ӽumtej t-닊,a'[exB +Fk]-4RNYJEAtS^VnSq,]CS嶟W0i>lotrDRCGE=3j!'ptfv&|}>ƥ9%yb3f3{srl]h~H /"S9Ru| Jt`O S",Ts7+V7[KSI!+8Pp@mJHA{w ?5L~A6VD&7p߆cdE gI:!S@ⶍvZlOkw .beno)*2z9{y;yy-%ݠ"{Kt++e948t_\r(@Q:04ʒNA7BN/}ùz?nE 2XvoԻb%Hjuyºk-כ}n*-vȅ{*a%S-:{30k߭z nsE[f(iV%:G৘>G/g#ZYhq4fsh+ 3Eh2E5RMS4Jѳw|E>]AU#,2rsvO $ -~N\`uj:dqWGЌ'G-r_5fl -OBQ Bi* +[btU9]):,U/*dݛ;OWP*$EXg1<KCU^nٻpniWev6S{BXko*)(2X^B*7rw()}L[8HjZPN:0y&mx,Y;~ Y c~!F9]~*bĬR?_ٌ2rG.r̐#yxVB kZ~Av̭ RǗH푏eryMܛڛ7[k%XnɮjhWv)1 U1*(dq%״ۣ+Ϊ  * {_̳o[ͭ3 }2+*uV*8Ѝ e>lm(w`dRbsY*\ntcj奫X4VS4--LQ@E|L=pbOKEp_aFA?OMdӤ19C1ˠ^e[6f𘯈R>5o5Mq)_9IM𙨖).M6J+%S9)ki1^jk*" ?vAQD[j!@wLJM,T ӭ|jYjIMGKO4u5tԔ)yf fOvK^>>lڸ_+]YjFulQHieܛY`$2AFxj*FA"켇},snI*h)Ŝ.ձ[Ɯ?I4 = 0;כ5C"I,uv뭭I1wm#GIQ,qSIU2@KW Sl?mh>?΂5bU 8vqkqǵ[7٠̟bWԍ'l% STګz'T2ZZXh} h &cv vU}5i|uq:ۛ}Fz{vk3Uei;{0jQ-e}\1觔AUJ y=<돪Xk@*hP* 0*#=㐩eD2(AJpPlFvwlzq}v~ЛF*jnedc2M)jja욃5uZVG"rhn;z*W6^{q{ g- (iIoe6-j7FC#hH nZ8E UTчAp4 +'lC_tgdǶe2TmJNo'U<$cJ5]> >a7鎷=>ZH;,:QWOhpS*c&.rg]FU4,* Z(F97~Ki W-PHZ)ABu P5ϔ$Anv\ҧPu6GUv6|+TWVԑCN8$>S۰m/Qxbj`tQ!TuipMgɲ}xVf5?:˦cW%Qxë3ubv~fuX}+ MqREJYs+Npu+VI.ʾܟ$1 1Ru;wK2;kh(sT* U~ͤ+ij(䄴da-Fv-$eJ uM)+>añ|ýDZmj nj֋E,+¡)˄^}혪7[㰘:ƶ=ZNF\4KD&y)(e n7ߋeqb+㖧UoYPeHiنahXxkkTO֚sN.ܑ5Lڵ, 2:|4:OtOsG[{4`[’ tV7EV4 M4H m^{]{31谴5x> vSTrɻr9㭀51"b@AQO!,-"!g#}%퍼7R9z* Jj[ӡbQɹ.{+o.7kU+;met複 mLMHq-R= j,EZC#./~Q, bq17LFB2--=3)N,obq]Y|n`F )‡NO3^(=曍 kedDVe=: ע gy9L&5q\.'#6E䣫5U#д: 4?'&/0ݛ'}͒흺+7M$`* 2`[1pGz1II8\:TG`13aUE0}x9bS vHIojy!ql.%h s!N+GNoL\z5K~Gv/]8W/F?T'h )K>]'/84E=b$uI掮0lj#q lyPWgebj]1BMx!$k}>H5ZcWR`J6ns͌Try1IEMC+S}@LG ョsQT:SBhkVo]:߂IkO;G:nvfR93& أ҄Kୁ7_ ^9R}:US\=.;oumEMOKZDmnzku}ߴ߱6Nc1GwSEO$B%SU8ʈg#!ÎZmygM$32 9H>=i~qb%hąDkҝ1Eu`&59L&6fk,:h QĄiY-Zkb,5 A CP3>jkp5Xl7Q$J]G52?Gֻ]u\q~ڽ;J7N5b3㫥;}KKYӛp0yEA*3ˋVa8xcm_U߫d8᥏GJ%xZjs^_<$EvQKMչ|gw ' {J䭎:Z~BZSTs6TTBAfei%?}.%$Uji5)ž_ʞM292636. ]e Ը`  Za&g\5-wU4 \m9Z|* :.[TMϥȻlsmZ_=-U?o/^6kdܾ&>:sYL(T9 YT 12VֺL;e[Nv&;"{x EH^I'Fҷn}k çϸ]"%m7K%5Fkv2Bt-F4&Dh1'ɽɰJ&329M]i)\>3y3S˭MOTWcSLVpjݫX:% %ĥ=1*?kcTԛ=P *OU#-=q=H< \S Oo۟ !+ۗ &P~g1im%$fu*J8RxW䷷/mo*$]Re)}Ӳ$)y<oWa2]rr8jzu9Lri)>K wpz )kwrjh룓yB)fu k=QM7Sq6U=PG?m=8a``*1Weh Qi$ӊ P /{1_ƦtޞY=?S"GrːSW]^xrn+Hz.5JZf!:ƛ+X90YTPfLD-6E3'%o(ĄZؗʺ6sXf I!|q +OP:aI&d0,7F |!KleQ&4T5bzgjż6r-3!~G!TǨ+nݝ}:3~VMz/}U ,ۏmT9:]7JJcPă<21&ou=lju;5ՙ\>ڬmvjxDe2fm>Wm^QswSJ(^,/Str); ƾ}Yh{q41cQPZ|t2bW+=Vxi-~Ҵ+G?IwYm`T͍Q,vݲq95?min-dǐT\p4z iGheu4,˻UhʪܐְvW\|Q5=uhM6Y'ϽHh048SxL(FU=-.v{_Po/zSݚ jEZG#ЃgJ)KnR>눰;30v{>2)pX892TXac3!X w&TaA]ژzx25Hek!*Ddy%g%*8@K2&Tj(G4pѓSO|;:jI>JsYjLȵE qCiTlI/>4u}M,@M&)dt!d$I'j M>Z¿J !it˴c+@676S?]'?nL\uc͐ewkT5Jy!vVM42jyԣ -]$ԜpL*#(<@a#o,<صm8rMUR*IYix2#A&:; r㫟9UeF:%fr5ygt1VOS+M*Ȭ&$=<݋]!ɦ :=eWEOّt0&3jbiSQctm<TݖXQnT?TmʋdXmp՘<~"V]RK4YE-!FJ&˺=.]*ˤQM(/W3^D%mOz\Vn}՘)c!8s3S*T9*zzוmDFeFޤĒ3y,ᴎȋS.bF,`aۙٹRkFbtoDE>zIb>>|z= U*>oҡ*BA U}LU "˻7-\̲T=0~X#F&u1$W?WGMeScPtXaM+H",0S{&cmW_c>D<4fא@77? zo"ㅣz* r;t1}:`25$^KĠ\J$oocs|誣|lT4K,>a#f1^)/.3X"pbqãCsT0.TU=?f:RJ$؃qkƽҏS;TKWjyb@ ஒ9 ,.yL4ҫ_;E |xt[qld+P#id c88U[5){KY:mE,9`<~Jt@"y*tN2p-=t|X(Tb kE5׆&h"jJVWPڈgs@7=]cr.pxzQܹӷ$ :D PYY}GK+X..Ծ!nOAzbvv3>4˘ee5 5Hӏ%lq&YdjۉJ @*]SRmVd覨U,i̱A%X<71 :QX7T>G ,j5c}OV$JjPӢ"?M\HexaN?nӦeVufF?.7XmʚL]^骨K"SiiR7b\ܲQen]٘y[1ШAB"LqԀV(bk'|{Ӑj4?/{vBe2k?GO21$ ]mr7՛XtݽkWlj}6܎1LU%uڣprjzw% V$]Xh:y1?T$2F7d׸f=~2RନLnUK&ʴ yD] \O`{RltE_(5&:1-UtsxU8n,l,C91^\DJj?fݑdՑ4ŦVO1j? ^SNjctyc(gXVӣT:|N/dWѥMv$o X*tQ!r dCtBQeD@¢qӦ5fp٦8~c'wa1e2ju*xVH))Ƞz{3/],݃v켎6 *<c-ae5?t3X] "9v 1Z#)@>`ZߦŸ0xi#58/Yo&mTkOJj)itUS2Xnz,71wk㰕ahvFm,-!6VӢJTv!TuY&^RkvUj>"1O?H^FXTMkݒN=unfprb.'SFѬ5.&a۔<` *jBt(+x(UPa/YQX/;UG,X|:.j)^7JY2UVI(f ang8M,[wE"6Jl*Hl#/4N{V2T֭jFQ*}φzqaR%,O$ rΩjdO}#U)णythBR@"i~Kkrl(Y,ڏv>*^G:KO|xӏ?rrOapu IpZ䤚 c[,4̉5f "Ģ;uh>onRZ`!#ݣ5JV%o nf>(m?oF<׏ߗ/]G:ӬtX4@#*ŵZ[:{O^$'P$@{)WKeSЭa+Ȁq{k]uNH OxP,u=IfNZߎ'ڌSWJ1]."=b?${{cr@ΪYP~_ՅzYMPk }!fe ZAs'c\dbdfῧ{IBEh:OÂG$*u_>T둰%IԠ@,8֠Y} _$A*I\q..ɵu Go}ğ> _cA,^HLE_\x#J. 0K?m?b&stB@>zm#66RiikchO)SQz~=l_2 |jϪH઎Y0;rdY44Og="lu1f'EjTC^>Sݴ{'sxǖ^6*:y!)YieaCzxV˭Gu{In=-&㟕}8zjmdžGPóv%6spQW ;f: jvZyLQYQ[$r0eRMП :ww-m%n٘EFxgEUU9Gp ҽ\ʠDV =YgI~)q5ʃjA5b^훰ߌ$GvwdV"˪ěmgdm:*m17E=m콽T$rF W Ь@xyz>'5|~۸L}]9\ I.SNZRNZ2Y.U6uZ p$In#A!e0,զzs,Mm$qbdgG40KE:x{ܻg{o~-vC&x52}5642N&IgH GQS4n$M;Fhd b6+R߇u!qdZ!zIm~vOۻqP]ɋSGMi)-喤ZFMDSS3RE$0TK ծ]wj~w͎ܻkbh)'Ag3RβN@{gpm4%rH3h Jzn YT.8zK[]shlEK3DsT?(*=%m,4z]wwPfgwfWyv&m-@ [G!hbbp#,5U5+ 9 S"~dt`+ $ h rXS(gnoۣizERY 4+ &\:wM>hbsYGOf+3 [, OSU$($H DB5]1!0MdT?i8xI &]J]6#a)::2MpG?fz UX0^1eU8PWa3BҦ xzb/o헭7 N|i;^ܦf>6brTRH\,mXX.O93dudL PK(Nxn۬wJe, (kZj `v>Nk6Ona"jjقgq Ԓ' :d JZl:ۼ: qjE%0URTEizD8Wyd83*)ҺOM6@=-uX*IAJQ%IYdd2HE 0@#Qƍ$DVvl6Zxb_-؝8+>_8\ࢪzjʍ<ۗ9N%GDSMG3)3}m9SrYK$89?_ԣg p+;Ѽ[|8´z OiL'dE}j0s^eW㜥elSE V3u=]8|l}Ivn[in-04Եy0?*E:%T$K LN.ۧ.o;C7B]E:9` 04  H`K#sD+@akCMTKSH6fw5v&=vV ͆y"\ԩ)j'dzHIVtl=߽_?{ *m|eCc{vVAS:6X^ X2Y^T ptKY[p_t`V=&#VDf$~|? ^]=bU%KoO::U ]fR<4X JT(H M#q!]5C|"ri}-ɹ~UYH_X5>c=]P힮`$1KVQS4%5-:4tGrAk~MtU'auUTMslM{%9hJ(*T IDԌq&1_.4ǗkLeUY}KnpEuYJ [ ]-T 8Qd☩ G%bk'OA] zi4CpR/TG~nocx%ZV9Azn/vZ&Tu*m}piq[[Z<ZG!3S.R.9r*$QI`C_{Nc &28tY .WAO--%vo16g7X]A&K/PQZI]4>{3$vXOd5CFY<6&UVVWVAⱱQdLf:'hоydWHa$("E@umu=wwNWϷ^onIrX)jYqª: o$)h"!An(f/$HN>.|CgyMsg:[Ѥ` T QW?>+w>ͧ;oi-[lo]>hcURP1jS-2G" RHuQo}:d^uxvgs2(f*+M1(f)6Ӷ\nmq8$\ȧt^U+SyFNI qO9l]#(t4,ʜ>&L]mNrzT<1CMG;JyD`w2U{K{FY|`3s4sww1J cfY4%9bb81tox]b#-@CٵwܵۋCϺvlmᷱ8kp$zI!VI267.wgvfQ8-ܱV}5SiWF4`z _.[5uMH \*TDL*5fNdvU# Ej'd|Ros\Xڍ(4|vܾ!mEM^ܳdzܽ=Ub7UܓcT@cLp"zYVB V4ؘڿpij1>?7Bh`;H`ܸN(+}>km˟8WWy]n\cX#P~U$~i)C[טcf5b?J~_'6YJ[-2z&[91+Eb^GLd3,ϗ=%ηltBV }~*ƆQWitWwmfo5S[ nZX\no;T$+:=PT 'E;ٻ/z+u%Fm m_vs_qc)ik%RUVSftevG/V[Q3IZ5 ZGpA% y .D@[JP|:"7;"Ucm<{rCuynYMEQ,ȕT2]3DnH^:T`ClqVo O/K,PJ܁kPTK}H@dRCmHAX,q?WXN=r̺ta(~ 77Bz߳aIIB72H,>v %N <-z0'Y) HsVJGS;ӡMeo3U{Y2QFLƠv !?4{M|m|"yiOiԵ.9/m17TtCl@p/~nX DA=x#R??GحB='Hom4;쭯)beFmߒCt|7!fU|M8-6c7:"|ٟZENQF_*Tjtwy<}>sMjlukor LnXv"ҫɑ˼@9OȤL)~oQ ΅VM0T UDZe B-A)ԯɲ4Ѿڄ?DC䃶#|~ɶ+{GFOݴ)#WC6/ǼZnԪmӾSodT;6+V {96?y5 ڧυ#MNG)g}f5I;*Bq>ΎFޘ퟉iiv$kQ(i ]ߕJ`./9:g_Iah Qv:E9!UxCNճ-ूa1EAVt/kOo5;f9:L9S-ː $V+ww~s'rdE)J^ins Me,\(BE3%7.xכC/!Ź7 -Nn 8z89rD\.>H7meoI1GaO:d5SSG< >>娨(65d#SGLs$ [EeU3jkĿf׊vV<(&:#>C#&'L!lo]^FbOLA%>]o /]]3BT+媜)a˵pû>FlV]+vv:ە{zl63jybޡgl$ /WpW¡g\уGk,[imc)OOoԁ?0ߪz.{!)ٮu!OUSi ̳ O1\c)r=w6>GVb2JQUH@vy8'[y+es[MѡPĄ1EvyZaZҝGVf/b #tSA<9lstY*Xq\.Bj0PMUZ(%IPP,GtM %Z1q]v-$S$Od>j[5umpt { p#E.8j.tyszH"#NJU=-H ۮ{ﶋnʛh##qPˮGL9ˬŖѸ##,iMU>mWKTKQ^LM黌pxG_f _eq5Ưϡױۏ1;-!~Б7Ec 讑ӱwq](Rry_UJ=\U&W!93 tgom5,w+,*̔pʅE/f i$דU@#-# i^=Fۍ+l!' :=oXuۑC<ɶlS5:O41bhq/-UK"E@[[f Mg}qtYz*1<9p;ƏrH+iczLsVHj`%obY/3yqehbiI js::]ri- [ 4R25QZ/l\ێiIC_!%~O 5)v %2Md/\M_ȇg#r@'\ p;q~ɣǒG_x7ۜێx;[V]h콫Vs3D/:ڴ:RH6$}ַʬ2Qi1XӉJ[M߹!ND0Ҧeox)nw.4ࠈ=zCkd0Zlǖ8C[xy('t[:ۺ4SQg)S6Aȶsd 7>P+nQ cH '(Jx#r~t{۹Ļ6qj#;,8{n6?ZEOVpQWo3`:uZjśH[./n/*3LsL$t"/ގ -ԕ;8 _GgZʄ][x$$`Rԩ?¹f<:8ٽ-]]_K`ֱIat;7KJR_ a/AUM+%5XrK: eㄡFzzido.ALqk4etR}kAw,?!RoU_#3[ZsuusOYZܕ65@j<4A>Ϻ5TZq񆞯!Ӂ6wH2 U_D'ekuDԃH }ܰmнwⵢYAV>Lנ"rۚᰛƋTG@bÇBN|v蜆kčٻ'ZG_l#nbYU&rzVRI%DoH{r^2}|kH5E ON9wkj}W^)iP-)ODWo6|~Opxe/AG8Dj*MBdòR$`=6AVTMásUhgjh7.3gI@qe>E2ɪ@2 y/[kۢL]W@on4:r78=ʄs1 SIU4'Q7omUEٻ n3lⲊ{<^gmÃ-6)gQ'xɼ7^?QN6=)0C"ƈłA:~ c@uOrFu^'iW3W.D;tū/.nTaRe+궙,dY$QYWXK)st*Y7Hddpץ MFp@Lu#:*ܷu\q] O!ؿovNN \+S6wkd5ZURk\ɮRa6˵Ix@n$Bxann HYAE? G220a!Tˢ Su^n]gZ-^tf -R`b'v);{v6{tqxiZF%5ܛ+~]l\췔u'todg YW/Ŀ񞆾z`yԓeDG)j ,B[۾w}SM†ZMt藻5p XMLv*BFE^Z9mZ<= z9#5l8FAu m $2c] \dVpmYßSZtC>oQN>3.yY􂺲%aܜbR\?Rٹm#Hl d멿-O~a!cQO] {x:Y6*iTbf:VHdarT.A!,ȰK8Jp,jEyMJC/x}C eYN!M#G *cď?BxW]-E]s~JmUeQ,efag_ZӌF.I͑7Mŷ[ z4xz&ƝnwO "5Sy#L. ִuGldkr{ >U BHHS喂E!Qϧ|61-^T;~xe.OqJ)%ZaS2.}'(̜P=e?#O"T" ʰAퟷ~5mr ˫+dTƿ"inܙ++1W-?PufknbsTJ8ͫKCj7Rp>))"+tpUd9|i+r-QmUDKD M-cێ{n;q$#<èrsmp$\~z\Vm][KQaPKMp)wgK!bI$滍u*豵C=dtۏaKY'هb1 Й'o4S<7)SCON{7L2ar[zņF8_ ,`"[ZUizRx7Rl R9e6-KeFl'ʒ^%o~7+fg2;K6R4R1F:y8kXi=&0[sn䨕㎥hzI2RDCn\w9_nt 1@Wxun2Cz8:9;ݻbj6h!8yDCk03RK1kBg4ǺgOA|N?YY6}I$$u}ieEH+e@D{>jCW=¦W1GZ2(][T]U/:MPX;xskhJ/uzI}F4ۚ1L v}ދIK&+Gi(4fJx} `k'p|d~8+}꘰YIUJ<ż)XzLeC6{sk5#j!R?ҝMLss4”h4Oغ^Su_Ǟ*j;#Mg uM"`l*q!@DVb>fd67 <Ҿ.:&O10ZHb];xʦ&zhVR&PB4LYrG>鿲w[Ơr=x3C5& M+{oThq|y5Q\k[Ly;oy#hCD>!u'w[kz[MJNrGWmP +MM6&hi1xh7_xe4⧫JPD0Svk0m:eO(Sqݝh2V_7}Qo`$~bho9^6fT冠7.  *EA*؀s*^!SL5zHC55a}K)R @+ P];2P&:lM8tbf WUO̫o;pdh2zG'\9̸ -L0[4YMW˼4&oBV4>^h~= m9wض6Xm'/ܕv ׻ BN{M;p=f+ tzxsJ#7~c=Dy8&S)`tqTʊM-C]t\~.UTbhsxɕd*PdkHsϵh'qΡ>IȚ(+W';I {?ڲ7 UeTS}ũԖ yc{/2ˎ f;4cx؊ <%Vbgs5N}?zGa#ߘzVxq;1ewşg!ӥ.%)WJ`CsovMLT($,0! q乤B{cg~XA)R|JfB$ >yhU͉< `ԹH7!\cKl)Y\)\~&`ivnmb}M}EGۢ Ư,D=B5FAxa* &}lb~)8ʺiRZWӞg$TdT?zcU]@_f[b|ϛ/[M;TM$!eX7&xyo;,pO@ӇICFe,ݧST(Peۢ# rࢂӺ ^:G`=W#n\dqhRl%Fcj*k~ݱ1y F9^3"t0t-~/='F3/rjtoNνeg+T/ڙM4TKvʞ[E,\BzeϋmogiEG_3N"lj\P@ggrķ'BO,ܚ92TgD81q9JdYk19E3J'Eg.47odQVԡjZZ:Dk:K=o+B#4,} e<õ5i%UEյ) W_aW`tz}5_Ĩ*fEIj:A z&.Bà\_,$"ft]C(euM^RL|RH`KYS q̆;i; qHH2J\WǣE,M R`%$˨¬ힻftva+U%b!TTJbAJ%E $ KhmoͫUP+:C" ÒX)J|zt=i2tS W3+%\Uf-ݞpYapz.2PBuRJc1bH X \|H)TBqӷO/BtRG4q ,RIrG"I#u*ANF(rM%(S(z-l/#!ʹ A(F]JVZWzr*ϟ\݇ǭȟaoml(;RY:jhbO^d`1-+r껖vۊ8MK|mS._tCX~:1qP|Q^=Q'nFOllՖ\t1 XfREhPSZ%Ħ*۝AwOVQ[IڹVg(EISRLf jё#Z*x˷Žgg4Ӟ6ধA" '~JhbT.W? QR*d3bk{;+ĘM4h'KűuE zX ?k < F=)ǧ^Chdr$d&j摐vЭUŞ䒀|gWg$ :zhTV@D|-Ğ94-\[ٖ/Y.A >܏ϋ?[3@NtOd/~zszEJQ>lUT+M+$ xQWlk0&:hdTReAvIث)k{$ݭW,kuXQ~ SA} F 2t3U=@S͙4)ǥ#R8>lXM[{Y P7m$BI TNKWVJVDp0 m%ebБQ)52֝meX,*@|>dۛ2RiSעB#͐֒Ru$}ӻ۳wH*#,,g%&,u3}mxК‹8K{xנLJ)V@AB&E4 f(i稕VNY TWy}G* kڒgL#J5N#"jIr}(j5xYNekLS׏<6<3TČԬ/fG-Pή쭽_|Qx#OMUIp3ɥ.XeAanl?y$9h 0AG̓ke8j"*En}pXܝC0ʪЕvH \{%xRc5>tӼzډP]n}8]|ZOT.QusSTjq˗f:gx 'A8כ. ˒1{coaq}IAfdcȱH߫C:$>S柳tv5ElXܵ?i?q+Lj/S-M\R*Fq=LY -r=h!e`+SQWx*A,4 _BQHڊ7!ճNDq4|ǗA^(c6U]) P׿ 9:7,j舊_Bu<_r0%/;z5Vo On/ӏo'ܴoժc>+j?g1zDi*[p|})lM4ĚJ3|T)\%ƭPfh |ϕ8v?t]ito%e.2$>D#uL8/[j*˼*>Y2YcI hy,A?@Y#wUvւilzx+iutĒ&[R kfL`u7PCaЄ.SO O_$QcykuH%#P52o˶f#z~K!$ϐw7"FGݑ09Ҫ]ZWܢϾ"~(c8Qc8ׅDP?U;:Am˖H J*$Y#AQ>i=L@='R˘mIKҿtbi۞ZҞ~C:Yz A, %S©tM:6OVnnȪN{~*:w5mKIO(%d*BuOWJiJWӒR;YS5$cpN_?AG;+jECUJxE )k)M6^x.Ť\zJuk2͌QrH`UT%hkueFT_WtTTEɂ*DKX1j Ӂ%I9%CS DpIX%3i ]V<*-hMX&@ƫ;j+~t?o矵VJ#Qɤi*$hc)sS"=184nw7"L.>oϪd#vӻC{ٱ꾺m 3ٔ]RI04tXLD"-ἪeаG))%SctEf5Gc|u fqZ +y֞Ifk2XjdP͓QG= @o]WYع<|>]6Ψ (jmX DSKpKZzD^E%¥>"O|686V&3MvE+޹xpm4&6HgU49@s5ܻMk ڥ 5RFJKO={벶4Y9a1ZČ5@%5m>gw2۪wZ>*5M6bFv7i`IXGmdӄő}AԀՖ- X\q1%Gcj1ؗQ.R&Ja+&IT(ԱGA[i&;ʖmo<Mz )f)]*;xAW[Vx1wOu+T.YRXN5+Gq'-ۓY53 FUk݉f,%mzG՟Wbv>GW6', Lg%ƒe{][H2A@)SꫩLHQ^ u@?ׇXR}Ӹ+j⬚ގW-$o_Y&%d\,B3sY|Eu\eq 'E|zMI U%D-.d+s ol4՚J>_OK6>cxYI^G%Y'}t-JΑNLpQ04U k2=~24GYם[ŧfu^#iCɘZ)Y(u&ͤlIDf.4oy;r;;O%E f?6!tUZ=tOγY *ΈZ%ykEʨ?OG68#ӟm _kϵիW>GѮoJiRsXէIU:pKEkߋֿԭ8цAVk 񤒥1#ZoFұ?s s#4enXl [}[m_W놤$6[M=i>]m66g,-}PuS @A<{#ѐL`1զ77>׺쵃rNab~`P3>ʪrֺ@ $?~`$ qck؀M}% 鷠$ qiD=zs\(<;A0Cvk* Xܪ?O2W6ɍӸM#, ;Ou2M谘O or׷s`#AQGt[ϸnUWDUƃS7l'sZ)+ejDʜ G_VJZ2ڮB3Ԕ{3pD>>M )qњ2QE&ԀE97z栐/*(ʎҠߛyO6gw]Ɋ4%1aEaA`t auǏ5f*w0:mJqWf$(UPM8Zf82?!wnwN_3w;_vǸ =VnLxe)TG#$r{F[6Y(%Y<#  jTE[ŷ$s_Uid3L8[OĢtnmEŲ`TP=G8yiZZJ8r4S Y_kU]H%ѼUFKy((S*YK}46򣙤@ &ʘ M{QӣpfynedV@xuxOܭYZxue/MdzW?y1rL U}@5hĴj\9e mm}߽TGn1?%,hZN⮚yyjj.(|7UkPPDhHhϗp8mBjr瑱"(թ$8t5{p<<6eI#H2!UnZ`!qبhE0Vae6.<_{[fO3ᶞvklzO11 $=F#/Iev5sSVlEoH?q Bu.zets<Ǫ%|Vkj KKSw:e2xCϤsOVsѾwr$gz]# V Q$b)i9DwYq[3fm.+)EcS1M2LQL$%Lx;}ĺX$HKZa1ro7F#8ћ`glv5oapƞa5tVTMIALb6MUbM i>wem˹,Vj,t5Q{{ ##̨ YS{+r }wN؛&i7LHKJlB"!j#vhS `tOw-}:"?ⳟN2ܵ|OnJ|Z"R(Ԋ qAW=5s "22F_~ga;6Oƈ*OYaq pl,2mL2m$ ViPdtWXkwߗ)3Oq ʎu/F@ hHCQŗ?Om0ҿC:92I( r*SFHE;=y[#)fFsb\5$g>3.]FkjMC1t} .gu`+7UV"9XzbܽB)aC(22M:͑鲵Mnj RP$}zzߟ)wOmew31S+Mj!0,I*EC ߴ# ߞ5z-A;#cIU[4T{wn?,NFH%W`YuqpH#ozbǀI|gOSͣTRPQKI[1Q WZQ)g2PKsfC{M`vX81FIh܉8;Uytgi!._d|ks"խ'j6uf]y'/zVG;{T˸Xl㝴9PUMY7%1G2ω}Oiukj+)upnd/R;_Z9Z !}7+hmì?$Hx@AN0Es=m.mXەZG4##<(yO_;w WZ,4x3CZc6٣8:qZx]"vNj2wlPhh^5z{{{o{$s5{{9Jq8ѿuSOSz$q{sl3=YmZ< ~姚i1)⦨KG1Oa!_mᤣTfrjJX6zcU <yXlf\֥X Z*>_jⷸw֦ͦuP%D#ʺXOaTn:Oinz6ؽِmːkoV5XiS~=MubzZ÷+iqsR=nwd̆[Uy(y "ij~xm[7Z* TxJ1ߨ)EQX4& -Jmnz qéFشdO4;n"dheGyrQLlOs!7<ͭ_ʅ?gRwl6rGeomb 0>ڛxmL.^UVI:YZ*Ǹ?]>:;W'Tl_}fjT8PuȆ6jZ[LPPb0k^ {ALnf4dj4Td"S7.g}a_~e1 Mɺ̦x T6^څ@ xjjj X{ogv8Wcݹ\=ƴO*~d`|pRO3l(ni :0*py<}`1AYV);z#E9FyK{$eQ~ޠ2Z,ufک15SѠzu;ȓr5 Jk%-uu7[*%'SiTQU婣UҊCCm۴ФH޿1:`5eVlN>U󚖛tw⮎x.n9z62CgƘS3#X؊&A{{&p#%~ ( vbh>b6b:g}o}d1COkN5ٜ垺GVS[o[N,eVWFnW;wUPF)+j25t4U4iC+IPfnc[ژmNc-+u5\j2QX]XyCr9*gJWqwբix-5pnn➎+kVzfw$?wZ'L/}[Z|l{2LAY<6r%UH627{SGetq("_LG{GnٛYa$R6Վw}l\bPARUd]d8 ,߄>Er4VS /Ǟ~|֔;'MM}GU1` [[Gt `u[oe6~}fu~u}><9D _56%1OԮcOue4玘jZj\NFV癨i>6 {Ց>al)ne⧐Y$ W}v }Dȳ+)z=U,MRɿj_%nf1ӽG$%m!b+ʁszClRMWa\>TEDE,]KP;RWTU汰"ikG%![]<i!|&3(硛3+5`oI譪jyI5Yֺj;N^ƻ] K5pe ynm-rZ`!RO (^ΚVTN*.v䩕#F߹dB`TCJGdЫYWWM]RWWT4=MT$(08'qM;I|znww $.l.DsOtQJƠBG7cLv7wuN?j+n8hoqQ6ߠHvFB)k 9Cͽn#>-v[)5H?{4nX D|v7Ves}_w.Ԇ,It2y ysR%P e wTSJ]2.on;i\UU'cy%Uسi7nnw=[x8C)UPҬ?ϧۙw ߤ( 8Xp|K}În{qe6~7)ٜ ~-2rSU :`Bc.l\j&=Gջe&w)J1>Z췭'?:,rboϭN>bV? St1w\QR =&^hGC*$[Jg%?$*Nb;~ޏ"be$ F7WK`ibdwLD;JlT 57ө@s6%=c'dEzn-u=t=Cg gō5&PH qވ.1j}vגhD SUU5a{17}|^_뺩vsvoZxw5>z pG%$1‘$}/t=X /n-`uWzSﬦ~PjLn9gRf)є 0{}fQ I;[4*:H&)Cv~J)9wrydIht0:i~GM]TKFu273M+fr*=iމovRWm(o6jv50 Ϩp>}\{g*-Xm!i{5.G'ǟCsm}ŭivIuwhv#\͖jqъ) q$M$<3Xd18d訚bl)a%7*OQbOʽDՂfDu2a1u6HUYB>1.  _^/w/?#ON؛_ +s`wY/MpC4[zASlg`[FX@P_1 .ʟ6Bm=|G|a$]#!f`Eo0taWb1J9#WA EFTӫء>XtI3הsڙ){˶?uRm:-ѷ1ٝՔu:l Ifa"-?>nۍ7Q hژJh.COp{or[f]$/aBURqY~(Rugm:3bwVc$q D~f |)AVR4O`4:?:;? EoYdwvX2k?'('KSSqSRTvYX+%C?9..ZKaY"cɪR/F2v퍌[$r5h?Ħz^;Ż{cMӐ6K[Sᥞl[1F%)LsJi!r>Av4;;YL]?UkA}v>mۥ7sjN$D$ A8gc7{i{Ye5#PP(Y뽿כKaŇ`)$ɎmϖeKֽ#yChP1X{ #\kTa*j/Z-(2f{_JOe[Xɘ/Fk⳵Կ-FB~Y17Nnþ+Sm?'#<[;EC. GԤ[ \캹ACc64$;rK#97?Rf.O>If2{uK#Jenc&̩h)Z|} Se*TƑ*𪪶ACR_Ł2ZnhuzhiBvfo)xtӤ?fm}o{FKluKpb%Dq2!SM?fSOԤNހ<*TtR wjak2c3۲M,[s$ȻiPm=R?y+O-5.!',ZLJ1oᶶOε?3Y"(w-ZϢ!βyLK]o2:X6u; gjG#Us!6 oxs}6}6tk$޿:w/%H陵Pl* {ҁEB)6,O44U*#,f-[;,t>*&oJ%S;_S/,1[fR⨛'Ʋ8C7fi O zd1qQHy'rAsk$?+vW^gryk:ᒟ j:q6IuK,-es,Z! e@[pu y!?d;p VdZ$g )NJ~ Sox͛o<{,+Zhc裙wn`Y[OU:SUz1}Ruڷ1ЩԉDr9do%KX~,/#RPE7?d_<cf9BU#'._tq&g$]`x$0~uc ĈCO'o)ژ^pQ䀛)bp2dk#gkQDƼ33M<L6_.igŸ^9Ϝ믍ٵ2PS-]0NCcq[z@ЇB[Iu8MQ?4`)rF%So #IW~٣VQ?QGֆĤ" R(z%{e1}[ݔGM`:Ujc"ŔK97a苘3&ѭL9F&ڳ1ٮoT^r)IavoU{@>Ô /ŸonVq`_hiOܾОR)@%m|@ ΚJGUWgn|UvS +ҫq5U.M X*$ZZjGWŨs-q ;;՜4rY#c9`!ܧ3h@?tCYYr}>l$ڔ˸TGG>+ԙJїy0}U[sӽGG"ݗEdi7mmzlL̤/7[׺orͶ;i$px˨ZjO\g-ej*-ngU& r#Nϩn>qMP M8xa2WRp>Xm^a*c!m]%ibekײ7`ɵhjr}k.͑dw~Aɮku %m;8E=Y?˫E=_>'sav8D*s }A!g-vfv݉dOV|]ù)qc0uX%OQ&=ҒH[{{ǹ7+.V!_?bs%,;N" OM]p~ݝ 6%OYZ,sݿEGqckJov>I*JNo$x~RT׮KBꑪR\p{Pi%ӫ4İWuMpAǗ ufY ᴱA%@mH u \^a,jHb>K{]ѓ~uMO7FWk*Vw򨛰7JSr B`=뫲[x?LP}O˩.JǶmzͰr~GLu]+1_K4 <27EV eE0@@++!w--j gd ɜ\&CI8g %on> }6VJ|'j,% >n,/`ar%RVcqi22Ȩ,#xh Ba,LNUTȡ<|@g9Ŷwݪe*TJqSүkc={f? c1pmlEq 귖/Q%j'K%MxY*$dy4ԪEv(^ƍv޷97M†[%%^8x~c[xow]KK+W _菄ud}}[glͭL)pg6YXzRGXXC_: RRO2)$/T~(nt' vEXWq V+~>U2uzJW`9Ow ] y'm~"i2øq#6HYA~A$=:Q {5wU5W:jݻ *i2!hёJ@JHp~~}Cܾe}sV:g4GQ xc,+RڝLC[ErTEJi%&XWB:xנ֣9Ypx褪7V!Yoe\m,ʌ"RWia/ȝL،v>K F%3*d U-CmB&<+zInwL>;FFYLF-r-[r+[N+|R0+p "~Z|}q>+m|ͽ=4{#v6`IUd%>2%zԆi h*n|n_'UY*T㨖J A#TB"AΪd p8s*snJh51TPq*PfMaT+ToAu` Xl^)[[un:9\eȤ~ h*7@CoVIV9AYN \:D, ѫ,c[+"eb`GpT ;gm.t`N صk\^f|J\h|G ꬠnTXu^_AAIX2CV^K)ֶP!IQʘ)@ALݸv3k/[AUIQE箙㫅*ܔL0mesm u7O8zڕS@B"MI7VGx}?vX51zyk]sەvf:p.穒mm~ݮ1$+ H>@,OMw%K_He堓'1VU0* wo!*EڼEC8Lj^mWJm{[Zj+*0s^(_ 1>(ӎ@1E'P77׳FjYAVTMK CDI*fk}|~9r֘?gR,P'ӭKU)MCU8GS~ROc-Z(JdbPLda)A%8I-^6TMuΖ'BOXo/ݴHY'bujXIGm\>Nq;_/KIGOQL,]頦zhԺAY7uh!"e]Mq_ֿM,( bhûU* }}ҊW,Q㢎Y&%Uy*$K[K18g8P8:"\Z?FGDCE%X2+8bn&˦lp.:3p[{<01=g $`(f/Sz,cQ/XԲ]71 +ڲKV$ΓnIƃ?^c_@;"zBǂW?P}:dȾRH\}>oz Z߬eL5T9*bf1VC ը|_Bgq ϞiMo]v0*NaoMн5>k9O*uS Z0G9tշntmN pGOMIݔW; !HrRKEQSVTG/B^#!mE}+e(YwT<趖V*t@>tE}ki;Wqt5Mf7抹d󠆞(IQK rIpr9 UnAE>3%_ bdZudmTv ldmcNj~_˧.tDjЌ**DK0%{`{_\޸c= d2nJ*Y)`,!VI&zBnEAt⨅n V2(#}LuX-bh€#[6*Wz,.<{x% nh );-GAy!o\i}OUQۯp49^ziP;܊ʢW#D)HQcPK9kj#n*(͡UJ|}:?vKޝ[ԒE0"I1TiqE9gft"o<gICM2b Ө3U^=;) nu#]tJkY@`v ^2[+r/jfd|>ݵ_qqjLceA,BE HR[5ەU6RTd`HB.Nn\M#4 (?*֜:3XÏM3C7g)$%_OHjkj`"ȲIQY8Ҡ7{)Pnh 17MNV<&ϫYlsvW;^'+y@niu‹Ha[q t-l.Z03Z'rON;ki򵛿vMox*7 4q-+KI33} ݃ SɮYn[J9yyq:qe8%TTu$~. qg֦5Êt$UԤ~΅ATvyk` -mrQe*U,\clu^3\#IU2A>Pi/˪2FGTPq=aVљC2&ԳHlKϦ1b6fsfRَ:ϫʉ]޺\LR4 L%WȪT/9y`i=~TEd$Di?^f+cMYIiiyMuc޺414BQu2Aʔ3M^)48s |Wx`P9:Ii.umž%.k⧟N$I04G_JNj1}dqS2UKSPr0̡VTbH> pscw=ڛ?›h ":$ZjzJTeuHXe>7㴀Ĵ:jzmŧBڲ_<&Wd U=kQ .<8b#A^=ƃN"p|[kM-njS:@uTjxeExОeKX+&{vDX =1 b\PPcǟW຋*A)sffS:#h\ jaP܃:SK>Nci5[?Ra$Ly ujS㡍!WuSO\ihg>~GWRO˧I,r e꧗ CVmwgmFva-8#:Q=M5mXj:%n|z:2j*&5ePBr&C{'֣6VbgljȨi2iV9櫍 *TOt-Ib)W_>i^)k5zZsA!g%7 pfxi@Q`~I7f`g3yCQ&O\+A)*H4jTI1G>UiZp? >=)i@+Z'>.q #GXBNu++4SLOU :&u1zjxiزxUtDC8?]n;UDOSNUKFkjWEVeSS4q hjT(,i@rxҙɥ)ï{4SzM;7>NfrTd$۴KUVrGM2uҬ)Xbaco,ωA<̨29}Ӥ ~zUX!XY)X -Ӎܻd)kw'Hy 5(^wfv.~d" 'S7htլ#E"b<{I?>)hzG>@Hv6[{'8V6otM*erۧ!O @%DFOϦF֐HUS\)P/ !Z[$ڶWG RCkcdPHlgz<%o=&h!S6e%c猸6C-E$lK3Ym5ypSW$V;N%~xl4o(`N~TDYPytfd-<]+-]4WS+&H5wf ]| ŏaVf%4::[QYqn1Z7>˪P}OmJɋVJ j BbWY_4h[ؠp[_#}:C>T|f !У# JlQ hOδeNSCIAK։c?/%]vV Rh1$Sg+UUibEF*jRF oMkdutU5T:: }E=--_e$ 㦃QA&>;9-`qˤBښ~C=?RšKٚIigY$k#hgܳ,TRpN[Qy^4Y$ WS=)抆i<4QCPd+T(ȸu,dF +ZG ?]t4 A'BZM3$HU~,UMpW{OU2b])tSV+2M 9 #cȇI=~R(W^~OGW_u_5ͽZWӫ}(Uq8OuR_oM}/~-ծUaN ,4 `\~?>T9>x]Ā:)[~ǹ"꿥Nmk]Ͻi~-=a-\saUK -c?r9zx~T 0)!76 Ck_mּC= Xs{i#܏%$G fECo4ӊu\Ac ?W? (Kj>o}8>Ct۳YP~ sΠe4]1a$#jgbdW!3PHlGz'd.3WQ((yi $ ;*>Jkof~ٙ:75cK*0S=FN-wnFMNܶn7aP%z1&t7m?3-I։)z)4wH_t7WS10] uܻf#:wzQ~;oFyvMFоlVlF`Jp8j]3"l}Ex(4goAE6Ǹsnѵfjjax# Tj Su.n\6K=MC*x>L%Dco22VUUΣP^C%.s}u =+DcqR4S-54 0Bm=Ln;~dՠ(4%0zݻhj{UZ}݄l 91%|V,SA3fS oD_?vnPoڌM}?U&O]|{4`%a_{`oj[ˆgđ`XhGo},nł=r:F`\ >B_1vS as}{SDȹ)Դ58.ZX戬ydSƫqnʌDdnܖjWetE_>s26ژ&!OY3M1˽s#4@d|υ}E뾫rh3R/~%ӂˑp4dw/a ^A**k)P,طTŤHn-aQ7 0퉼Fki=D2'ѽY4zv\]6;0PB:lo?uvq1X]-[wt_-ETR)ƣ RR³RA4 #ޥ.cKĠXQu;`btڹO-LQYj՗L*-GUFgco\ɷzyVbMFR*^8F}+),g`<S$/SCz>/sgk%X~qC; z溪c(:EzX"Hs(jy V1-1ֻd;l]38a5j5M\`or kۃ;+F? vתbgU> yZ.[ҊYiDE1pm# ?hUF٧e#mEc?%4f ZX:`7$2[o8KE6%5; %5oR[Fc I,tVQ`⣟كKq[',_/Y<du%<L) 50>]ǽ0PdQd飲 4[dcQIr˵I+H4T FEj2A.O`pn@zd35*Hp:~GoXs/YcL4.B䳴"RE 9X#)ll׶uZ,elj 䦉j5UJr*@ZޔETmYpR(03:AU>cnkq~Xpw /c='fYLa2,z+a(h^rGPLF\QYl62~t|/o`ap6[pSa;G !jHji P,M H6!W84 b4R m;\ۏ7osG p'C3=Y%I:daY|wߋ:-7 m-^O7Zwٛ{:Ԙe7%U}L`&nZ7j\TUTsQ4JX:,jIcuqW7?O3W%9Ȝun7{óxo^l^*|nncPA_N(+|e?^D}sF+("Xd'I]*5l J꧁*ty6Uh>`H:x=׼n CER:o~b:G\^߳t8zi ӝڛ DyLc>!Y]dd%nF×,ojd 3~(4*Fzr+,˨}<ʱ?)A 5ȠVWDo_nٲUiFOY YFOclf뫕^Zypb-<+X'mGw 6G6M2,pe7ݓJV6 0߹#1j"ضɷ۸Is"Y!&E˹x,.%.% ̀bHp=wZlM쾚^ݹ*)>aJSSmxlw~".ًG2vcvfʒHiWUIrۛxGj-) ٺкŏd+"qg6]XIw{UqZFA)Z1*m{eqˬKyD*^GAg:@:ZN[|=)NGO&۠mO_u ?eLKo]]O CT~X-[]UW6KNC1_ yqǗޙXNi)O _",P }ÜW͛$U#[S]jzo.ow北2X^2>՞a ٽG \^\rƚ40RTEOU=w-Obol}6Nٙm]aGYE+@mEA#I4TΑ4* ݝ6aq ZYrU%# p%Cgj6K'I@m@])T39v*Rת {rVۂ!1n\rK۹ICQfh"QjcF*~ȧYx#IP^ }،!.xukոfTm &ڽbQ)Wd5 #%CV׿׏7k=YȃFC`x`l _Ϳ{w5>[S 5%ASB~UF@T}tr!(h?_Vx[A?7䩚jEe>tE GАޏOY!AO&ʦs=պGEy7";/u=b0 ӄ`[FNȭ|^]AdlH&xdTz}i+0d@n[A&ى %I# Xt_ZEKZZnx~b-Uͨj`ux;V@Q37eò: KGmʌ3OE$v)i!()11?\U9.)|KV%gpD}ߑ,X_6liثt=WܛñEgaRm_=>Ag)&;vLn:vzl4pK~L>3n$274*ŲYrcǻ).N~4{>eȖ-ld>OpS_J|@ڕ9~Hijy˵:ޗ cvM, 1IP=rS;ekٽx%3wOoe΅xu{KcjԥiBce]nRVtj~3&OrMcU q$<ҞFsd5k+<s ;iV Bm"4 jSfj%L[ ZNۛOl檰x`qa1Y:"BC%䫫gbZi%#ӧLɿ G=w[󛙖b1!P~Tw6\ -t x5=kh*Uٴ0;wkv>?bNL-6.'Y5Ɣ, P sHbV*iGi g﯆ c.X KETg͵jh婁 dYer co9#foFBkQxq5jm-oXkx6$X%'tg@}Svntctmiu43t`*i:JhPt%Lr4H?߯8_׶2[6fb@_r61KfO8=Їf\-E6U0+)}r6Wr[~~@~~6S`m`zTMYIO Ȓ *j܅cT<*z`c@ԌGj.r@- IS鞦95tԴѼuu35=+y]KQEٿ"c&|nNcJ?0CĥT%g{~]h{ $9C>3l8Xy|>T t럇]˿&fI)gM뽕DUPm,/gYa176Yj KGHj&߀T=s{,=Ɖ*2wrq`VEm?z >lt} K,U[?abqX.b%S$oa!Kb V|kΣŀ{4;՞((TUck/>S/ȏ0RVdw6llghtɓqv 8ؐ57; ,6;JnqU23Ul)]TW͘xҧ'iimN|'R+b&qkUd}I<*&!> 2,xutAIE cqFTnOޝ }-VXm,У>xzmk6Z__ ?ʱ/ t{pb*3\5FN)BƳ7vo] r[^kpTU;s$OobLGto2v%f("0w;tCUjLJk<3h`zz8Ym閆&bZ>ޫ1*zz:k<1w5g:x7Ȯ\V5eڻ9Qo.5퍿r* GURBQ7YyvyICRA!!ZT͗At66w2u%5Hg:.M۲>;ة~|i?lIMRv._82jji*q+$I+S"b~Dv>fWMs;?dW9HFK 4t5WDf1J3[cnmn+ dt˼'o"^CmNI6S5IL[{lN/UTEr5j9'0f2;BFx䃯*:jRn ֿ9?{&˛j^8(ǣ2H6h_ԙ$hT}$^H_M1ݛ۱enS6 lV7mH͸)wT hdYj7/\^rtn"9X$H+ c&oo]JN-G91.~sޮJRb\>*EEc CLҐӭq{T~3!h1륈d7n|Io͝%ʃ;cLn?_Xbߕ+O,8޸J?6(U#C%ݰj'k&$Y_c`[I"(!$۟xR4 b~ˠ2؛x!{m:j)Jh3_i)$i8g'Ka6`2r]|mv짞ccz7Fd3vA $yY)Hr+GV LҰC|j FkyaFM! hWQ:F;N Mŗ8ݩfJ+q[}P$3PF*uеnBD :rq|E-VWmi`]J#I|F>: n[zxv ºM7s IZQ<+N^XX]On hK/|kӥ<z.ɲac7&TbL>VVWOs/~,j}CgkTAh7VTiq=..[^ytU 2z<-",dБ2g3]ڰ0K C K#m -xۮ-_8٘*\"Q*ҤtTqw63~Em*M\7t\ۙ*-AD ]Z,j-DXZc뚺,l8쌙Q15RJD234-H퐁=_KT4>rlP.zU3-e4xaZZ#Z"{"_0;o?jimmmAL9Jn؏0|erQ3O,,n9&Hq<"ݯ0nQ\nHZc)YMnVYP>H֘zIM4v~Q.ؔ흋3&peDiGpūf)cG-m|U7 MS^9ĭ5(8:N/^*4N!r份pǃ9 S$#Q .Llrlltb U?w6 uE56K>C2>cǑ+#4QeD1i8i)_.ߏż+k9\ժ͝Xg4U9mQ ❈2Q',HIe6M2@[D4yi:#&=jz}徝گ)?iZϘVFhY]h)`VceՍmEtGCLu4c؞MnTIX}w]?7Z2'?ڙ-O4UO deFZug:*ƒĬlrg]y+UFcSw9k ˘XFA:Px1|ya|b ><~Çej}^JI4b6>M#14?Lˌ!9'XhnM4[CjQY!f ^ qO LF+;*poQ ஹJEH>0VXgPM)ITE4ټ1ai/ej 䜝ӹi3;Q:pg+".3[ hh(R9Ҡ۫[ B.B԰p (FcUK:?^]$VVhYORJ0"((gtc{,U&ͽT qDŽ(r8风?]WK,ձ/7F͙؛{IeF QcoȸYdTTDwe;/de|T=9n[lgXo {kJ\Fqz:z*؟͍*j)ghW xo~ו={_ElO<#$ϫUHPK3o-6w\Ѝ} ||%ܥ)*t+Ȑ* ..ۆ W]K[:s./c Uf sY(1FdJ*S??~w'{fG|e9LFM~PawkbB<. m*1*TMSWLnST$Tڧcbw}tpPCPOQIHM$p,//Ϸ6et B65UǐD59#s7̻ܔ !CWnvpi:v.w^͹6ߊ(ih7eH! r-IX{ =eݪݕ[٬KwFۂ祮"aCDZ:q܉RųSO O$ӆ2O";w}Ig7nn;yMDCZ^$ ~&Q2RdNkg.CX3"H5Ӓ@ {xmuvNldTH Zz ۅ棣Ǵ.x*'h"+nFٌ^ OOV:/rj.Gz/pXXf^m&?nn#5pj}˽ǕmToʵM_iŴndi&![5Ť5?p2#,^)*ZH >LJ/oRPw×/ϔܛꪧm1T7/-uXP:P_ցZ} WIz] z7(˵JJag_CXޛTY#6A,WZ|bԪuiX1#C\CdM}T1QSM$|~[ث C<}W*`fl >YL}cE5зj:M%JmV*@ #j?ץQ[{ OMawfŹUtX_xPiժ5Q{k&+ Rǵ'ʽA֦KZ&Jf?=e3ѬMQ8GXٛ?\( $﷒:ףj %GO|GX,bvJ=)y^Dg<0>v%H0d&1 Y#8f>.8$OCMs(}+]!|䳐Skz7<`cz%sXjÄښdɎ)0fW;օ]\CFӢ,42<Uk;Xmk%XbZ睼qe XUP^ڤcǠa`j1[J>rFK6GQQMreI"P)8BcR(3nx骳yy^gvqKW&GjkCr`7ov M/,M-e qK%b=%<&X_5TVH^FL6 |kXQKFWcBzj-`niǥY\צV==~BzZV9R v3IPcbuUe 1TA?6~;}58<o6ewSG]\k#5Pe) -9{nۣn ;VC-ܣ$)]5#fҴhaW#&ZwK$kٝF@NMwow .;z{_Uw;T͸E4 5NY$+ -7cX` 9bUwnݙmۓ۸m;m\F9vҖ]~K-S*$p,D39~ܡ6ֶ]au) h0PBt t97qt݊Ԇp$U~C;#>ͯٛqI=ٙe5s|4tviQ L֓kKWOE<"N$7K IJRZD ,<?oE2^L]D4FYuf'g2575%frqW򵴍rdu ěj6!d TоH JܚL,J]nmEﮯguRJзWhc+qy2/PԑҒKƖuYj"!2Ȍmjb[Y5!'vI BKRa}$XecnAJKןSS|>;+ISIT^SڞiJyc-Ep~iwاSS>HWGH.A*PȄ0J|ҝ>Ձz?z/XJ NޙLMU^Beꂮr'lSHΡ}. R=1SQr{~9;yfZZL2Lj,&qr4ҺÔ?>aI!I.,ԒUi*ifZ'4|kU*R7k`QAsT,j>tդ pܦ+' $qia\2POԀߧ¿Tuycxr[)& D6 @iE6{mݢ3thp_IYimZbRhtHV$H-_uC=M=u:qR#UAX]RYѱW $h_ؘ^ZG9{_h%Uu']5cu$0~[}}ӎȭ_ر) O")Zzi`dX%[MKyZZA7_ŀzEʗum<=&O5W!TB <7.$2k$g}/5~O>ZK}U& Z;CDĪUS9I1oA">?VbWG]$npHfZͻ}r+&T2I/7>zz{tursLpLnJskFnjjQĎ?]YMn>f#ɗ_#Ez,#:N8d[FULuJxbbuButw$F= 3ݯY՞\1ՕfXk V )ҤIW@Ue# k7@>4i1U@_>ފOg]Ld[ lWdl4M-&5QfNhB_ԥY;qe.?#I1yi&hg0?P{,u)VX5*6JդQVdi)j"',R J>b>$s=Um-~W IXpJV51J`P;nKM܀i;EvEz^Ԏ bC敨fzmODټ[V$2==}$yVF)ZE9ٹLe]<~Uu2&3oS}/RWW)),C9o?~џo.j?*?oLU4Z\Q2Nަk"w+F "Q*6zX?GSM4Uxzlvqj\umTG9Ag"uLƦUmK,RA4bL]ME$"yi.c ) qsrHSjU3~]rm&{?gJz|CKM5GaP% ӥ]-D<9i*|p6Yw2fLEd*^6Y"~!1UIјQz; QQy֟?ϫ `-V*IH?S6;ߵ\5.;omLw je}QW ,S_L Oa˱]Q>%}]ThS}5ۃ؟ƇRkm gulNS;O+ 7# {1R6U!v74j?7/cnsH*k}b۴` _y%!_a w/Dҏ(ʝ_<>χC84P)\_'׫r{l츪 KY>J$yMÛn<#䳹7ymdZƀi@8zZ>Xf1h˥GLmu $DP!xCK<;6Pi?ҹ1gVdiCG!M%dž;S\+hK/ [׸__W;䧃m@K)2VXF"ڥ{ 7j%ܹ7淍[6mx]%Dի 2QT$@smf]VY0w:Zi5Z wt LDA=zwR`{2u::7b6K6i&'6p! VĴoۆ.̵UGMLV3M#QAM yc H${]< %Pb&_קm<QpYhKOOQ&?n[.68)e<:AGQ5jc#d2k窲;1M_YHzvy)䕨h FpHn@APkcO,z)dXO++,(7`<4u58Ϙ,} H' 1ua&ʺ(yde%Bj!n8zT_:HE/^]5gv 3}N݉m6hib򛮷'%FNf kR4-1#"E?ݭnh|x}ͧӷuW*Mxpvۆ-dC_5>*TTXYYbY+r\^|nz5o况X_ 9ckg@\U*nx 5xWtϸy`cFH+Eֱ#݌Nxq̛`)Gx)UK.)"͡}nQݚۍVF Os%6?!ڸ9-VPǖ'JtA#IM,n Py\;k+=+hLDz19z\|Xl-R}ӽwd% ;/)]<×!ʟloh"_!ҿdmLh[#_NVVyG‚.Af1k 1wi߹+kjy^TXY@jy/ `Mrڛq$"/Ȝ5}:ḉX5x|z5'***ꧢNcftE MO:"u.LJ.l =fŒ 15I?5Es &DA#ƌ?MrL<9tդ T MJ?3idVyeepm#HPl{/x S}FJR: c6C=ʀ OF\g;1!8؟[u6^ZRRah<*1dӫ:3I#JrKm"cP>\?ՎY'*\=I?oMy.[-= +b` 8k{&:\ە2˝XK !#1_!2VvF__0jemLLp?#~r[qR(s0T4RVf5n)Y*PF܎N̎H7OEҘ:5/HĬ D*Vys\Ⱥ(i~% @U8?:qf2;I#EyBIk FO>6`~-7~*Lbh7om۴U}rR;E{hUG`g'O?r2qzX ƣ|dN۴2d WT2! d'7w۪p䪔5-LPZ8cTX)m.ש,5z=;QӼO~è TԵ|]Ej(0¿=+ 2ƞ2t=|p<~:Kudj(8Ky=ajL Ȋ(M/uV T3SѪMf#iYnM6.ɫ-&k{ -jX~5/#:E c%PI-s]E|:  Ϧ_k]|৪m*,"l2+βKMΘ-U̚*Z2QE$S*y Pmƙ˳X_ Zt<***"DPUTYUTp=IEQ5$ii6rn9$YrtƖܶK$#ZS?뗿AۡQJiKښ)֥ǥ)ҨXpd:YzTƄpwoT էQ㡆3Wexqf r(Y-…$d%bۋ:T ؙyxM+ɠD2$3O)XUnlI,Tʠ)t ߐ: _H}ğhO_F9LՓkHl@"+HT-H#@VZ?+?kM< s$#RdoJS?GsCL5ic LqϑjʪRmp'q܍D_755-VjVa`|ee46aoۚTkמgخ~"¬g)%q-l(Z[0 yIߟa|WO#/_WSk5x|Z+S5+WN+Ntt-n-֯ AeZSǼQm@p Ձ 6+~a$HYv6BHu+k6tQ ?\Ci Wp,܃{#9k\/U\Y5`\XjQ{WǾd E(XjGp}MA s̄Ǯ(֕U0ۋ^ߋ=[4@+J{BS+"=rwP#bS$ 9ok]}sԩpo7Sno`/-}3dUyVߛe>n%A n/1)OpW #B0k.np;sާQ%#WzՄg'?xZ+`Zj8o nQvT;r2YnޯbjgӼw Ӂ um?NvwNvN:'0BI3Tn:57Ћ{O>$Dʿ[c=>JY$??X;W]9*wBE;bZub=OlY(nA#ڡG-l}<ݛٝxIUeo[Gp=!?N A[{p-8[z&}/*k*MK]oT!ۻSjx#}$Yͪeh.-כzȴ48^7 -> T~{j{;S+nYfS'oϣRfkJcVC |lt|nn~4fh겕sPyL8iYSRSQJ)WUT[U_,2_/ȋ"l!ZpESriehh+f(:J9=A(\lTQDVQcǍXWUɚ~Z|kteI*0/;= O1U2#s,Ļrn0_- Q-:chZF+ƝK]߳Fܷ c= YhRxz΂YiNn=B ۦ1#;lrd"ޙGfFwvKR=ݵL.o efn==;Ec25,:VY #tFiy{WrLpXźP*BvD!_H9ɨ ջEuh"G @)A8U oFzNf̚M._znjuLSK4c%L4t va~Ts; eY (%gw-fJ5HTEfBiUAسwKGum1DAH|0jz>lpܟnvt0sf]OB(=}?'c1Y޽ߒacVJ*Œm%&:b 1Q%LsT^_`/hgj{5ٝ =ohu&[)8'x` X~F2.[ hfd2J0cfbt5ZYt4:H#cF-qlk tNR'RCi. ާܻcV{{^zf-CQ}J $TL^P0q7Wgn=KCj34^m< |R=~/Y "īi`ڠHxxH<_:M-uH)宔Mv ~תWW1P|-mxHl}ȉEnz7Р+Tuf4RhCV6n>ˮ:uǍbh1)h^tj*#KY@_Wy.2F !WƧ4%s;]seq|T3Mhk ИLܿnbZx䎐uxiFOh&Zw7+ኻfM)F#" )oyoj>QŚ[BqdƂH+ӕ[j3s`RZti.ĩʞ'y~R6f^h#=T7=ZUd21O(Hݛm6i_Ǭ>DyVVi$mu̜ƻ+; jPFI>g3-mC+35;BPvn 3 ɼu+Sa%pRD K~Ta$. -*AO6_}9+=R,u/XvSaP5//E?n=bZY,'Osz7އkQT[CIWǮ`Ⱦ4%WDd=ckQ9:%kƼ@*7 Öv]na@P(5W4¶p@ |qMם[MݹTa%I7*4W=*ii.bw]6CCH'%Һkxii?(^U_cEq͛޸G-/P#:¯cMW%~kqS}7,\dԿdBjČ![%", c~wsX^rRm^չڬܦtdEhh $j(fi#l+cܢ̚xEc:B~:B*dSdtU* usڱ2/{:'|>"/MZUZ?4QېK,ddH\G'c%r-SI24>| axsH ZP +i옶6bz]>۹ ݛ.n\qC)PT Fj%R"E$ѳo-Yl<ՓSjsWpg`ByoQWPВ>ʃp HoWp*C11$$f@S)՝X=IsnmVKO{pv*ڡ_E0Nj3)΍]؊-`TI^D-}lD*:Fcv=rO|KB3xLm^[oF+1vRV`* K2HV){)bT1"+NQvrܷF9r4 phmn Q.Ȧh2\S!䡖gɐ]epNُoUnǓҲ9CneY`zSJj}$,z;s %{[555 ۧ-2tu)_5QID*TF}֑S/ i'  %}{pǥ$!,8F]J~/{GFJPu?fB*`viEqsz_dVvvWZ{L\L.m%N7I5-zE ^4Khi@!Xf&Mj*hqֽHovw1XbjO{?al=qD7nos O>'?'Ú:ӝd䛟s3yYF33dyc"t m?qf{6]n)uWMVLS-R۽ڟƕS|ZYuziV]4 6vJ Z9pk*?`^Gm^]}m;C#Y.3;1KgN媚lfTFu:x,{y+ܝi '2q5 / 8Dk!*jTaRM;vK ˜MRЎފ=ݴ/k뽥f*)6T w^єr!E{Ñ|~G'\T1iq (7C=m;w1,8AM92xVzҜ~uWXHU}rFU*?ivo\z~G[w8^Dkgh抲 6gSNTORZYXJ[ط{c(ݼwCWOCVF:N>:*OuTT TOS;ZV%wnVdf5~)Jyq9 vOUcW~>3upu^/5ul[A*8\X&{?CO%-<tS""`{uoCwzRS|ڻzapE/C]fI~Qb_BW-' ǃW#sF߱Jo&DIⳗ$]*sâ>V'4đN>uzv 1Gۻ_sg3*˖=Zb閱(0rF#ZA3UBzKAm{#!K^mQ ^9\b$UZ#,v] {;umwh/\]6#dҿV@ƶۂ 8 xO<2|.}5Y;^,U5 s髩EBATDOɀJ=GS7`Ve3S<[v[ y_EXPI6g>;>m\#ƌ6W|Qt!H R*G Tt7wN1KUMRY)jNRzw ە'M_gxVP\U #YPg9d*T*p=K;db%1Z) ѦEĜ6_a[wIJiZ4^^?&fdb;nXTTcri -|.6 g0"y#i2H! 4MŸ6n:i!z ŵjrL 61Ap/܋USw< 1_".|fiіv妡OA)Y*ygj%TNeQ$$Ua =[ηvR2ۛ+w0g%>Z˹s3HBMϹN[HѾw<@-hҺ*WT/] @FA.So1I?XLL.1p[JX S> kXX{zo g]TEʪ;ϻqu{^u96+whGctq;1i~3hln T< E͙_ ׽x!kRPw}'6对\I|h[qi--ItuԴ̦%hߝ$C%&%*-MQ~-2\n꾱Vm8D eD!,2FC\.ɻ-ʭ)I&PI9MI{Glj1å\/)| 5B Řէ>]7t.ܸۜ ۸u4u4 +fYTO%%-<"JZh)BƊln]novoիGmU 6ޥpPcH x!u/vv[ߌBGn*NBKWCӒLԏxbέU?ƒOv;\Wƭv~"H+'{Nc+J<VM.e̬vUֽeO䊋òqQIpfƞ'_6GcfwN&B_T*C)?mWbiP+Ж)}PcH(j"i4Ե5ɔb3V8ɗu1SFFzL&!֞EwmbnFIm&E(b5sHf4%GA<=?q iR>.4>ػIO 9L|Ztw6{mWn6+ ܑmA%Z2j nI?^}Ąݛ2}cf W9[z{s`pԵVen:H(RBV0r+{G`l9ǔB4%(ҺjK^|r4V72r&7pA*CFG5V@poF'3j_Cee흩in.M$ SUW*j ,Eݚs9MGYpCQSnJ,-+y$v:]G,uo 1fibE=]Sd&UVw N]иnx/suRIU6PSSSRA4U/݁Q7wu&8Hqۗ__> kGRoK >9M3}5׉-Y:yU5ںE}G7hr8fr%z_olbCC"s =ǰ7+tD71d5WpkákRk/#R-)E#xU24*6uZcUhe{:z=4G2y<?Q$KI$Hη/֧厢w:-05$ KMJK5:Pīl,l=_hcXN?aaX >RMRuȋ,QNd-Mw7X4!%*?jUǑumC˥69v.1h˜ԎĽ!w~Xjk}x3GQna$X92u@"Gt6V&'ٙO_a'-DR2r6{i'H'ikS8 ڟ6 >ΊgVou,M%KSn&ƪeC!fq5-vq OG)>:|vͷ?6+klq_z|D@ ɹrS,dE*G;vKh./.x ϥ+@kF\/(mMpݦiI f}'FϠ/K 7%3(&54X<}L9d.|6E;kQBT7r~ӈT\4 Ie`āv'p;5n'q2~ਟ.^TWÆxәxhcTh܅|mmmG! >!e?x_.l;w#;^\W>|{f۔L'6~ݢFwNS#"I?vD/=TF_:֝T/Vahekz[2ee4V$*L`'Js#!#z;~6gÍIFYqY?3i(2CtV&9Yyo=%+5zX ɑrtRu7Kle!z6O;g*k$yf񼤀<)U#=9fbȚ2"JcET:ס,G)OUIiu$%N:Cퟍ{ݹ6Nj1CjǷ$]PchC9ݥaJ'y\&ZQUO۟+QJD-{i 2B=h;{ɖ׈fbJ%@8E~]qִU)QGS-/E,ŷs0LiMU djZyfG#_ǿ81 נZ'U_t_uvY |t>zʊjY 1Sh…PeΜED$)Go@&OWUaeq[iXYʿ?E۰0,q6S{2{\Pþp1?Û)j0ɡQZW{s]k^á1O?{kpMG7%$Hx镑Uإym5,)u"`GB}٤[eJ(*U"8=8t X#nN}< mYxyy QF H<EC7W'EZj8Ž6fbZtfv`<$RԺYV5=xpݗ= 6ҭڴN|iC$X*ۀT(P^ci⑏vH S W~] dUfkÎceƅE32_ESٽo'p'zvVQZ%Vϲpj(fV]7|g5콂#SƹĭVs!rl[ ӒH>Y 'ѳ#/sw}\=VP 锪P멱t/: bRX]AYG%Q,UL+ V8+++(ߟp&%ě̷pK ?z wWI#jfbYAFW;:jQGj8P l]:D-Cv I5b~P}3>+ܿ 6<9PJI96˸k@K!Pr/#sfkd֛׎2[(J/Ÿz5ym~hYp/X|ɽսMʌnN<<~L%KU3DVI*g3ꮺT^XӍO۝ر&㣒';lLļ,QeV֫cך`6鐆}gNToz!r* MJI=9~ 7 loɔ;b=N ɎUC 9xyH.ttTlZ 7?B\ qǸwwjF}5{x=w ԵrT KTᦐrũ5 ýrK-=^~TdvTz֦Hm.)v/1*3yZ;"t*shϥ[|x>/Ciӧ5_>^wfGY]tiOEB&] Xijq%jKK&ECK43dQ%)s`ϰu )oiM* `Z1@yqdxbb^8\FrH7m/o;'ܽհo%UO5]T9z* 㔹vyWw.E-"AA9mpKq-¹4Ӡw3!^}wV_w+Ih)`epղd9oSD)TB@,I5_u-{SI`5ܶ ܈rvj~[} V-][?0_uK<":݌k6p5zG_cGK|MۏٝIy*ۇoAۻt5&6a+8ә']H<;E nJF P<<4 l웢nVV7fHIP%tkw(oβ{5mQQbjkPA>kmmJUN5"=> &or3E1$x~5xT@7 q?֎aqDm(#RB8Z=v}xz(Q{Q[nNǚYz>qxsY-Py uYL!BtP)9Esy*<|O,GHK2ae7)ou?<%<o蝆]"?tiy ˆcFze汒,%!.4ٔ϶΋RGhRF)j$&e O{b#/c^Ub>}*SӼxHksCU c΢6dR8[} b}I[L$rF)[WS2$-f鞏!OFE)e # "A׺7.ݮ|jzMahNUȒR_\2,A_WSm"b5#Ytudؙ$rJqx5`[R@&1J,9bd.Sn-v*Zd-E*] R0PG /|GoO5x T%/:gm.,C3sάxSg` zy@J,ڽi˛7.+D@oҋ0aĦ\Zݕ9&Sry G̫zxH37۳ ,4(+Zn)6V"+Q%'jN>* [i- <>/Bmˤ?\ttqy*,61cmQUQV*)獏20e7֏n̐"QMJz$hT_bYAe`}W,G>Y7[SVϏԸ'd:oo=DM!1fCU59U%b YH_hJ8=VN6[x*>c'䏷fȘa5^IbOtm}E/ǎH ^x?G夤REq:Jp¢@M*-䑈~/~g_oXer DM,ct7~n]U_mh&+]jdV??1UAtݛ_wn6=h76"*D:,Ti!PِM"QSY5i,\ >?)|kl۽1Ptcew!L4ਧ%5GW=,lIF;Î}E~}"b PyW?mAM[c}c>X*>GW2!5`J.R$UX8))*"Nm̌5 <3btY%%B31"F   (!)z^_K$kro㩲K I*+DSS +l5XPE8L3).~5kQMZ,f#iT HQ!uS{4?>ޒXv-l2?eH>C7SםŽz%&/[q֒*+f׬"zCEPMu\SIQ*kJ />IuRUhǤ :V3{yVRЎY(IEiW8#gg &kpjqu̕lͦ:L>6dj"EHoݢ|Eb‘$mmc2SU&+kfrrHfxS`Z_ƣcn I&H TOS}0jOdutH;PO2?UqK폒O!P6 S$LVYHnlk .;%v*)%5h0Ո) Hkb ćZ>n zՊňC&^zmI5fk-&^:&TT.FTMOqHOm*r&96~^~xp]$__ .4ztl/oЁEURd0T^2E<ŦS~/L!R^e[??>բ n٥Zl#Fд'DuآVboaF ք@B yުH)j-a) .jm.mj'AqxϹNTZJziPV$(g-8q] |#ët\ޥ5_jkO?Z|߇q|/} D9jlKL|{SlǶ$4MQI/}/-BWYh; yJM{q04_XJͺ>8"Sbۚ7 6lEjp)n`dPj@j!Vxgͳ0_6cred.p%T9ȦG$i,Q$nUK$YvfNﮦT+-Ej)+rtx:}_1nk]^U8fo:|JYT3ϤXrM*-d S(GD|jeUn,}y\~~ riZiZ8)t+c;[srk U"fN)}E%ܙ5 ?IP#j0W $7ilє2SCI2"-k22YXۦѴN8pm XW=r]\9ߢ˹3jjE(JgNPUvf`+WySmM-V𫆶X*O VSTq$&o%ѽdž8@>_PʢY1鎆j((W.c%?A-[oFrQS8$CPrs,TӢ$l8{(\ä*</_vv s[K d!S[#QCyZ)+) >E3yuڡ7nF7Gk5@‡J" |e̾A].guHHS8Uʼ8#yŐlꭨ A;:t SG%H&iAl450_;+KS&ʪ)eWVDUU k]=&}_>5(U|*Sǥ55:) M1qƒ*2{{Jy2eV.CCm٤I$+_#T$ܭ:tW'8_=3*F Ǐg׈7i5"d/ugd]G_]E|>o_kj}?cmmVuxn5_i?gMQʵ' ~ Af'Zr x'EkH .ҡk^ōE2`-aaOzJwSө-w,7!*"ĭ+I!UMuzyHa^.9K!\HA dWFve~}n8'UDcKy ͸-(߀G-ՙ% P96o|0=%CAQX~~T"i#A<~?^a5pn\/vK[o,I뢥يMl S?= :M +r bm+a<}*0q/ZZ#-֐>.^XnӡO/4R2F R t>#(bct(-bn *Esj8/}o{'j놂5 p, 6?(vF^;$ )66׏m=Yկ>B4" !yHdb[zo`@t(+ mJSHƀm*V ci@-ӤE͈PK^si%W֧PlHm$H>Mu׾]gkZ7p )'KZeP)bOoE~>ޙ<: U'U“~=B/$/aeb}KS;m=QбknGZA2 AWn 6U J' ԣ$ŹjV^ux%Z*K tgpTad^\ M`ڇo|LNeP0f&4e5 $}?IuGоg_?X$BI<3'IpK)cYD"\̤)3Ï[i' _[UءQT-`'BHDqHG,GPG'}#=8$vR'h#b~FbV9> +76lN 8 !oS%HZ u $+ F|Im,6KzG:VR9Vз}ٚH:z9d8c=cҦ0pjmpTfҬ~ƔX?վTxC'"[$Դab*c_ԏ}QnGU3(ÏXdryHH2gbē"CX1ؠ:ǺJ*)=ZX=4 FH^}Ʈb{ŀeGGڒȟ[n(#V XPc/Qh |vl ꌍ T u[z?/(b2وX.C(oM\M>Gjie1+ u&ZŮ?k1q?TF;D2RJE$*A&_ JcvG*}W19h}OΧ_g^릘]tcp?2JѬmy:OnJW\:58#jW*nbu F"QoUss5-0F,CJ(}50} jJ\zڨRI9C77!גo||mpu̬t)PνP; ~chմɬkN1Cby[ݖNY 8C(?OiA\z97EE$BOݑeWpu&LX]F{`jL}AI*KQD #0&2;?T}V='_qI) ~]u*Q4"l/}-KNV*I YKxeX*U.;Ib} gL4q?l4TZx wYVHoP" _n_+J# *`rB@"xQV*jk& /]¥_T0T*?#7,=V4Gi,_$vMLP9k}|ѩeI2TsvUτmqFff?0T"x$$X][ּIbק@;O'վCSCCr|]ͷrxlěgS쌢(Fc55+x2yl]DIZ F(IHV@V) ^5sk%˩uKzDpǗJ8jz*ӢZE`%e> k.C!C3H")njp<[!*p U%`8|K\zh5Lu1 OoLL^ц .:d G#RԻbMO這u/.G7RRg>jQh 41r;Q#y! X9MȒDF6 #-nH@ (BO:sǨ6ݤ- ^Ҫ, >di$1fc ~3X jcry$к+՗5+@[/&~ė8kLrH,M\}HfS>V.I%Y/#Nuq7mi{ItY*zjbR)멗JjT ^Ċ\2;Q4jjKz_~Z\ Z%T< q-"՚F BId-zH W]e%MK31U}1P􈟠^ogd2ʼJZΞ*U)I&JLZ;3FCE5)CΔ|QWO h⁄4Ϫ,LLzsB? +pe==:2%'U}R WO \TqRz^D $LN \G$)3F8'ɹ+{QB(XOj!iE!BFQ"K X,/kC͚" PH ]G{[mIzDdg ) CȠj狃gcxDj$U"f*YQe6ǵVI‡OL\'Q[? I%:f<϶1Ả8պF K^8ASoj\>ֳ?SN5W_ȋ*G+ݟUSkԳ$Ưl+A:G~9~~J|:ŹHzh*Tyaz4xH` \mck-m] 88EU[UI^L%xx"$ Y)*@:He4y,xUKH=\4!?Hq7܀M 4T ?dž__y"Mr?ϥn;Vf3kfJizcMxJ޵ bЕz[E]MDidt0@I{ E5 .?~}-̱xTӂݘVj1GY u䁭M?FXXQJT;aRycA~,~A=AD'jt#%<mJQɷ8>{5x)TcZ璕S5k` .kY˓/ˏxĖqJ*I'{lhuB$Ǔ!zeOI\ۀGԮ-[Vb\]l_Zl68R*ꢑZi"A}L=^ݵ㹴8B)5*8WiE{|Qռz#s_cM,XI#Jܞ9bz*iQie1!d`{/34ۚ<ЧIk"jX[Dm4 /Bpɡx c=Ӗ6M1⤗_t}z'"4I! 8C??3g-r &K]1O\mյvhU*U],HcGhwt詑(qœ:,4זCO;(@} Xg8%ذO]Ӧ-I[jI63hj 1_"SO`UdmF y6 q]EzJvNj"࢘hsw]RH0je05qzzkm:FbOǁs9L&SUغzIRfZvu<߀xqlD9d%\h,s oIYՋ/8nebVҠ`|=:or} zmKO Y%#G|R ;H&NvRHŻ2" }%ؠ?׹*jd *(M^1f!$>=vZZY4H:Rs`y |9y_u]-R̃zuh ҕ4p í_+]IE@d6e')͗ՔOz1Ih` uXefxh{Wt I?=&Ƣf/67zC!F7t2HSv_m"+ 6ԥ=،;w8ۘj~f'I8|c Bcj1d w ͤh]?xtŤAIj6?oH#qQllK!YI>xQ̊TlEqtRc **T]r;c}-sZ,UV{x'ì:߳GM2]xmYe3rI$j878y9H62'k ZJCz| U}8S |[ s)]Av_QFFu\v_!2Ql=5oOSM D,#Kn>3*APVǸ6Vɕᶡ#z&~$?+oD!45*%2&(\~^?X^ځY@ağyts~-㰣inmӷ`;wKK#-;ClPGQEACHFI dScy,i$DF7/"0k Z a͕F6Sr'M@}rn ^7jl%n‚l9Ѫ U^ō4$(}?g33TR]vJ\ܓ3 scQ%LЙaX% #,vU[[H =%CK#667מo>9]W&Q%EqTjgZdLePdTΘBVL!|ĪB#WT醧%EZJj R .:*[5j gzb\Z#WY[Gߵ"H+vz$<5$h;Vm&` G *hߙɯ}:+˻+(߇J U}7lPkj =ɗJu7559WXb_H޼`|-V'1^jzg Kr #%2;)]OC%aR|><=k}@*)4:pyܹjZyqw 4zUDUAGaγ!=]\u5kU~D+OJS* Rn5I>R?z0I#'_ΞЖ,q㺏Q}NY.®ȪԴficIO45=?XMjZmLG!@{n'oQU%jd^3J}Q5K3X+XۅSpUYݝmb)pbF :Y^WKG` T& G$ )K1}"juxLZ%Hgӏʃ;jo)5Wf7Ȯ]g7$n8TtX ȥ* 2*ʆBx2`匦D6? ^7ϥAiC¢Ε̴Tա]?63;)He6sb)^4eę,%SRD}RA9 M(cuDnө׏\j\u;|4TePA`gDN/ >uTXo8aHK)N@*:Vu <Uw+ٸ ċ$9^Θq??H*7z: = D8+B4 3InuH'I)A:gU?hI]4]s9JRĭ$ǦIKk'Y?Q1g}Id3QĂi 'Ԓg554'a43\@:t?,|ՎFF55L,c+>ٟWk?NlEϱ^il8,UTi%DV=3DxQ"Dlm~-y7ӥc '9494zcRc)ja Wz %50;7DcE!i5pG{|TYhvTX:eۖvd_1F"01g 8ͪ!| ɉ,sIBz@^Y εgzI$ ͵R;^Γf盇)$Tº$5+ x}^fT EJ.R1x >Nzd[hb8$T~}HxS{%n\xm`zS%UMNK+3ܓhm*Y0SL%1.e~Cʼu?W>tӿU! =.ؒc6NuOEN\#3\F6s!vzucƟ^{ݗw?>cmWӧŧ?۞]-^:iޓiR뇖/ѧ{oǿ=6ͩG*OY,'Tш$[S lJ&K-NE*:y~]o،aH[¦O~TvjSr-KQ*TFg%b*- Iec#0/:uUO}18[G0~Q}* Ѧک"[+c<f[K{wa2&7\/M"O=Gl@~ Y5XK,$BIu6Z45z'`>–Kq>W+oKM$+DB { R(b{EI?g?1nDo6~%EqDnHEcy?"Kn ~- 5 ,(r]LZ}uY S(G|&>XT{ܺfXLd`&3,,#kس?O˥q4oi$?FQoq-{0&>H*I#A8`M,6@~?Ve QSN0RyĿ>~}n?,%E:ʓ@iP"rqs\|uaRԈAͽNi:ZgIYV]eP"j$^Au}f|8Λ ucERY~޽׾4hTH%ٙX vm0OBM)@[|?±I<ȸmo;NbD>UJʫAiۆ<%/F 8^JQ—ͽc IZ(W & l|ꬢ[im;N&6p"eJOu G" 5-ڶ}Z*ҾXW^ /#{귻rRvV?jYju _u4&#I=0?cnI ]j#Y), ǽne @?^iZ t1xu [EoxFF`)m0='A}@>ڋh /P1_{^;TiMR=ܮCrbQ$)/i]k.[Bvm}6 7\JKOr)gIsEݩTP9wE;F^+yշWˀ>X7] f8p(i-<Ǔ*®HȨ;R ,ttA7&ߎӷp0?T(vu/k}'H7z bA$!3%D3JLmH,# {ڶX-+|i Op?VWt)WBT .yӶWcc#ye 7ܑ$zsFUʱ:)!X1?KwNZx bPۏӯf9n3cG٣~咥`7+Yjb \I?/mi zЉA{f:KQC{nዱsƴH]N[:@έb5ŎsVx Tu2@Տϯ ʕ/ԞaM{ndō6~zJ-ΔڦN#/zɻtDĩVS ziZu¤Q Ev+GSP#>_NizzP)'4E~yդadt[GoJP|?oƛCKŭXXsooU=zy({s< P2QLybpRMNW&*` 39:C*!,R8WW ,h\zy] :~I|}c*9c-T(1d,pFTp=k:jGQY=4m`cSk?] CJ7Bܽ,&,UBT*/#1Y~[$G_I%ہ_\3ozNm{Q*{DFO2CUNʺ" *LR:]-~kT=5>롊ƋZFH hK3(`V *uEݍkz;}o=zL-cO?:c1QS_|)~=ɢ)!mc S,LcUU2E͜5Vk=%j >k$D ?] Witr<)bGq^Z6MO<%)i˼ \o'bU-<SYur5ƣU&gV7NK[k{½ن8Y~G+X LX#*ok7YYH+_yu8G;k}V#իieujZi#/4,tVaR:5= @#_oNE3H*WH_׿J-m~{^¨viRX6MŽx_ݚw,!oNKWAp>GN kXC솩&9ёfI I%M<` +=;F<]2$X؆S~]rrELos]4tMR1)5[!DJH )F@CkvtOO_+#_uv>Ɨ x;G*9N&Y$x`W)hYB܏lP F>ViQʤӇ^ }mk==O&/c X]M;ZFGooҁ$CF.pqzA.\^5>T9S{o7pij4`y=56pUW:SBhTU:㉹&ֿ>ݻ9!PWxڮ844d5C jo>|?Uos,ꢋgN,}())%wnv%]µ2F>X|Ĺ[hTs>V5*-?:2hc<=:V6R#x#i{Ym3G489w|2(+$Fҩ3}@iajWPEF :Ǘ ܷӂy$D~uݫguiў*XP:KjR+\BoXBi_1 hL(x?QF<]G02J7NZڵi6{@#"_}=$jcmOǼڽ*k;pmZf&?o#DBWpݏm%__gL v1x,( q{: "}n4uAJ}ɑeX@G ~X!db_+OzcG@ZJsƧ_ܚ^IHTB¢($ 7}6W ??/u,(k\mpv5;Me #(ގWۖCY,U"o(Տ.$$i#O׿c*mDO.H=LݟWY+SAYGmLKĪI*;[ KX#ӹӎYg'WΝu/p~Ɩnpm{.̍)=!y!eD$LC,+2ij[-V-O^t Oq ) ?s5 L$&qK) depm{pv(:Zyt@/M'+] iu_ ` JW}㞞1,!ʫ7R_~ݿwuBVî7J*a"=VXfYs+ȾZ9c85:xFPnARzRFE>}t1(TKKXEf&pX"XRfmr2VM*Uɸ\],bVD6Wmm={f>T\r-=w7`T-u;</o<)(Xf41TիHR>]ZO ({f:S<?^/'=1ߛi)2D3[PyWzRtZ?)qpg)-{ֿU/jvYr{36j## zIM 4gJ$~J6[\ţA ӤEUYJoN8qA$„E$}͠~:_Ϳ:JW+_Q7 ["PE_ >'0{pPJ =sA{dU]R)_\}H6|߇~Xɢ Tx#>_,LV6Eh䠤i$:07o8v5eF'Ŋܰ~qԀجܸsSU1i[Pi,d[ɭEƐ6GԽ"Qj<A[)V7^êBm5C QOYI\04ǭ dw.պhueOJ,p؛zE $+uב#ޠNRqȁ?Kz9c"qQW_禞bnނv/i,Ƣ?mjRKG&Wb ( ^._ڟlO]k25;pWi$5ji,4xoj]%^4tӡhھ&Zϥ&;Z9\^9-6Il4uX^QObF֦p4%Xm۟w,ETT5Ռ-$6Ջ^+*U":Y iɛ4]DUYQ#r]a|>{Fhى98R1S]8 #Saw-M^u%91T*qF0dj(1b 18|6oWvFWAYz`{vT!b`SN^b=6dx57V>\>yt$6YT>M8}zhzsUf%[OASsoG>}BA*r]]44;w}}]n)|U4|LZ3_wٌ$דwfysD4jl?GOD%U,`o[l^8q'QB:|CocR־>>ap1V95RJrYkժ7>ɥ~7Z:Ž1jWbe7(q &Y:[rvm@$?1?=: (,"JHSMe2Y' J)"@W;3-G:jWTCҹc3vc\.Ƿ4%_?Bh@kTV*{ zH͊+ݙyتY",gUT06P6k' $wV{b9`</NCagVr(!`*EIC,op&Pcm:Koox/k墬 熶͐Vttb"H7oMϷ۬e8x|:[KnR¾\NTm:A'&*Lr,E6[DZgGun\bmH;'SU3]ŅUBcԮ i*)c}qHiPO@bh#xQvn_qrH|;#^TS{Ny훈}cTmQ5P0SxlawC ,4tlv?-;9,o4r7ȚC$r=nݑ Q?h?f?$ Y:? =OAw]n:͵UY]-]n&<ݝ[Z:Zg~ Gc- D+O,h*VJªkKN6+4zY~}s?8VЪlxjLטWBHfDCnJZ7 =_t'm@K>=omH?o\Rڨ)!mQ=AS{g{Pw&n=ǐaX2u jYd l̳y\m&մoasq$zS&zyt|fz/ۆ\VgSώeio&fmXڻ?w7N}ݙ\^"k*bڍ|'RrBޡ$dB} nb$4^ CA8V:SCvu>⨠kadb j!J)%Xᇴ}mw^%U-LBԯtSdi%&@H݃`mկKxݏWzj?g;Yb*MA<-Z:X4sFtr)>2paFa;l7^&i1̕_"3M%ԃv+r=nܷa][ġ%p3JZ=zv WDт>ݎcScsw) =~k`nJퟗAYjcf*/h'vP{Lq%U5vr(r:&թu0KHZ#Q6Vm(z)X>OOcj ANiTp?l]5Y,z1uV+IWGVVFU e_R{sd#纛{)6ysuRdvygZ]"Ե4n:D{&ټ?QT79#/>ԞpZ$+b s&۳,yhyomv큱qRFhief MI4a+Woˢ%By4x^1v҇R~{QQj~Mӊn i<5PЭ nc}[*O2iEsL[؃6 ڵ^Pٰ_W53?Tj+tqi7.Qk&Xr85n덌Q5I뒦H֖bFK$Zlۢo zr?m]ڛʕ/Z}5 i_1?|Iv~3nn#)wNۯ; Ks2tYKj4ˈɍk$-LK8?p){3ۛ2*zWrxIeVV_e p@miAlIk(lgiZ?  톋1Bi42(daM(لè/l8yjuDݍz %M}U x2eUT# ӻ4OvD)7,ͷ-5?t6+RħPjҜqytдqa5?rSCS_dCHCq $r~*3T2PemmHQ5M;+ii*@Z#D#b.ikcQovۘT/i*;z_!QaZ<5c3R1*)!Z)1щǼUwl -Ƿh*Oqm% e5T%;-$XkkiU?l`SSU7ȍ[m d*8%`:Tij\)R\!`~ ]TUϽ.Z W=NRu"tQg) K 7 /EU?o.[EU~u:czxc24Tz]);zZxg? .-JʬF$`8M|?W|&arrIQVƚjW&9Qy;aM;@Oˠ߉y܈nڨCݫ_x0QL)h*6ࢮTSeh$K b=m%l:97fg$)*+1YT3M[2TʈJK}QH< M .R M;~K= -.RUYI5:FsObZ_dm\n۲Vjih17Yج7tq="#eTE45RPY8K{$h|8eWQ'o?.OxeT0dtaV_fSwتh2Ztz!VLHF\{HF_Ϧ_- N><΢"p΀@\  z?]osd+`{ gqb2x:`*`BA!ʅb]S2I؋ *'Ϗo+mj1T_= QWq-&d--E5r/CJ4u .Jsk"];yk}Wc5o$x@5;FCuUGw#|H=Y{]Z3jd|ZŨq~ψݐT|mRlf±S=,@~Ti"ҩ U=-I3fL unv*<5X  jĠH2*,W-ﷁ\O.i-8F؝ۀ,qfqM,)FLsP $ ]BNpmY7 e5N&-щANdƠG3Ckl;pBIMvXi"5OW^ە9l=>㤖emzz Fux˩P5)o) !G& v 잫]6o]V`(`zs[?h{!CuJ?B.OfKvf/uv^dl|Uv Վik"9+UT# G0kU4[Faz6Ϥ7w1f"%5ӏm^ޔ5zmLS?IewZX"l/2nNl\R%ڈ8:If$yIad-dbK\}ی&p^7^@2ѓTQmXJ륊4~S+* ]]#.ċ8W eE`$]I KYE\"xi*|$u!TUFQboʝ_=D.RkԲIO GG"і'ǼYj鞝VV9AP"b&Ej 7{_@^I6{<~~??Xs˥}VZuy!`fxK]/흗G=uT{'t0'(hg4jmLV7&Kq?/uOT%j8&B;$' ^I^{1/XowT5ffx} cH6:yq5%' +^R7)@7.ܖS(5}:=ɨHP xyzpMٴH%)_ O+TG X~{q ە" 0⡢8UuӼ,ݠv Kp,oχ>20_qny 8<\r*&6T-Ms]?g/EN_/:]Tef1Oz[&ڨiUvǷ7Ncuśrdž<)aI k$ UTh;@Qa,?W=&}U| .:GٵqˏeǕͺl4 :rH{ړbzU48,*ٜyS$qՙ L^ً1 a-*PϤ줒UFH45!qduez&F!jޒ?(!A^}|/ݝw-EYT>1Ǣ.Y!v6&bn'rOˏ:qHG *~@vJzxj(e{2}m橔[z؉6ʿg&X֦ɑѡIT4Dw{zI-L=ԫcgk\P{OJ~]%q_4tT OowURdr]q[[uv*̕6 lQ54:*jYwQQh&)*Hs"HB%P=?zzXZ( x kib%EeC:3V!ekJtɻR@1r>!6ZÆVː]<Ŝ 9 ֡1Ī`<HcZ|ҖަVA`A`=dڑP"1%:IPدSϪ5>޻K?Mқ}(yǮ0钥)ZU:aB+_S3·&Kqcj$%鼇^hRX}8o%V?kS,)WdDҰH p= m Äso)i6UG-Ra8FgrKɣS(R8$& 𮟏-ݜ}}4o*j=SQx28[#H9;)' {{ hݛ/r4)_j<~#[pBPudoaٞJю/˦q)QL+|q48ibDPƲLGwD9}O ROW,o>?5tdrC񨩲ƥ{WˊiP^*x*G<8χ>ڥQC1 t|ɤT,OU;>[Ofxe%5E;-PTyHԱ!MY#(oS鿥XƞٵU IG(Nlm4hkֽ{.'ߝ@y$v+&r>O57h.hc{ءW=+?괩?ϧe*n-G$ȸT6?^׽* >޲# Կ:I2jVj Z 6^0H8Ԕ:v}(jb\I>|?VeMDgr?瞠ieksU9eY$zJz7aEMFP*/6l;poψ{nC,tiN?+U?"1}- bA~,j kBxe( Ofw:A8ʦkk jSmUDPcv 4ilQ^F%eS#*u2<߁<1@Ӏ1`I[1_`V_5* S5WUff[c`fb3yh' iNzD7ƫF{*mHѽu~g:E+p :?!hs6}&F$=`H$jOkQH.wa b.GsQS4KM Dp5D2Yd#ĦT SƵR$Fj?M}o|***vxyT9ZW#~a+m$=#StPO]:))\ij1u KPQ`G{Ej3~]i&q޺7qX*Y4N4E CJ5 7cxNu!׸ +S @yI;HؒB f5Pth#:տq(XC,MGY f:̒4'}4Bu߸*$j4 ()5a"(K,-r(Cm٢mJ$T_t3)0aRAV(B0\lxyU H RM% WỶ+䦤)4fOć75Ux|*O:Ӻ:6*!vr*6}x?I  ׽ziIOU-|V  {MK#Tp߇^{\tTC# dXX_Ǭ,TY:bB*ףf%mǯ{WEM OHhajm ,VҗV "?_M<.?xZ*ĕ:?$j 7:G<(餟t 8c0ڣRqK]$JG*DzOkOn}XT| lPDLsL&)|K]H"}gUS׽Z-d4u4tFT(d b^O] ?b(i44+VU9OcS!*x0m} `YmnOdru!})yZuPzqzldLViji6>J9[P+Ib?J4ϥ^4K<(KFG,&#p$0_Op 販:^,&JDFx^KU-u-S*B"EeZtMIZ-O?߇Tc^׽ゥK$0yY 2#4U1(2G]\ɸ\n{t^˯{C;S$N*d$Yd,Ta{#F&a~:#׽ˤ$|O&4ɥEOBHdqu In@N?nZAmi׽j%Q-1M3%HTD/O"yKg:uz KSJiNaZZǢi]aunyɤ4l%Y41MCk$hY!P\-Mff/ϧMg>uz\tkQJ7k_tZ*=٨%Imx>EnUP(x}{םޞ BNO 4if !0uտ*}>]-'Ɲ14y--|z̄TǏ1-x!!ƙzC$7Sq}*de49cT]{}5USvjq QM+̒NL˩A[Uohe] c=0T~{ĕ4IXң'0H)cfK|dO%qk8/NClTr1jhˬ3xHjQse*!%[.5YnnIZhE_{YR8tWDբ  D'M <_J{,KQxG H4/6RJ?zf{5T%1{ܒS VDGXH!VGW[(+˼H^Y>:jiM3=`F! Dokn}[$=#}ж=?M^#T Z9LAO B jfo_۫l>ήAmʯms?՟^︲ZUBJ$BihH"5'餰ě ?h?zbJjA9JxāZX-L:`Ko{06)| PG(k8[ϷA  ՒJI)51Lg** D}}4kZj;p|uyh48d0xhgHeF OOƴ ZаƴC={pT;XB,i%T!$5,l"5^orym`-~^XW҉jp8uq47Ikfew.5-M<yq"Ҿ9c4feƯx|zLuRVRQX!D4qΩ4M+=b"[$`h_>,%YWG<}E N@ՖXd TÓ@矪I$]a:ڌΧ}wemP%bLD*d xY H0-

U԰Q40jTI H‰8}b-ũ?>o⥢D(R8X Xzqbn.4$s~x-==,W&t"lb^HDM기dIp )_ uE*  Pzu~ԉ3V]dZ Af'q(Nԩ<2~xnTK*S4r,iSO"а14gI67f J?oJQW^*Q42!^(+PUd G_}DACҶU~ȉC.ʁ]ݒ X4NTG<'L-,[΀\7pE|zϫ"#)OOylGZ}iKyb WCUAJu4:*kQӣ0H<5սEl+҇nTDCb+^?$ZJRAU69ݷ&ZaVˌͱg(S=$,r}jo$,rX_\ri<ƳCo d|4tS߇z9#_nG1zE_ic,TᬦOKi68 :܂H{f'96㡚,q0,Cd-$x@ep,%Vu`p %PĊH:&bY5Dn*1ĒO`dBJKdkzm_h6\"yYgO+]REJDгk+kxmSfD=zwxQ ##6Plj2t1H+!s ,Qh0D0d,VZX:$y GJl},- 5ҍnrժ|F*&7ob`ljYrԘ֢D?mK#*DrB:]xZ2H*+kݺi

i;o@,l ӻxң- Z7?4&E^K%nZheUS.E>:6+V5T;+[d/UM>C6?pZfq~Q*Pa3Dcyt2$21n9n[k5}EP֙/^p`yϤOcmPT`r8.(D5{=K6K`n.Yi?I(@ TQU(̍RA1]'7mήn3euyhtDDhZP)$N`i۶d^bzSW'qXܹWG-0xǐqiŋܝ&q,Bނ73 U< K6`Ē6Nݏ|yVBw_rCM<K&nBLi*9i[VP ͌_M'F:fV]5 vHȧֿ`zt˴;w:q_X %5]DSv|>ie91X HӂK;km8( (d0ό,ԫ0;®M"H܊]#NW~ž\<01V pǝ:8 KRu TutҮ*ifYT4uTB̒# f*GӃOAؔe 58TSa7c hjy$,J#ڙ.HGӐ[0Gb|_*|uXV`K%MhT mQ >&?k,&.*TȨ2 iI sn5 zq) Ef] :IE7m=U][kl֧ uE!5*G qջ8A%5<"uχ W?6j8dfӖ-d)4>c[IR9Z!I%˪;i `1ܹܴUrc9Iifif \j+kM'ܣ;)oDm΢ U~ME uP=+-$~b t86,ZI#l=䦞hrT$1WCRQաguGM:`pn<)mJĬ~|@[ֿ> 5KSTTSKQI c ޥ`J jhC1=SMGVR"|uVFŔHkuqEw1m݉} _RWq7% 1'BoD+o%INK]Gؘɣiy Ud0< XAN+I@#H3IR$VPZzs7Xc^~]@GGvl'ВG#ϱS}b()ۤ aPKdHİyQ{KqMq i'<{9H$1 NyӠwvVٻ1L %N][Z0Dd^=+:9Oa_Y#*aTU>GOZ=b \E$ {by,jtF;5/erJ83.3;!ϻ0{z9]J, ܓD#tm<(V)+( d6c"6۠u\'*&% VV8lcy[YYmw5>Cfyd6 qUqեK[K %KU҆ITI7~QNJS{ĢQfsҨj,t3$WPF#PDF IG#]wR9i@X|4>f?=aYd_ts=!IH?TM(KB]q8tiOh54,"u~$k'[CQXq/mh )Bp9--? Vub9\cWAO-䕵D!FVDhdG[K+#ZFQSNLKYY<*`u_!s`#֔?,N Xb[J",o`̧۪>Jɵ3OY <*c27Pfd1*ȃ/u*r&rC .459_?g=Z/S]{N}^iji87@ -OW{e ỚBBS hlr! C-׀X1hSWKimǮ!X{F6+b7EEǐapյXcU#4-aHJX,*&W9N u!$tN[֛үu[ V*5JKs"G4H}$G6\hI,\_c}֌KTO-`A-NʼXAN+b"`oSnы}A>oiZ)[YE<\T-aIJ$Wȳ([_p#Dw|U?xUwPW>?g@aIWMjQMPlU鑚im47RzdWfLmVI n~&\Q)IBYI%H ]? m*M>_/ӥ^ZA>VPdQ)eA7 ݙ|}ݻk= -3xkX dNߛ*w1/SN/=ɏ/QBUfvZhO_k5<.GiJ5FVR ^uQ14kwm/k! htխZ3ğCv~mȔN STYY*$z3HY$WQTgu7}B(NJlWbru~'=m-@Ԑcu'&H3 7bʌ/w3 L3苨 I1TT#tYљSօ6i]ct%Tj*MG. *Eb,3}4S5 =߈zPunn KI 8WJZZt"()D $Um{_]G62-GA/O,RBXjq5*aM+qaOpV: jyf5O&u$u^xT5ۚ|~"pn ;i5YEI]4Ӥ:rXɹ{S-6$9 \C#,tt@'K1DAaȶ,=T}zVb_P?XJ<6:%_"KK微@ƣ<WvAָ9L&fEUc(<`DSSǐƺn,Fڤ W?>X#I*3Vk$ $xU$E#zxTP^*5gϬxiDuuuSjl?#}3 dgSRX/"))c]Nw;_ ['ӟL ? iPbIk]K+T,=Z'y4{Z's"ۻZ6BfwTIEHL%Rd]3ݣXT3 &%ҮΪg:Pe8oϧ襪ƱQ ]3yj_hTB?A}p[xgypL~Oi-fJS%"DX+X8`up}X۪/\hLj4T!1&}nuUʹ=_ ,UT -9RfsmLO5_Ve~,|2?pl?/]C=#IOCO#iU0BcVkۊߙ y|nkr ɟgJEC)1 UUfW/t;M'8zEGCM%,zxcQH=mh1Z"dzX+<*&[_]&.l-b\@PGJH @~AOyb&.E P@&?m,^Xi@But3? #/1] ?إ׻pvdt~ZA1dcJ(YNE*ic!YeMzQf *0K4^ۣwav:%8ifimiNJ ?F -fmιຟ`⪷nwFZZzWD9Eϥ8S E%;b}4)W'p>_  _VA?3U-;vc7L{w W+EV?|(ҭ9,Ěd"̫b (rwdc FLcꫥ]驾8zQ :4LLBYt:#nee_5 ?ӥ+ԭEj?d Xd]`$Ohihʶjd) 6!]Gh U2{wI}^#'YV-Ӽ{l-6}., 4.H0,+#|joozt}ÖIk!A:cbA[+37~Z]ai+0XJ*F24R(SG}T+%kZi*rLNG@ua Az\Z+,ExAu $h#׏_}:uV%j1<&? kLHE!sjӇT+rSh~b"J5#LA*nTr?#%~O=VK;0ALd_5tSHt-P}e;SOHcETIiF)jj[JKR^IJw"04V$wboV, cX럹h/_si|uM:>/eM~^qFJ(^՗<"iSp MBs LR")XEj#5y[iQL *KzΕzI*#)X}p,-?ӌp>YPuo|qQRH>v 'P TD`b ޿Wo$9:ߡH&RLO Dފy iT!@<'IkYB( %"=q/LuQ;OI X&VMG%G&y捫$ȥ7beIK J;z!9jfi~#Z(ugQ$n[Y+k}x. Ba܎>ZxS\hzzif ;1i.i={6YeYڢRCi訆uDk*@j<:(z?˯{pP%(51oO%Q4aVe.srQ=SS}4XGP q#Hhϯ{u=uE<_f=9d*N dI!tI&lqTRmi׽ī<*ڵ]e+y܋X9eiNG={ڒrk*fof,8 lIf>_]i,?diP.brHŴ<-f,966 ΣlzL9mS%B]* 2p$ 7C̟ ?ҸDo1ȧ:BwHiPy"i]$~ .x_U8d׊4xKK1^C$Ry$U _MW(my'UTGAcIQ)!F5ƀB`M^h_T3GQG==SSI4Z7IX E!_C_q-m?}{ۼ6e•:**ը46 G;xuRdWzq G_~]{܉`OTqydԕY>V`J'ov/W$Bz2Jƞ:EtFS+mh0]EwSWGq }{48欠$1TŒ*e&)QV0}!˳,Hǵ0隿W5~>~T*bt~G)buH"1JHIg3!6hԒ81V=M-KҤX:DnZ=I\X\FIG~]?׷{dxjQhN-SATN#F%$wJJ:zR~)C42ci^BjZC=t0oQ kn;uZ@*+c{TOE2SGZ**aV@$2"'[ƀM'%(8NhBX_8}{luC3`RCI""IAX8#Ž :Q뎓k_}}{܂C4EY>FHS MC5RR^6&WAlDIUzU%/Bgq={ߡZ"fF<04Y?YR#u y7ۏgWpC QqW׽WVILe TQYb?Eeu疿 fz}{ܙkZ[QHH܁ _饸oqHZ$!j^)C^i>FG9u^M[{}9őVV:&Raw`\Hbp_f5d8|N)"%z\C )0bmwU!I[ULL,GZu݉6R8Te^s?o&z~[Mxj)j1TO%b Skmg#-LyoZ␤8~Ztݐ [cxjzԈd[~yMKq*l@d"g]ɁZYnU9hvG<5@%:ݷ6džiOw zg&o l?ڹȨ'\b%N鍰TJ PVGNdqVw 4y38 2[fnYdӁ>_mkU Ʈj!F)of^肷qFۼn<4 y+Ӯ6QAU芃qQ0$8r1^Qs|r?D$Ưiôr.]FFh+;S jF&#Ǡ}3I2@Kx${{runMtJ:tm,VZzUI]L^LV{0ꘆNEhDhQ$.mEa6>ȶ5퐆3 KƦ[ iM g,c|%4FEfy&4]\:k,d^zc0](wnvş&IuSӥ9BioYLdL9J؎N?+xrPturKb /5|19ǑWʝ.$GJ1VȈj$>? NCr=ޝd-xST+d2#e0ܳ~*pJN0$1Iq*b?u#:23妠xv@czxy3NH1%${8) .U4Ux~dAS.#玼 #dFa2iYCm!Ih٭.ܙ2M5RKahjr4RSEiV!u{j-d(ћx\Z}:|q``ցٴ>Sdj 6&ɦ;:Ǩ8!J婈)n ybo4XiO *)|ztK O Q[_=?ò;Cq%򨫃ScK3!"uBȌ^@>ͶOp|㰘sO- T50ERS&r1TETpn8˛| 482˜P&F C|+温gD Vܖ{7fhm*:|f:G'Okm GozSci,3|_,,rOWdb'񮸫ybgHAvdb쟠avMޠm|NT2ߜSWqŪ>Z? xiEWo{VhY&}ɓҁcr- 9Jc4L݇Դ|*Zg*ޗ"k_O#)5|Tn^S]G1W[J }&˗hKfX^LPയ=}^g #2OC n˳*us/0ԙG/:%‚ vԩ+}썟r}p2~B )w+i(C$LcbT}ZHMl߶+ v-ߎ@i>I# kU_O=Tbk:}Dzw !Fe2n [ZHҺ*³DDGrlf_359QGGIQAW4i+q,DjTԆ'IQ!˴- 5E*NCK"T#Q':k9[<]MdͧL+!KYR DꐪTN2m]4 ++`OP $Ӵz5+5rS}Zs OBr4ё$GAs{XkZiTU`$x`-}NC.{C5Fvй^/Wk:!fmlY=L-l>2h7it ZH},ޠ|١/=E46qXTŗ҂+Pr6cŮAfR=TP(6rM<ӣP o~=-8 /f~ulQR42R5j{MٗKwveRIJvo$rO+F|LK K.-vѝ WP4\ϯE΂c'̆՟˷E{_r䠩|׽2N޼j&RqQ#yQXT,liQp<ˌԲ͘z`OeXo#P54ϩ]^mOc+ T#.V Sc厵#y8?ҟ&TO+`hꄏ5Ҧhe2&:\F\]ѭkJ l^g$JI;ؔ%֪`Ol%G!FQ[(t}~p l> x̅J5EFߙ,|-4Jԧ>Q*H ~#ؠqr լ->tW:n`ǁA~^U:e]+1"{n|}\:[_iIDǫ5rjgazN(y2T̹uq!iӶҼхQVR(:nUIU@9'oPbc疪*,-<1L(&%I'I#4R_hf̺OyRB~_.>}fI5ظ@\-}SfR\uY ҈Z ̞ ֬䐆Wf\wq_IoA!c+!+76 o?JwtM»k|f-DC+gx!35Y,MiG/Mf (q];hvQr,<8iWn_:SuS aD3hWDי$7 ڈ>̖J>R1tWaʉ*ѴTNW%T orm„#ƖAXehMQ>JWwcmu. iROpSE{#ԏ3+SSWj|&snf|MU]m5euV1C9@ +C|ToPGM6eqd0w,rRC8>2@}V{kw)Bďt( t RSi=kt;hTTCG*$:zG1UQdY#:E!6V(ړLت`HcrT{txCVF9hiF!seM F?I{Y M6.CWTY:B)TXÚx3T $I[Eʆq ίdk qJ^۫~/(ԫxQʵ,Io } U]GQ2RÉʚE:SH'mi PLygêD/PLu's.)=_wv5;~W$lZc"qz6VE]Viȝev9txoR!66msem3W_<RЬc{%[{+)#ةg γR} 5*4oef$)'w2c sTcH#RAS`6Y4eC7k.HC՟t3޹$)fIi֏]A\0 jG#Y>Wk!lnZrub4~0,k‚2O(C^ΟGˢ=)$ͤP5z2OcwѺC%BٗWTi.TTFofs!Nt~ݭJm2t >\1!6:h%c%«:K'[ۏ6pQ5 Ӵytb0 Pz3?_]t6V}i7|D"`0/|U^$Pۛmm]_=5%|~JGXj^Ha[i?#=feEc#]-(xLhW?gF-'(d5ui8\}F!Ҭ4}}s8<mw]B<+e}YY!, y AQ12!B~/@9Զ?[%b*mIuS₁Cqاxz D$o,ɹe,GkB+Ƥ+ BtN_i +R-ʳ.G%+K,T}M]]dmJJ㒦JtWW՟j5ˤ,j=97fG$qmM?Eۛ:b1Ϟ~ΊߋzOpȨGq[2 eXޯ=4Fhi+t,.X"Ŭ4zc:jh$K4r#Z`ɜrODRNR{s[ ÷T O@z]]5i-:1S X_je?r[.M[/Ul\1AYjY֦؂tbvee<9 KL2YdJJtq5FBZ)hj&K$Dc= [^}mLd$D!2TC,#ȹxX^8<{ؼe%l}UD*OOPS%4 J@i\('ܨKV(5Wy˭N c3 .,մx<|rUNSƫ#;+3!bY܅_|7ZV 'R+P˭4W6UU_}Zr8!oO1N쟼&C?gXClHUQ{]rX<\t ӹRF~ꢢDHԴ+)7ymp]' ڒ1Ij XϯY~zؙCsm̙=A DI2/)E+%GSoLZDܻnIdwF`d2yʬF*.>8q ( Ҁ\6,^ڧ2 ϗǡov!AOOhLߓc$I!$UuT(CV/Pđt9u&,U>dž|>ެ*VקaM_P,еU5-FK% jd:X>&a +p_=V$vrPʀY0Oq66JLVjbo=DR%;k5}BGHŏVb]"cҖ[j.u"ͪA"ڍm䒝V"L1S{9 >gy'=4$GGǓ5rJI:U mG Pb*1QKzA\դujD:i -R_>` @<ִϠJtbVVX 6 ZMrSj8$e0E$:@F<{mi*};?:xz SX2vUU1 $?Ay即}KPh2R feYd3]Ek؃nc}iLxS8Ϡv}=+#hG< h2"BB3r77t6/*E Y5VGA TmkOV1BT"IjTUHx.0Lny*G)YX'^ hYVҿ@/6R{B U~X?t/#$} _QQ:&JjgZo%H[}`ԏ`sUE_!kx!i*s'[Eo?҃FJg~ޝ=vjVAc'ec[x Ἁb!pK0Bש4V9ifu7tFXn,5_N-4:>Up:$*$:TAd *SSw]$ ފ{PI;3{.,W?fdlf2]|IBĀ<+!)SU|iV_5AAtISU7*xR䛐 a^p JIlqM05Yc>Ulƺ*I,iYI?Qgšc,UFYE TyIkTǍxҚ^ԅ3IV0HyYͨ2 EXEVt.jqZX:*5iKXCT~d #E4˫ƣ ʍ-OJ&,n^ՉWg2SR):`Yᠧ>iVYh i&bO f7h>~C֧py1w`1*?9>wmw>KϺ.4i-Z5~SϮ tu+M2TD>#:9,Z%ݮMa$4zAiOI_+Ri)i*|k׽j1HO++#U$,˨(\i:A>.c]VUO^yH|0׽8xֵvrD2! [1Scߐb}zN/^GU(iiS"@`5'nmwi-QR2׽̪J颦i*#mi qEzZď~1^,a{K=<4x;T̍$^3$ؖ7o~M|r,.=ŸePhy!x4uWK'̥9<ҠrֿB98?^ԕ" z44t{ u(^[l̦X:ҍb:z5S8DXuGy'ov,_IfA?gՃU:Pi"JjzghV/epoŭZF)O^j ;tν-lFK-8."-cy~Z$ɪ [_ϧjU0ȥbN7(KE ,EՒt@x{U$nϭ04Q׽䭞) aDM-A: '^؄D>)SOK*s}Dz$_{8{Mycu4=qbdI@\bHrIIZҟtj`J{Lu[=d,D31Ye)b0@D ÍNlE7T* Sώ~%FFU4U u0:ZW(܅CIRiNurT- D*$)#(LI$R*E_lr y~|׽Lb !%g_Z)V>׽jHce"5D`4̤b)ImUWUyqh(*&)])u2P≥!{:V046*Ij= ~KD@gԚUfS)Mz~ޗLSc=d@E k’ GpUZhi Y UYy)D# ҽ%J$J[WVhuzʭΟ{z1d*w?.=6GAXq$]RhַHJIͿٻUdbjFJFV, +>L{`s$P* wSd >̞weaS#jzn%ܳ2휕E;L2>"QdJd! `Nvonqmtʀ Eĉ2E/*h_W4vUJ_Es57P"o<U uo4 ̱_# y $rBX>n)LcstZ VQ։[ ueb>V%vMMd]릢c=+]%մ0j4$8Ac?.ɻc}>ߛOeJZ al.t:"OL*G+h˥#O-؂_ʓk/BlT%.ڛaP,u:lުgP! lV 'k{ w-4m ǖAUaݨJɞ>#O2Kb55.r 7I$D pjԯ)p]\JO|:[}sn<9i֦ e(F1V>`7~,mgZ6wg3?FePHMFTuv^VhꊋV:>B>3QnS=;ctD US6 cTpGQRiZ%od,u .GI${$-~+U=:28TV<^ʺ3c(b>  Lxb(^JHqS,RRE e.Q)>Fwboë觘!xm:g~&DX NjUHGYP!8T+Vl}~O͐;Zʹ#ȭ/ݵS!E:n{.Yb%}.$FԿ5~_Ђ6TFVdžãI-.CAWGYzz1*̷W _ O^xl;i{y#J*iҒ 2Xܫs:ުU|VK }?1q`Ҏ>g#YNwGfo]lJGmS$1S$j.#I`sy. 0g+?i4E.Sw:)"x-RUS&0Kc(}^ǻ̻W*uHJOZWυ|bx26RM=N53#/OkhsWHݸ1{%JEY玞zZSSO;Bɤy.4Inm\iIݟ$ |@POT%&C&PC" cǰ;G0h˫L1p*?;.#peZrH˫v^}ˉZV*.__ES ]f+OLi+(%F7om7eZ]G*h!GXeW Ig-3$vvJO+3oVtQEx zgÕvS {,r5 [bES+ G!#ڮ |5;ƹj(*^rS%4r<4+z%>2,e $PJGa$I M>˥86hشNȲxueou˷ YlJ`49hr#SHIB߸Ů,Eߖ2h VE[Cr|+]9Ɛ~ccG})vʟVW Yf1F9)jhaη[>ٴoo#;s~ ]H)"Jcc})J{y$q,T"2<Ƕuhc<?>Gn[sbk0JhaM6Mjd.O4bR;:*hm>'95v3kl'|ҘI6buzhi&ZhdE5HX/4 Oi1L63>: c*Z#k?6znTM<'A?e=:2Ol$ ^ U: 5!y-_@tY~yv:W^-$ 3OE6M ,Ta2, b;l?;8CY4YLwLqIƁCJ%[p趕@yi ۴v^ګ EqO:|~ig)zl=Tjm\RX,31vc{`}&/sW੫.hi`&c;9ސmr5ۮEe"]l " M|Ƙ'Cd=,҅u߂8b8lnFtԨ z%X]umG50dvźjɴՙCJ&I*$ h8]9갋<[w>Ij4>]SSC42 /%YU9-W/ȧLXQۧ?GL ul6FKauUu&m!\bSCECR 14#Y`ۚvEj?g.)ie%4I]~G#unVkX3Ss~b)OzbCPUztUj }JXpWjUMHEbd5(%dnU'CptV8jS_/˦ME>\:G'qn/f͢yR7JxV|v2a?W8HnC^Bu׸j/O۟:At͠1xG>ܹHiU3AQ1*®dǫf3}C~ݻ1S谔(h#=%uL5[rXD~KnZ!_ΜH_'MzMn=%P]ܕ[[}!eD %>6'EB$'OKD*i$()>AFGFO/QvB4Tfԯ<){Vw]GS~>Om}ػv>͜3\PzO Jr)V 㱽@P</}xӸ,VSqm<gذTG)CBV?#52/:y9>Eux9Xr3nĢj,jz.FGߺfX/LսJ;TPT:GYKXvWtIEiBFP*RrG,ώ#mw.2I3ڥNr`PkT,YXzO+k;9VeMiDlQ}?:WK% 5-jVk_½4 3WQ|UV-TKJEiT It';)K6y=Ujl^^:<|R ':xQo圷d<[_? Jjy5_3\Sڮ$(>Gǣ]Lq`qXY$bZZ*)`1$y[L$ hH&Cmy\&ϖ4(c||uD,2BK,hp$KMnܵ*%;`/HdP?Y -f))^:MǬ 9TJ/=׻'Q6깆 T[QJܡ`(,UXqbk=.;h4 }[<+N#t!m]$O NQ22P$qtE[-@Y+MSRE¬_JEB=-EDf X]'.Ƒŋ$t^*STCTTPJO^xu:h+fHV%T $*y0o2,[ T'HBG'9>[Rb UDWU,p@$}E7`nodfAT*3_ A%'iq }{2,xS-x@P#M=ij.WL9*D"Q]B}$iGZO wQjq4a"ƣu%AX85S䎡Ďd3,Jҧ[:&r˦Ƣiu߿VHV)ܴj,z`I_PV,yiȑV5+|TW>}uao}U|ODҚJ8ݍgەs* 3_I Ҭ] ~}54R(6ǯ>&o>@%"2OG=t~UIUUN)XXVO7]V刍H*Tl}-iq2鋏ՎiI QN"Y'=̲hHT?$Xiuiy>|N[{GϑGJHژ Pom*#MW<٤!VSEaLK/Ķ<:l~}8u߼UJJXVjiG"VO(X74p^@RVAS{j&&> (JIhaR#)(zvD#}'i^FԿ_^TF3SRޢ8EHe{lTμImcTTq^*9I H# E gbG6'WezgѧU)?՞=TGM⚡IJP#lXYuyV%_g|"hE}W Pey4/upg}0 s׽榫XT$E#F_fjt@ԩX[$ѫ3&u׎UK)`TZu%qj r UF_Kj濳^B$֟xWUڪ*B@i`] LCG3mJ.,=([Wp]+2&׽फ़eE TcZv|\B]}={l+Zb_r1U'ywX4Qr66M5L>C0Q_?zV}LI'u% ~jmH/{"WU:RsPuj=M:#N9X3yLLd_SOX3Wyx9;z*`YS$5cj%HuȁŘ}!o{oܽoU`.?iO׽1Q]+ŞO1B."OdQO.E^)5$ CIT,0F+Y_6mɷmSiڠI8׽䪕(D@Dg<$Hѳ1uh͆`pl}ټoWЌmDvyqLU4U(jdT zgyb5q4iSJx{qqFO_NC_O^9֢8)呡h^ TX "C捄d]V r@#i_zNŝg]{X H#u6i0Y5,#I]'tGsc??BjTU3 U &JYm34NXHH%N,=y C!>_׽!2CQI,"Vi'`rWADS8女$Z~DK!5q׽WTCQde01be#ۭ^8 ``_Ԙ̩H]ں{D$@#r 5y],u\>{ܑ*4zΨMU4TFdԡm><G$i?׽Se598Gg/GAUU67,^ɧt>_`Jԧ׽=n6Rz›G'Hd{iV.X1e A*A'gZH4p4QG Q%%=o( EXJ2TyK!ƿoEphuW_?C׽&jfJ*w4 <҈N2ʗ~^Ҝ$颯|ν,Yx`9!a4ђ$pU` )_zuo"9@x?{MY 6=eh`d!f*Xu@>ٚ8f#\zL$2緇UzIq& [#a$H1U@P2 aHd'W;2LN_W׽Pf &Gq=7d/p?$lLƕoJLM+G2 7¼8pG9*Rfa$z#"pA$_χT)(D1Tx.YԺM*9)!G2t\onnep#|?uG=^j*DUIDS2ZᩃJu*IU6K YnN?ꮧŤj[-%9YMjRw}UI⑄aK+hbF-kIDlYu(kbIUŮm6a[IY/I1ЫJ+Toޢ͠0UNV:++tq?g{T {zqeP`S=E }lL"ڒ*tfs͡XIw n:zp\BI&=y\XͧIsm4U\G)`咎+C5mM$4u`*&0Ux0e{z-҃_tڔv6-ҟ:4c3PE7ITtIa$D *G+kv^JaSq4?{H(Wa'+Uᦓe0$eG]QNyE=¨m`i2~)(qႬ{MX7?wPUnY 1SKvmME=Z?R]R(̌XM\+bQv>ާz<6&3GYj*ZY˯ {/mTb(ھ"K^š5H+S_̵?ǥ]ݲi2fFfj5HlhВݛ!Һmq,[yε9~SJjHdy <,sWdTYTJh+ΡtW;]-ePtyoahUjzDѣTLpݱW7hy82Hڞ\=SpY"{: 9)Ft(k UK4 P:cct嘠ڮkYhwjn_M/@j~TSH⫫; 6* t􁤇3w¹:zyIy!EO =4P>7Dt P<5GY 3[:#ˎ] V$.Ɗ tWY>Y|"Zcm>9Z.yi1;>ŠhvpxF)jeV$鞊Y+~1=x&"%SSS4.)$lVpmfϘ y8հOMXyn VMқ9ϥ5UjTˏJ*O7C9Iw$PLnTk{|,/WMQLت!A fY)$ien*Kž]Cao /F;me#ln`Y 0H{k6CoC [?İU0tUi fYa*cEӪk үEdjqI{$S;&hdHV$M`r;'1KB2I`]Tcs%T*B 5})m) =w TIᩈQkFD #'jpơ^m*>O5Sϻvm=!% n5@@Piҷ}+66MOOh1:1S<ȢML ,{;T[_y;5 ha3p2L?:,á>t|yz(S%}ݵ-, PQ)PB*+1'W#k{v`wWrj SA_|nM`)]-"4"aCG~ l:a|gӆ5ªX>NnԓC{~(@G-Sk^-hUE=&RTw11B۳jgdSO yeuF2*,tMM%N!5105^ZjtS`)TAwQK3e$Y)%qOu,OK?DJ{TM {+kUB|]>~g<YtZ7nvK>5aZ%>CE,<*Aj*Ou%nMK71TVO܉犖%J cd3\>ËE=>y%:X*VS=KB/]O 7Kc+)5R! ȏF"x2oդ{S9s$Iѿ;zn/ $DN~>cnJQOdz?yGe924i#8rkaGy` ۇ*MOKJj8dʽ=3P4"ZybYKSa6a(G<ztecpB^ QL:ŭK:wm^X&dj 0H%V/Ib,/,TC"&9ih"]ږI)J#S"joкG=QyZsXySWFVPUwi4l66JHx2x%$9ܟTR:MبFj'}K؆bJ%[9\t52c'|@AᚊY " !;T]DgZ*3A]J+CKoMA6kjeB&wYr,VD7W!,<v+v3l"ʂeJP*ylcʉ^R/Wɶ uLk9LQU}OnTq$X6@4UIQDU$S bbTHnR5&56̥a/C0gfo*[,kдgRjqvh5Ga545ž6m);pS;iR:^AIf9^IW%WҦ2gUu!5X0:IZ3U:j̞v?(5?:4txзZԻ8xV<O #RL4 IYm}(l܂p7~߷_IK_ӡYt  ^XR=9*YЦFj܄wE5ch4IP>EV,@Ffc"k\ۆKܸJ*S,J!KB{|8( {%A*x#bL C#~αTLRFP„$d|GןlՉm(s&3REYQ.6CHG4uʒ,C**\HC0%b?Gr+=J+ { \:Qαyh_Hcar1 iZ9HӥTi?t)veA"Kj jf#. ƟAN=8%2YLjYetH"q$}RZ0Y(o@'O\&{~G77dOJfFh|q B&O H&7=ӟݐpOQ0SA_G=d\ӖJسImDѬ3U_ˣ , ]_|>ϐ٬mHROQB@1g˥Ma.: Uk.RU>Y݉o6 '[nz9rب֢je/K+JDV6fF`iR$NT/$FNO@o#{v~SM3X+LD N9K+IVRIok" Ԥ4(G~>C_U%6Jraq԰M j>%21H_ ͹Ƙϸ+L T^R4QZU.ugU0FfHS_.:]R9̓SXP g,A [ypXT돎TΙccB@c"/֨ !IWĖę>.&Ǜƣb6n젨ڙ 6t L1M D21)kCUY %@K/ՎVbiA?udTA >> տSl@4 JL^Y(ʴh U;b9+|W 0?ʟ,tݔ,ii,PFZ1œ>A#٣MSRP48ejdkLRSry+ F(EXzyT= f! Z?zD=V%F?l&VJ"Y5Hn_T\[#dgy¥9tB+*$Ǻy,KHocc(qD誢ǭCHij#) Z-Q9 _T;sSB>/yu g,R 2A)TI lXd>-fnlGZC@i\Fc<0+bh]ra'IWX}@XJ|Qy_V9M?b"$cV@/㻰>fH5Wy֝3p-/>j&vyCOǎ#zN9il UOhȕ *u#5CI2SNcKOWh $ <>*i=KO/G/O~Nui[^/Q S>:20䐸 $ ܅hn^ҦJ)ie*t_[{;8īL<kV$KQ"8‘zɣf*>tk[xӇ]ŏ7xtTM-=< %!X医O?zEqoiizuUh81߹i DHVˮ5TO_ 6ցJYtjI_ O3_OU"OdTi'KHECSt.mNBG ~ ze=w)R-F¨E$:4}H|P U U|?~uxj'yh^uM1V,!]ʷXXj֖bU<^{۞%#'*r42_CHAkfYWL~^o^s2kOU/Vu"ZI:@6}Wu'{l =U9@Ve11!7g{y^@|?Q2_UECC秖3iʴza1ذrB=Ph3FĨf J\ġ+A*Ȓ4q8/Nl $-_@=!Ps.?i0&R8dRV਩11!9 ZLMCLW5|s]DeҡoԛZ$a[-?N%@uq^2䨢8ҡC3.%@uH54hT}.9o@WV.~^I~ UQ"Uz*6AjUm{!J "< J$Rwh'Ĉg2@<|;3į.g:%DB u2ͪZbty(n% p}O^%k,զu5Tt'$*̌Τn.k H={zr JwH#?X[76W˧Xq?`׽Lx8y٨(k* sU%,IE,lB ī1h:zViZu~>bZesM4_ufE֫e PIEu2S˦SU}um\cSR -LAa=CE"Ž#7_\HX=R:! ?_/^ZI%J*d+J:F=% p#>Xi@֠]{۴ -\3ȯUb.iD_j2h"-ON]qdguyդju:SMI]/(CdP9kz;(=<5I`K-,)J˥@#tNmVwyNZAhX 8 O?/ۃ^tG ]8fQӗ -P) ؓtR{$q*(zSU:)+2SOMT$F$UII ҅R}6:j dg^񋧂- P#M ɮCӏ^E GW׽_/LVRg!vydc ̤i-{sv&~_ &G7&82?:$r{,TP+|р0U~P^%2:28bRنfaUII?xYjUl7^UduZy&SOPI9+Zc`n/{)A1_(N>G_׽㡉yC4(-ԫQ ѕB5?mK#ƺ_n2}:Z(i zM$#F(S+H7^Irzig𖧒!xDXL,ZQ9k yHr/Eb0ś}{h棬J!0VQO$HC ,K`߁SnOoLʢD1$>zW $I wfBQvl>N+/JO׽ʪKG00"6zi,e\eR-OMz\R-tS?{tDCQBT:G=2 >fky]5: Vo׽3>(jK_WNVI)@X 5ۏ~H 5>L#^TS'3@jX㚞'&u(Y >HI3^Ξ㎑s$W׽ǯŽMIF']dzE%h݆O^A*&SJU&p >>sƈyWעfHjoD4,ʺcE8Z"`$2/$Q\HZ鑩)Vg-~]{Ue8慖O1駖3NxP}7j$q, y_˯0+N{G)exe һX,aoOHvi09l$ z6Jȉ<*>DMMʹ7fi16,+Cxx$U dA+6al\mnYRF eimH""o=:=ˀm5 Qݘ\#Vҏ=:Q"3E!er={Kګqf∶õUDK (!a%5u 8䊪5J& %u QYFW`Dp#x4248eeR:@z׻%1RŖxLeaaIfu i+QLK@v~USǟ%lF 3I4q=*F uw ;MEr߳qՐӡLޏ4"'gU<Y!H7̀qUwlک#n (w3.Bp4Z0oܧƐ4DVݵ%O4"W h5AS[/ as-e1L #?kkE#]Ms;\JN@fMj cUc4ڔѴt&GP:ڮ6/6lE)jf\WˢsTay78PU3ԋs6s!~3E&Jsd6dJƬua=]v_HjNj4mP颣;7 ji]̬ bUe&&_f/tn4;!80'8L[nq,E,CjS} 3iEC_!G=h]jn`v^א+19tƽTF*|VWZYuX+kehJ0|՜<?g/2cp@b.Pakyھjo.| >( ~x.)b&'ܗfg3_a.l-Cql}fC _Q$Q>ՁE3#IbZrEfZUx叟UO9h\'4y v^BR IY7hكCrOЏfMI[QKyJͼzt։]YNl#LVd$Xpnb#IWzm'6 4_:qkn-aۻjY$?wVJڡ~dy_>ٱwSQun?vVWf*0z-*hH!dih૓lKɗiW QjRzU lJ-`~8g1SÚ~m< 01BovБU&Kep # &JNb)R9#M[ujt 1Rwَ&it+NzDV!K]#]IPԪgvSdCOYCM,h__C(4J$  l"FE*i"C}9! Sc̣ECI$ʯo <"[I% YufpL4O,t:ze(PJ-Bŵ\pՖ8O|5ҟ GOT W&7͗IAo ¿z|n8&[6,g!!H#P0`e1|nm. U0 _4|]TIp ¥#myiiŸ3t][CEF$w5?/Qf]<6jkh6R-3U3."x&Lf NBaJ4nhWiPȺdV  יn SZ>jW..6E@:/uə9h0֮g_[KU*3UONj#Nk1%-l5ɣIZzcZ,t[q/}(.zϣE ny.OLe6'AW ["M Ԯ@, qA(CQYI]>DUG\r ׿+4CSE$"tTS!uFȵ⑝'O1%<*PTYd90H"Fm&96 p=? jaxL{o^MqCeSҼ1 XYx} :(+>dY2+=8tW~.wб r;}#5OZ*5(w^}K281fdն 3Re-rdx㐒HSX6)WR_$_z3#%YxI_J֚Hŭ{{<_QE?oz/?S{($\_?b&)>3OㅚxL҈ UIHR%ۘ:V>kÓ34thvY^ d_R..}9 5lC^Fi宦`ӡ%eZQo{1xT4鸋y4C f82A>^ibDsD5@Li QF#$ͩnX:Ei G^]4^TlݎꕧUz֣ RBhO4 1f]QWE oF'N;}I]͏ L[oz% ARUaw&޹iX\}3瞙Պ>n?m7}jZ8}LuE$S.#tG]5 EZɴ(Orjw^B("HuĴ MVR @>{8wx|XcTU%ժx2KHL1d>/ocÙTwZ\7$tCdBi(^dž T׺1|+oe *htAzniw^SUGM:Ϙk[ 2MnМ?vNZ9(k(c)^H!)*qCR:I3i}HH#;{%,>uNB.@uW<=enӫ1QjXWlORDQIF#M /|o3]-E}N'yV FVJ}'TfJwGA9! RLwyz\ \hX Hoe|캼zm5NL3jSc#-!KrvP57x.lm}6V|SEx#(15/*VYuL OPobmcUUK$ji`HuT ILlD4fti83?q?oR_4[K(` q{y)Bi ѧ\uQb&e5 \KYff@`@ g\U?g#ծ.24qܽ1NT|nUM()" soLH\g}dĕ[_0qV>LZ4c6oD4T]`F-rI7{h[*+fxi.Ӹ _=>#_l&GXf|(538u33<^:sE4㤦_9$Ard,8_*|X45B<>cCO4 *Yh8[H,Ē'^#Rѐ2֐ek(W4+֩Vꁥ>Oo=V$<$N9w NW$T_l;#[ M[x4GOZ #=2,TL]s",n;F4Bq/@8(O8P8?Q%ې\[MӒ?VlmY;Lr\Jj#hTX(WZj?pia7= ̞&\4w!!.=.Wom_aBbaIf)-S_T4UC T3~E`n8.I<1Wd+XItKQZ8"@"QE^ifpj:VxtcoDR:1جLLM*))`hF$ySΣQc椬#-}W ,αˆFr\IvLGN:RTODt4` $\p8ӟoxvC+j HHdP`B1 /GK4FjRLfXi#QU:<=Zٸhs2a++|FAWSNAME;/K{/UkHW^ 0Ǎ|!)tKM T4Q⌅EH&}#qY(z5tV'qWM"E ev;5AA '^WWIC=qӝNb`TK=۪F]bcqȪɍaDZ2V8K")2HH P驾Z!1 )ңLq(ySԩ:(> 5Vt Hٞv'#p[@(Ŏ|ˠnŨxn*)QS y%=ݣUP0 Ie#M;~oUTRAKB(ޡLu &ʒ|X:[Φ8ΒQa/ϭ}?*3'Bϥ&h}L宗-zG$`9 .eLul z*]X]4SIYB*kDڞ\lQK {N%7O x_>9~ztAk%ʋO3y f e3a(O,enI$Q$[9@Wo:R~]G>z)bi&$y N.{&{-%VA\UPlݽ:dp QhGRo,L[G$*8*Wa*ȴo7Hp Ѹ56FgG5-TUD5oI*V-T?lPnLhڧ_U}LSWVQ""xոdxHI}F>*{*$h."q*31UUH\e !bQ*ih8$j{һ\ ]F.hf^DGilȏkuq`[`W5[SCȨǪ/qG gKqUEQ"GLrmfH5o'96rE>)Z=:iQjW𪚽4?׾6F_U_}?wOՍ2c+&⊢a%.*ת7t c5OF<IUI%H՜6}*}_[r=>V7KWҘ0j'νXJ+j!irF*be *WˬMI~]{ܺ*㫚̯ࣗ,EJG53i,53) m${qAn_JS4+gZe.EᨊM땡 1ũ_tvwVG_ϭWNx :KfG,⪝]A,ʱM`j]"om}H##U{ץ1e &={y|+*h]-YRJ3{Ƴ7 O##¦bԤK"j|]x }_{-=DU V4i#?:AJZOXRxROO?^a:s H+] /o`&۪<>*K?˪|׽ȢZ8rHg,G( T)ߎ.oI#S_pҨ&?8%K@t39R;*DR6~|Jڿ^<j$+M9F*#XV^ K¤wntr $"u:5,F__T%Pk9>CTKUj&c5#SDRA`-qF_q ǯxBDSL;CUR҈ ԆORd+zMV`IOJڄOjF{Q<[ߒIVXrP[ ]^=5v=|8KijWPDdXj4Ǡ#8N)zQ,SS YX9ϊ8ʒ,t\0P©R%Funtk3K? <%[' h@+|.Ii#C/Rzݴ-ٴHR%g`K]ŞR#?}{lׇ_?˯{oltfZzyxw$~YZX.؛د r=.Pv?ooίM_?*n8'UHjij")'{=Ds!2!(6 |#NF~^{:"(4;UrK ##3u"M=nj|Q'HR]H%i惯{[᪅$pMRLj諥32[l ^xcBV.>_gCq J gϮ'?_#:ϒH8(hRGI*Cy,.* )qmeumA{/pׯkjoo 2՚Ph TY꣏_Li921EJ~}x]^?<te<ޱ[{i,ZI& `j7 ] Yu-U|6OL#?P럸i9fpjC4/t"鑘=Q1!OoьS`+M^\zۓ~Yxj䡪-FJqh&oۧy XU 7 aG-<7؏jvj?Yݣڬirם#AY+Tѿ5WZM]L?B=1ï.]I-X5y1t+I=*]T:QSzظbz!my6I;~?{~tᘘ #5ˤK +*4FFd4Z(i_\*C(֏u 4/_ܥe-fG[z:z)!4uK"9 cp};&opmP?>u?u1⿳A3X?|v.!=jKr2=M8WD{GU u9serX~-*GScqtebUī`HJlf$Xi)gU8W'ǣ JŽZ1ajq|>7-wnv:9#--+y*?`}}OO.a<Ԇt|`Vƕn]Qxl[g?Z5.Z+CzتI py&Sfjh*V*Ĭ @xfa`iqOu21TWDY"ǩ[X풞JKK>Z3 TIJx_SNYX2hTZd M_YIrJnTjKx<[9fh+<>!Hj8cc$lI"C~(L Kt V[?T).^0EpsCM3 gF 6hm6mHRj]- O?o.㸡1Uut[ŹMrGu -~b^.3L|硭1 ,{07;+\|% -VCos>Xb$؇X_  Us616oz`7n5:kS͚BOr0GTP~^:%]3{|dV~t&8n+' 3Q}ƴYI0R,5i=; 1lF KǻVQTtSEKhK|33AV˛M(♿ߋTNpxj}Ks܂ąjtejRFs Ǘ!sۏg͈>+[};kk'n~$Hԓ o|vG#-]!dcxX?g*$.A l3VljiCU))1)K*7n+ NzYtIv/ Ew \fC9M kV˸\WII)ူVT'I$;[jUI=4j<|jdOWA"jvebnܹs0[N_?B9bY!*:͑;Cb\nN iJZKQ@\Ip}gu/[} ED5sUsjL#n \RKPʲI9N6ea{{w6vY+,F*h'Jk1 jf>UT;q[;vcq4YSEw0z2㤞 ؔD6`Vb*!܅\Hx떢3B:H I'8-k7qH; ;>ޤ(ړ_ d&izzh&HDH  έF|}KX1c 6<3W_ݍ4;Rcͽ ~'jRӤ!N)N][ݻ;hj %IMQS r\E͢ y'ڟw ln,.fϺTPUQW_ǖu|EewnB!kӑF=+~,Gg`#g`O8ɥ۹ 5N}2+C \Y]-^M9a)Z\$B7A\Y_$V;vX>̹@9}:OoXgWTUMjIj˷5z,qbjUUQj"TRNR쓯߱z%+s ;!C-6F8j'dcj4t5h*2<(7-i#^t+u(0[?L}V}cb20ÂߑQkਕ)oT#Ş!Z2(;r[_3:*SqO 4XĦ;=._l %>u` ))|VGL!xVg0=4ovf{{ =-EF3Se]M/]-ZRTѤX %:zbv}$ˌ _#Z@)PqZAnqI&$k#Ө$BnJ~8psz!6?Tj\%<됎Dv-!U2* o6l%/zkx ץn 9≚*ݽnD*IH:cAg` s'}`)dei*T & e%R@e#i.pma`y* IՏ?^wS_HIX} E2MN-iҗlq^Hy9R`ƿtX}ͺ{ pcv)fČU,ѧY#b022]^^O$gm:m-VWLWM]uvd_Dk&T4%AKOb/$x$hbkiCIU:MmR}R+Şd7[>& [(:3]\;?_pݮ/nZ v p:?07cY$ 5UF2h/E@EY5"3c:%wVv4R@^;]m 6Sc5F)o.稥ө*v<3(FS[R-L=̾%\hIݣ!%(C}FǥvGWSKC L>yftJ. CZU"s+dk#:Z[1W5rY4[S>79.5hmX!ҩQɮ)ը,TSQS0i--4Ab8#Ĉ:36c mT$䱙*۵ԙ\IgzJfZ)BcA+$)>c{i=fgA@&?#NM崲tt* FYp~u.g j"ЃU^C$JJ &B-X*.q=9cpۨ΢#Mq??^/tÁ U)Qcm7"+j.̂ ܮT} c#T1B(%Bs;<2upCF԰hptE4(؏J,}gܒӕ>433y#ˠs{wK}?.z3wN }5kqF 03Z4Ŭm%ؔ ;;rm zô6UPfsCzLr H0#) 7{˛5*p><_}Lh*Z_'\j#HFk^+aNy,WM&X>c4t䂞Jt4p j$FU.yW_^_gUB"ъiu20P6`YM.3kAG=%0дX)t(oY$S%Ee@}UkEHQH2yzzlb%3=< dY/ &e+U $QOFV&S=T?I=uuٌ  cʔ5 `Hqgth=)G,^)/?_tj##X)E&x w߷6:j O3ZANYGQUt>n-6S rQUI%)I >Xw?V^> |ELW im2)(>@iFoQfapeyGBH֝)eF*q|u[%DrQ}kJ #SJŜWU}qc*X=tռ/GfnIZp@h>y$=QWr<]EFb*2:EVZXJEQsc=-Ÿjnpf_u"XhVPEӢH$VҬ'65*H?+6>\0>~} 8~**\}-= %8ENLz5>^-{6Y%)T54͌aU=&6"<( (CFu$i_ҧZ?驮-dV ߇貝UZ?]e+DvnY@1HEr,d,8n#2<҈dIzt7끤Mo6Z*q z#Oּ#Wv³c=NH]OU Ma]P\Ľ | ?)Ha h??ァĕ Fۮ0ecEC{,䫫{Ja \yy*&L=dRU'@U}V<~Ҵ_k"GSNE#(o8cAsse@^>x7/wOݼ t/W~{VO kG#K_-OFC4/:I 11Hgt[]T`;N>o 84eTG2b(Bn-Ҽ}#k׭K TSS $Ig )4 5, }+qHN}z/md{_bmьyqWds41դ^7{OSeԜ v&VoT6au-WW_HeC`d5oAިU=7&qdA bzԸfBb,]3dk{ wZYMKtmɤW7օiʩ6<I$In[EeX7S:k%^ \zy==G.G{e86gl})\kN׽4u#TKRC;xCu1EO*(bQIb[l\NB5s^}{:ZHH(X -J`^d>#Fefm!@jd$O׽̓)e-Lt "/'XU _܎tx 7W:u.& ^k桢xC bWI `{KJ$fy- ~|_#+%5P#%5G -WO $]עy;kyyoJMWE:7LTc>?)>u9߄v(>#a@Z1QqVE7 {fhd!iU:c?p $DKap4cOA9kv-1_P{XZZp^,bQ!.5m{XHAϥtԃ\=zNOES,rST(o$#I 8r=lt*KKJLMpmw&ȶFO~ίk:г17^ߒPIUV=ѿCܱ@&oϿFqN` =zYyV%((ȇ&:kI,*{={uM#>WQWux&x`aHUc1, 'Io!YFlǏϻ$2O t:j uq!4}uPIQ57JH}>6Ƨx׽kZ'2)gWZ-C%cV-`(IQiN"?9CQGe*QbV7P_DNr$,Z˥-@&C]ï{I>9v%%"(j#&Q#7%nۖ*#iHJHkᯗ^:3%<>*da &*H$gSkoϴNMô|-z{ g^,WVR$TOO4EWiaTD(?\^${M9_=* 1п{ۑIir5M d0=\. $q -{,*I[& "ڽ?ǧ$K|uWh8ǞZWVR\\G:ZvWr>du*ZFUk{܆̵Etr+%Yϙ&i&i|gӭJϯ{ ij @N~Tev\\Hw-W>^]VƁW4H⬖X1 -PIY B}/aZ$VO(QOLyUJ2^:7]J2\M`IڛxѰy{Yg }k>elX$b:Yg%d&IK"pE<7WV%it̢ݐN k_yS{ 4 1SX.~,IX}=Jy_-WcWS>}{<3J7䩂FHW T]_Q!|^.cӯSm#iGcc{MDpM D>Y)"%1NZI$z 5'Kr="U+_W]E!RŪWAH&RKʊA 8UnHR8OzzcWyX$wa@$JvBJHXr-bI _m]BMG_W{TFRQШXV!ːX/4Kco{/ON-<:<WaIY(QTĉ4⊪Xh0Y5(nጲڿ*yq`IR y?O޽јzՐŖ() bNJ}2HZI$Yu3|ǟ,-{r}-NRJjvVBXEK򣥩iA+@ߊ?G;jH.?vS~*>ST̞:zXXiOYy ArARz=(=se~`k J)#Vl}u->R XSrkF _hoqcPuHO'jAy(jf}j%aDU+ `#F X T̓s1GG*O*QJy.-Ċʪ#MD2F e{sƓx暤A bLRᶶ. 0QSBP/E&5-7sԯGֲlAj 䎷7 X)UYV ?=wVTKWn8(+Jia#KK>]j8zFQ+U_0@U:qbHQEzx#KJS ?_izZ4\+e?sH MbV,E#D\_/^A_c#/lui;TJbZ $ơdk]ٕQߟo:ZFQMExcѫR I9:DJ3H~׿TCz~ CtW?{[jhq:ĈU)jiiETTrcDci<2ϪH|gW˦VbȫJ N-HyP8:uł}./΃k㠍S>n[tcDZaP s:?k FMK@Z5r^}TYZ*du5Ҷ^zD1CadQE<8vWJa,Ϋ+*Ghf~}UQӡ:gힶa-|=M"(Q3<:-j|\u|rE63o!Onj-Rid RXNBuk46RۈU2&ǟF6tn۱:TOKwi&JdC,*DHƮA憘DWP PXU5#C-5L!ȒTԅ{zPըPW UΆ_ W^]BJԂ٢cԔ]uKVZ|6*)Yۆ^-c4Bdkdos=(fhhdCݷԷ'ަEE41ԯ8ʩRѤ >}AOǑ{VRcjʇz6/G]F 鶭+dTogV =r ^BXVXE=[4`:}7`KԴ C5\TQvIR2N48䨽8k =4푥o ҫ*ь1j:*3=^/OfR3Ƿ4EU#Na$5P(fxr5]l6* 6g1H"Ĩ!Uq.*gEM!EFZxd$8%ۗ9Jb-MJm4 Zb7d1N#iӢgOl,i͟MToٛgevo_$4"_j]<г96˸:}RT5)hni`|!HAtJ  ^8ܹo9oe djU2 <&vƇoq_D?0~9fk(6U\ː J&*y)4Df4*kAMӝg؛c-Lp8srT$]RCIQj_/#5-r!'B*_E.!ҝ??:7 'l jlQP*@[_ DȠ[`mn/ɾv9\6S%iĘ j^@$Ydff8Q>Qmr UrRFp\,{nTJA O?]_30mTnQE6p Ҋyq2L薕lXujd6M<7nzGN2x=IDVY 85[nqqȠUb+:@k%7@ Cű'ϡ){;{ QGQܿjfxh8yң'O ֏nV#aSVEQCQ=]D \#M-JHVRTH(;Q" ̑M9VV,<=?JԞ "&M6_@A2$#ya+#XY-nJ#:hi&$ S_Ӥ=;xKiQ"! «Xq=He *usesOd'7WK]4Kv&$T͘MT Z23|eJ{{pig^c4Q=(?sA,H14ҰjI܃ľ v-~ջw#=Zy*Yv`cZ5'QX*J[;1M1Cȷd%jhڙ}|1v[]Xi+ZJuKCoICؘ82pMWʳb҈"*Sih c"E0>=O{y,yhirxJ(X2MN M/ X$O`}˚%g5dmNt/Ѿ*dZЃ_??uc}NYy+AעƏ=E"$2κ&-n1{Yݿ8Zj&y AGC6F*SCT 'IĀp}فm ITJ+_=qGY?N<"S1! eM5\⾝W90$E#p7 1GZ:8y _8Et,+`E`clq7Ōuwjy[d"T7$pmm ln ͅNgg}(::JJ'1;N%*XZy9ɻdFRīRBvj#eEY@p#c؝]K]Zju0'Ѽ{螞RRxΒO:,CknڛnYMfjJZ_ښ2J)څRMo6)Ehˠ m d~Ϸ;;:;qqCU":*jz1Wb+kd0 ,2LLU!չ._lєj`-F7܃9I"չ[4[rߗIƭ_6gB[;2,po}=~hvT 9TU\q R~ܼIBAgjJ䊖vsSO K:u{!mrh=[\OFE0рJ8B;e[_O_׳?;ndj!!/5ob e]D )Hm"N7ҟ~O7Dˢ,G 2H쨪Z`[wgS `))G%PSSR̋0q–[^l%[IEUbjUǵETz?:NJR}o賸?@L1$R,zj9|еKi}+^(6mT@UAS,bVb꧁s^O't0V j*"UP= Z%YCb9|3T_ϧ^+H<ċ-/{ j IH')fޭqY,9}D 0yi((spSUMI59ȑRX[hgw)~^I2EN]nlcskM [=]Tq8Z|Mf )3Pde}=c 趶 6R!䫡WM=DKnQVt:4Hѕ~tǨʨg4jx[fӡ7>5ږǙq.8TP-EdVAb}!D\0~ CLƞ$kǩ~T2C O![&?>:w%8qLS3ˏ#FK$ $9.o#i$5/kRI$WIgXkX-CQ˭<H⤧g rX϶ayL-3;#E6S'-\M7>aO3#3K 0Y_C>nd*9veEjv(#2HMUԟA_/Dz{>ƥ]ni2"i`X(E4ԑaT˞`Wz9ᢂj,kO[؄ *hᖜ5PZװt Z_єVшZ?/ϣ]ziu 66*4Wث룫Dy,M4S@#b +fǽ[Z[[ )97A`qk\{h5S+T4UıF2U%̆e6>~}R*xӮ@Z}Sox~8M785aRO0ȩKjf,5ZČ4R|?>@*^_<1-*I^8=1݀sznRM.ͺ[?Q,JZI$IjfkݍZ5MJqZ~YzAʒ"lgD6Wz-5%UbHWqE$W`M2^ Of#YIjܴJ?K@ ]Pf0K"?izܯK629J?ç NEiu[' c裨bps )bȊ >Gf`͘;!MZ)#zF:FbY4{WץtWU$UʃzqYp}ETL ʬ5[oR&p鶾C>PTC(S5mTtMJ+;,f\nzq:f5Y/Qp3QIb**Ȧ J"+\ D? QYUq%-C N(i*`(` I<MI VYV;goB„_gUp?W uwfS,KS1 Z@UUMLoȌޤWg q`=I5IKmdpb:* %5r5&J*Q,/oV/hk_ZT&k֣.LlzT<<ԵՔz JM$qzV>`>*pnm IJci;⓺áRcGwiuU^ZVOJymQF?i]]*FfJ%9SjIm:[Hgw]t%0M2~{m&PԱ3zK5%S-9n;)_鷸QO"na6\^ލ2[ y44sa\)=4N ]r-q{\^׵Z(?f W9MA`B:ދ&oyҺiF:ۻ<֘kD'43H2)k j7hnۣ!E ;0\>l5$_&x#yU4ń󅐒,iq HR5j??.{C`f4 =:dCY[Mߛ/ ~#I]ɏ:uZR^YR:+jLlقYڿg4醜4 ={=۷v;Om}CAyhgM͍Hcikz6其b5ul_SW1r1OT 춦=sSB2UڵE-:lVgL~]?8;1}wl7sdEZ1TpfIt{o,m6kK?zUIb2`^>BʳIw]}meJ< }6yKSݦF+A-m"pyJGcec6/u1PW3(K<*HO*@&VsWERy ] >ֿpwg158nMW$N3\4Ygd?>74٪:J.YT)EAQG: GfY  q"9{zV[udbO idV_7/V* Ն 2@58}izcnwvkMzrYyauk Xj(4䁤VEN){eNSDKSM-F E,%Hj%|k|v/…oʇ/Viz2izkI~O{Җ|r[7i"ZzW")9 iI"RDw]*zz_U 5i$Z7Xd)5J+(/Sȱ`9Mj{ՑÈ/>#"̵MS"#F,Z U:?( nrA'"B~?ꮾ4V9?<Rо"jq S οGe ZǕY'#Џ=zDV1={JL54Q \2uYh2)!,ϺN ҈d$ ־8|1ű:/anmս*1Qa<=I&)ʆzdI wv-) ҍ:B( \Me I#ֿU~E|]+6NQwfYVdhކ-xĨWxقX*)8-r:",QӴ$PVDv[1֩CJj(TP/Y-MT%ɧo> :AN :hEE1SM@ȭ<6>-[_fyK܎ GSM3uQWQItUI,5Ѧ d;[~An1[6MMΰNJZj2Qs7i}Ֆ}`Ex$d0>B*[v:HP)CЁ:Zy|lb;h,y- 2τV?hA4pOY sL.]`)+c `eUFvXQY ZIq5X$oάT],MIIf98bc U6(5Zoq(*I Χ?o׽䥤)MDOxR<^7y)!~1F4Վ׽Fe*aPE.iRB\\龠+ں ?!׽hLBDŸ "K)B֐ *4NH%C =ܯ'R-4RQUJc])jVu$$UeWB6CiUbPA"aa:CN DOeVl ?o^Y~ݠYrC8# >mW KOI,u1xpq# ̄ҹkj|{d(fx*~hf)s0_Le[rdu>j׽z'KWHZiRyhS9hVRl#=Ӗ|~.S ѭL34FIpZeFH uWфO-tC>]{?80x$Gpejؙ^Aڸ:>WL+`{۽4oYGO5T2J'i+U^4@td*#WXѿ*)ZY+C 폊BH1uFU~m%紐\7cyI<:רvHvYXS%h;iRM$Mq\T3aM_{QUTdi TESY'ӤWzm44z ?eEay]ZɎ=N=0JgXTT41jO>r|A^>EH!Zz'5,RBHMǴr!du!.4Z˯{,QԼ0Cs$z 'dЩt@"-=Q3.R̵ "Ye)$^9"'d7:I4B(Dyѫt{ۓAIi4Ѥ𐠉ZP:m> Y>tQмIĐMSj)g¡%k")k.%FIWʝ(2#f<|1^#!Y3W,E6'tH f(ȑ ,`1@(KgLWPx_.DRAemI,M* Y mh k  @̚d (?={hf$S `hT32:r|)BçἚz* >Zxb@!(z&զA VΧ*A[Nj |5}&=^Q)<[Q@yh(y"ZYm 9l,2df^}VDKA:RTTNi8Bj\Ri%,>T淐)aE,1*N8~}{۝ GOQeHJ1 P} GsߡEsY8OtT#~]{:ڥ@!XM6k!8K?ea{cm esW۞~{w/)Jz^SP'ygaj1(E܋Қiץ T?Zy{QM3K$Z8$-S<0YPRaaŕˢob +W׽(H S=LQ,`nHE sb}54M_,ɗo_?={ڛ"eP&(&8#](ia%B%q!=?Oxrƣu>OEQ|L5kDjcz9bo,.̜5Eҵ\q_ϟTKi>8'Wzd[E)&=5345<\V?`u$̪*+ctrڼ=NOg5*ySɎSdi ^'QĒi_P Ȅ?֤ԁ4::H6_hE:jǥJZ s!%Y B]w*RBU_&K]_WHbI> ʤ.Y) i_: jSO$2W/N`S+Tȳc>Ϭ)}5q{/??6fHڥ$z3zFCXóoY?j֒YD+R8c}bU'0]Par}aԲ'̍AQ_%V!żiJRZ $ ĺ6~cPΠ,2rA?oua{Osq\,P=2SH"r!r=* UQC_tatcWLG]#bNJuf٥/Ix/$5D9-*մf 4<f6w { SpUCO_Tt-C|b/fCASEOJ‡ -G_2Ƴ[ؔ#϶u))*gi%&LzfW+3rc57P{ϥ+q!AJ!b~CK۰v7ubٍi&EdQO"e !bnk1udT.A߷ɵ5''c:{rm4yՆC5G<}lxݳN-Ϸ󘺪i*h!C<y&5#u\WM6?OguH*gNyjZdzI ʒXI7m}FԲKgZDENB}H̊1Zt02Gp &ј ^~y&d]VbXKƛW[Gur#暐Qddv,IVpTCtxa>o\*"]J^WeT {-ݍ;{tKSm|V$X暇1IzGzV'T( va{*=XytFW6VeRTpӊ?:F؝t]0)aHDԵ+i`arU31w^7jum dhJu6A]J\pU0->gv*覀Fh^خ<ϴqN-~߮۴^Un`*EbC[ph{}nřHSkSQTTHi% "ZK$I[rom>u6粒 ux>|+IH'/ˮ/Yg_0;靠%}yʚ~ҜoMO\|TWtd4g;#G:5<2Ȼz$I3yBmrr%kt+Ugg,Wс'`Neu)窦nx2C%:%䡞xaV$$&V0v7RՊm!Ս&(ԩLRYsy@^ap^j+|]cn:}Sbu9 6Ir9 |u%x*<$yUYyu9:qҵxO\B"TVŐkżL^TxDPn@7j.O Cg-p vdܣ _S'nߕ& ZC*5^V- ]E%S%.>]XG`#E6+{tlŹ+POPݭQOISx͇J 5-+3e(rFA,&"nRYs:!ƴYN+=(P^OWu}2,N y6jp]VΌYHP |;Kym^4мx+0r#WU$N ڔYUm%knˠ-7 qחo]õ,Uqj,¥D'i c=3l? r`{|T"\H$b?$IfUku<MhYh:5[ @}z7Z5ni?-e<$x%(7ܞJZgZh&e2S:SI"0[><.#d&ǯFtՎS!V[),bE?}ĥ9Z)⊥6pfpr1^L 3#?}گDd )&RSM$&H')Icer.[Uoׇz%Z%a_W>"plܥm=5Vl!EO]r&Y|||z[l8 Pղ=/:us)IYsW35AmAT,TJ[XٹOUîgerZKJxLSY)]uĂI1ExHi5WC^?IC2URPyP5wk]$0W@KߤmiU˺"YO4'xyi;U#c@<@71"74k)sRRPI2ANѰD <+՚5ОH>/wPn$JoϡJI"Rz,yY()p ~LK IׯBR,P M״^ZCJfRY1KVգI{oYݣj~C-W׬ͮm./V\y22SI3)O(ȺCh6㖲SHf23~Xa&>ֻKgn-Ņ|Hٜ= &s$rk*teQ (ҤJJEΝ'_tcKhuyS4fԘ\VG3V:lf>iMX3nS{__g)UG$Vj剕&8#"+Ŏ 8J/QAtEsxr{5]Y_Uc^T* ㅅ晔j4:Lu2ś̵R@us<:UOIOmtK7m[?ϥϮA8~?FqnTˋ#RHȊIQQX!fʂ4_˞bՙi;W?CG#ȿMK?TȤ:B(3X [)b66jA]!kDb$bIe63(sO/fVkxKj?t^jDlm% Ź5u$I)L#)HcG2t|DO.Z#f#)Ԕ$4n@uSrONʩ3OY (aOʃ2E7pNjxsQ1TaXU2h:u"um!6tQvvʟ&lNSIN(O&▐%$dGdYAo'ϪٟSg1gp|(UaWUHǥ_)#WNyw[mL9+%qQSBjcMc7(z Yc6qnr9d{c BZj6UX㨪Ա)vx9LA=?whMG$t۴'/#^VSQ]MOL(IEINzy]RU[[rKH tɳO4т`c>ie*SI4!<(, }aJ gY]<(8S3(B(# G$gh(rMU>>95}Q,(r@rUG A6 ;ofRgs5F 鶎iCJ'e>Z mL巭P&1y 0C|(g)fS"t|ݡ b\q\[OeSn*]Z)+ReӢmT ltaƾ7,&8<3O,}ϦePps;E8M~5<y yZ˝rRSN>E1PIU;:L52vbI ?!X?SÔ)vfyFg* i4cA"ItQp" +`da/V'>|?zP$k@q7ߛl䫷elۇ)RU5S[**%bTD[GM uo1S+OM*+uCM Ak1"/nM$I$O'}`-GC_SKŤYEgωh4TA ѝl%;幈9+LS⯑򪠄nxu鋈ƺjC 8ěwa?}ٿ>ļzߛ/ӫ^_O?zI?ƪik_꿫F~;z4L~X,Ҳ;kvU%GEs ݀Jn\}_oe ^[f*uQI~  j X7o~Νp#8_m?_ykj2-XҢ](̒UR eF`_W߹LVQi`&Y"HQMH_I7,Gϭs 5|MNdJo+ Ds dud-nHA>gY{uI $P?zp睪c}T3H%1eDqJ x_T ׽UJ@8$HVHeWi<*BzjO`R˯{?客mF`6T9#.2Iy%P s_zvEsOEA/Tbzo8<ޝCϷ ?>8 =a[A3 HIR/RhE$&l?-V'JOFW).,d-C1?j/Ǫ[uCB&L°4Mk fm:0j1e#HX-xcZBƶTQ"fjA*Fl^Yzu|鋘B>!R3k`*a|lk㕙}GLUrm1M#AjnBCvrŅE]WiJ6 0 rxWY7ۣRhk4T)opWз~8@-i?~j}oʹ.WGpnY6> J|- Et}FJᦍՄ&De7[!fKFЕ V8ϧVAW8zum=CҸ2]ػOcSE{/>K$"6 ^Oх<2`1DQ|VA]1ӈjG#-UZ=Kk x/+}o뭣YɅn ,GvV}hFi9+nw[Ӷ[̺TeYhHaZ h8Pyqs^[ùz5/e]Qc76[+OMc+% YC?_%-Uv;O~eݔ \P@50fl'Wh/ꚑ\qCOµDOWE|G[`s~(ݛC|;S}`vQ6C\5)WQ9Cs9F*MqoqfKz9c]s;wSap6[dĘZ법4V#̊AK,E&ǹmp-Uժt?Q\g̊zGtWu2Nr*ryz }Dk]JQ)&^쪍ɗJQRdmZ]Č;!O[[ES>c{UM }hK& +*v?VJ|iJ +APhx1@hv}gk!J-v[j䖫 5%Z MQ $F$v+p= =m>{^|:II-Sbk C,gOB!a2@MjܶIVe VzQ⺊4 I R8cKwW|9=ԛ]Ѷ;kUe_ ي \L4jYEXJJ cR۶ T8jܼTd#aMV$eer(D-qy]ZTO:~1vVupmH_.߳߬+{6V5Bw+ލQҊL BD2+ok'I[p;}lpi[c-7Fe 0T,$G"ky>yn 9$$~~_)%V:2i;FsGN}׻j [c2ry(†*jgቷS[*70+ ko=ˋe)\G1t8tG l9eR[puV6 4RT'5sMU.ڻvb#fXsj)(']5LH^s|wz%-Sk2. i8(>XH➢4P nѮUj* z+N8!4>gsJ>tɞCr lqb ;{= 5dpH<&eeI=L":rJH>"?`WIcVcdMUW,uMYMSǏVI&hH`oǻYc5*ҪьnIRj ??8SVVTAIII5UU2=5<gRwbmzf-ХQNJ۵NcGJ`#\ u<|1x[*q$Dn2 TԚe:$|:*;&KzonIMli5qdkX]Ul6uVWx|5^EgIe"d} _[Jf%"yPӪ5Pxqf%qǮ;|3߳Zmʑ شC$mMMD@µ&CœmGbuvJG3:\QqZV3Hrޫxa US>??.rK"WEGt'hnVq{Bbja6gTIY8";HeA-؞ "*\5[D81iZE .{Nj(I NĖY)|IRMc{f} UIWѽж%X~~UlJI+^[?G"y)ZI儫"hk\}+ tsѼ^%iӇF DTϐE/0VTF(tPTCN.U\{۾:y`X#dR̪Q Ś>^.b,kUoc{YE-=eAI*VFBƲjU4IR"mCMoncS*KӏxbJ245̯PhdHwӬy\I*T;{Nd#c7:Q=.>q_ NSU"*Z;2X.")[tw^zDR8TnbC)4Y`yK R;] ^߃mkՏ˥EmEfM:ޞ Yk*O+,әcBbbvPv |KO՚xz[O||UmEy3 SNcE4BK0@H[p8pScj)ϗzc|q㫤KRӬUr uʫ_?FU@H P`k:unfXi!+HE;24*>]AJw KHl*OwC ˫=FHo3u%v*9`zI:K$ "VA+@t 8# Ij?: D)O~]womHijfHEXQh| +rO4&=Q|ӂxϯˉQS(ҦMM%]UT_e4Xcm1 :$-FtVפTD=pf icsm*5?Kc`0cGLd1lVS=&N)hee9KSMO* P]N%|zz(9FO>*^CP]ћID/ [RGܱӭpk)Ѣ֪,l@Q˹(X @$\vN=uWԄE}q_lyr˼4BC`^{R*4$cNƾJް8l|c!zP' Z"Ci.>ʤXY:?W t$]Nx] V_"J zE`_{ZmXq9ܔR#' IOg ̔fGi{r-n}'ÝT _i QǘOXr}Sdafi 2SY6ۙ#hVX{L欣4 ӘiagfyB;!-`M.,1h?XEi~_=8j;J< UI-'Rx}"b/kqӲ2$YVX*lT2K%/*Y2|ti йB;xԏُz)b8槬HE H$@G,oLn)ܔOC,tۖeUDFum!Hޢi1ɵ2TopG*4XZ=iR!*qOn͠ҷ;qn:d5MbUT$'–`h,HSW`6lɧfUs᜕o:PcCLSF# _%$^Z\-8kyq.FP.ooU{730UsRdqzJV #$P'xmIN1AU[Q{q'EJ)_K U%Z <5P}Mg,K7Gz9jqEЩ[5Q &-R-)`tgS_*}&5+@4~_u?%`*l/g"_/DтUW^-_zc-Xi ?O>>sE-MMSQ 6Fye(YQ̏,&tҬI[`S *>ޠY|H%˪ȺY:@O{ܵ0ahT^jz+=UMĥ5 G2 ֥PHv*+EpGcX }D[y)+auҭkcŇ߱ 7;I5~*z(h* RCC-ER&hJE]d{A4E݋0:. (8(Khl_n>_l Խfeedb E$k,RTHzػхi5*ַV@ ?[=PeirttQV sBcHD }H\y+2VlqoJ'./zq o}:PRC[OQMGQ[5t4S "\X#^yg2ZA_/ê[ 3kt7%j$"OqeC9wRQy0P`U径71VU47:4z$:T o'o*' 4ؼyeXS)6u_$rD@Ega)UѡBҔoݦ#$x ?o 0Z ϴu]?9?fZۙ5Tr-Րd*e&ԐW3U0@MܕTkI>G2 9M[gOC}=v<#^B'K:zөxM_Iiieg+k**iI1%:ҟ"rڽj%6.:ua@k)X%LN5߫ ;(=0#OoPC,qLStl}OUSC\TPg*XAiדBH~O`F.9aU.E'h#"  P EII!hBOtCF>@V#)qԫȶN*j,eVvHڷ|5Q!Tݘm>ݳziҙu<3\ 뎦%eХVX-u>R=\I66Rq2CD%31FȎH!H^E4M8gF:~:Ҭn_mk^Mu6dv8 +h*)u[,b9be7n$U 3t/2j'o=vIKۙ$1#cJ%aq|JLnsneR,fGLRW>$+ yPerх@loe=[ d֚A4;Ǧ|X?Tٽ=Dž[ZZ s4AZGv s sCEtԵFOX2T f@Ȭ9*}sgm{]ꬁ0U ck^v$;]4>k2;ֆǞDU3}*+*y$.du  ><%3Yf+@ <3SIfEDDH\v?dt"qҹ 9ѭh!H1ԺԶ_mEKM_5,/Rx"f_ڋ1s܌cN}K.&+cw&gC,2NZ ZVoM=KT]%C8˔OtVT AL1~_kZ#:׳6j`caZ*p$ct$Qaf0 Z! uS,_kSEGuX*ldըeCy;wer߈Qo닞 i՜zg[mǓ/- [tltudͭB5"HΉMGyl!r9>VO&*>ioV''?ξ]QIXjw.W¸]o%Ep(+R-[]Q/ݍŻ2bITrԑM<(46ond,??yBЫ[zj~g̶lMe,{mu&=5U AU$Q͞@&$}qlL3,NbCT!R, Ul偽R&N$5@WJcx)"єam3kw.)S,%>Nj괴lj]2yHUA\(ESB>^gí;џF OGP%dB!Z)倧ٕW/ܟǵ%ٻZ(-%,~hA7s ^$%y\.o$҃o}BAJUڍO`nY<3R=UDHG1 ( @or 1STnLF 9əE> GU*dTvDq܃ YfiOz ǭ5z`ES"<lIX@gOhvwPuZ*z: Ʒ{vh|]YG#fj|BTF>qʱ3Ȍ|ȿ5_5yTkօzڅ#U2#ԹVHB8PÛ{Mp'(E?>qϞ=:\~>GM:zjh)QGL`z]'}Q%-K8$6!5KVŇI$@\#,r5Ӡ \n.?}ZxX}熎U^(UXX' lc^^t֌BTVW]-׹k .]Y5%%%"2y _@pE&pf{ڷ_QP>_+$ĀuAev\} {Gvfe ՚)d$Te1X<~(TeEj1RS"iIXS MHyMI y_>"(p, !GC%%_2c=1H Eo쎳Ê>O?_M:SJ{8%(ǨP/<1O-$rUj鞽Վ u->w4h (xz7qoy_6o+<55K1z,:q)k %AO4OW,IrG, ibO n1gKrѶvaEU=R"Yjf46UD[sŖhi "jeNjuPJν/)+AS1PIDJny~vvpyl?ISZYZ t+|'-bFWкx>ѼhkRfo11};&x|OO6U4RD9 zv&G'iˁ*|535: ԕRrts^fd%H,Zo{hG2!;浯LB0GCM2LZWao5Fo%-W_;);7j^Y()G T c]csھ6V*D,LusJ yo9,-O shebIjcD9dJ=QL^ }=;xaXjx6F'T#AX;K:6i(r|fܕ7ۏ(P]'M#+oxwM맹XKŻs<~ޕ"B 5ʔgfmPQ|;bBSԟcA+!KGnt;d<6G3u^qk+M$kPmf}D۝똹N;ͼY"vBKI75]m?y}2 r[dmLFHG%vWO_W"Ŀ$b}sDtL'ͼco1If">9K^J7ү?kR#Z6D8ߗ ؙYy&䗁D^mZQxa6JJ^bx(S͸&/#Ku!ԟޗ.́$p^C9aI d^f:ˮuÂ8D1ó6K(aX"áܞ-~%EE%[.xj:WXT1$} [\TӫQyjm&sLuԘY:x wgP {%WPfr jZhnK&*_|X~{bqWf{xsedD"3MGZdԬV8j?4s.nw;?+F丙yfzHME@ :iMf>|W4^?8U}޻= ^v؝mʼnOjzZ,eCUXѼj#m󗷲=jTa7mr)p|E~UYK% hY}A{r{Ի6[ˉeVV|=RjiVM`b|I*W ^K6cvR6`w=&<6JsT#EN: $!ʡcSkgo."0Y+gOv ~/DXԆ9 = *= z鞢U:[‡n0˺pT91&?.J/L Hbe-.}"wxMv.Mٴ9cm45 î':NbG#;˲Y}{K XꐊM)4BV ޝٝ_{roy٬F}-W>֒b!ux8 [ wͺ:LgQ۩ʦigP i4R<3z'uU$rl۔sD#,D0]A f0+GMp]r@VGqSI*!{l7߅M1nkgF0 l"hHĽ`xcK^ߙ2KY2 H|UPOr 4=rOS"te6_ĵ#T]G Pn=ؓhʪO[xYc2):5(IG K =5 敤FIdQ  8y|8I=|@iy?f?8Iclмv/'&,Ag!4R΀WJZ`uy7}6R6 =+nל 6\} Rԭ-rTO]Usd򙊜ftg3nR Tp(8&,ྕ@W1o[,ײ2&#Jm(W7aSh MHiPkƸ~0?`LN> &}ߞdn钉dg2D!+: $h-d^;|3_6'+ZNZ LeK;5-UB$ڼ-7mR3J3|Mե²ῆZePjI'"IuR&Χ6n_W͍9nbi5gii:YCJg`eGb]r;/;nVn) ^>* 8#c4q:N9Fpեuh? FmJ+JT8¸'Y'mM{m-0uܛwj`pmڭIpٺTIS;KBjd2n+Z/9zʵ]hX˫Hh 3OurtSSb` DrPvG%$AEĺ!c|5d~/^:zcuGTfgi!~4kV-pao>Ajc&25W׽Λ! =*Ի4l IT K-Ir>VGå^2~G{|c+(aicc3 Je\,8em 1I4xŏ\-]j^F" 78:vx4iAW GW?P*ߗ׽1kRi5DsSaD-b"$ipFh.>?åMp?}?׽O"^Jv)bLʓy !iYN9G-ڬ0gץ2j/]?׽FQ(P"Vet,f4QkSk#Cwzu~WR-LQHegau.i=p<&-s(QE?#׽P鍂W$k U1A]s olo/։tiS֘?Cӯ{WRbY+k)4HBuT"  ܲH T#ǃZP_=}eL \24JWZY e[B!@ [5{pA U3UE4z5b4@SP*i#S6IʺnnJrthеk~RA iR7R'LUnO&xԟϢXO:Vʭ*ZfA%P[ڔ uf$@??3\ݑ^9)<:*F;:Җ]!@ etDfj^ƌI- Q*a`㊡aQpl@~rƟo^6p3˯{R1CD-_,j@2)ů"Z]qEvV?{TE<509S5<1DF2P*j7}m> S?E*xBd~x=ysR:d v$׉Wd:~>8B@?g˧xX>\zǞOl[͛ẸC/0k! jWX//[yi[My")1{TF![)wX̎Ȫ#bk+>W~Ҭ&iK yY :ŽǶvNt4E)I{pMS\e%iPj]Z !sgډ$pО!4WCcByQRTE\pw#$EN<%Ѹ7KfaBĿ}CI3Hz*DA-[#T= =E:]ZH gQepQn mTE*OKjZi\4 M+'i,GG-Ό bEM8SCNm 姩*{N,vU8x؛PcRFI䝤yr 3xVF+q5u5Z|ъ^_닋f%IBcv ?e`}TQctQC=<-Y@] ,孮ATE,~cҸx?z']>⡣Qm2?reRzH>GitP3db07=EUD|&:%UUzR-3cҠٞAѲ@<1CZxѢT;NQ,ڳZqRPU=<@9!*P }ٓR}8!i$Թ$a0 $*O乙kcSIVX'hQc\HnQ7v4yy' rVV:T%ՐbOO/G,O=)0H8*XkR&GDL8^Ømw16?XeBuaG:hk SOD:O2DW?tSK,p=e mlE^)Atɲ_ۢXƥ?gaF+KՂ,^F+φ3,Kz#B$kPCŕ%<S"ϧհ?դyJ#XJQ .rJX|3Z2%"3B7p>m텳ZhYq_v}uɺClU:5y"548` s$pHE]*N@c~ۖu"Ɣȁ+尕&vG?Tvݍ/磨ltM*jQK,cTjvXPid8>A牦ݲE[I Q4ME"#J6۾'UPsP>>tZ7tO:G|*Qcv L^Vi*x֧JE!3&2'?Gܥ-|u;GP&d˥J>6QGq2]_+$/ Cc_5\T58X5) 7S)R[WZ [N읫_GVq]?,$qTJLQxPٖɵ+#T2._Gޝ8#jGI .Pcjv3! ꡐUԨp̬~}⩛0 iRH~݄ɠ2R "}֭N3\/KB3zJmŽ\~?]&>e,\ g9Yr4.iZWcABHtp ]YaΚ|%R6?zV@F^=#Ax#ŽJ:M4SIPLH}(=<\.d@C݇jFj+?˨$᩾MBBL`  չaygϭx(nՏe>?~؜-G \-VwM/i)JeFKҨeiVUX.Cl*BۇYESQLl&~7"33#dx1oy|N =nCYMQWҿEJjY(ǽwEC<ҟROV*'QY kV Zh[(+֧f$Ibnm[{*6/VGlf&=/W "R㊞r$0^h eF'֐N~^g] 㼮*>~m?^Y'$=]d)$2:=+luVE$̈́Wdc2u:ƴB AV70)I\qjb=?ܱ֮^P8a8F/"\^dzqev^cpyjxͱi*'t4ڋL!E'$dlomlp ~!^?_tTBH ]Vݢݡ0iJ㊚pZp @[@[8b-4t0UQmPSf|MY8@[S4Tbo6[\vUb>yOBj<1_F;F8|S>II1:zVa7лO#y1AMzUH[O%Ƭ,o%ن/R0\jǯ/צlmi(%˪?J65ڜmu\q,İ=-LoW7^Eϲ(Z`jY]iOX%HsFC:Xz}7'[EU[o+>1B(4_{4LC)ObXZߎ):%1W_o]Y48R9YIMQQGrm8|=:GU\*i^0Q|uPH(1yUҼ~X%`e+:X og:)W5%%4TGD!lSu\O5^X_> |:*Ƨr# ?bP1);S5nfL+UPPGgfD@Y0 *Ob[`. )I^t(ˠo| V6jqTOAbN "$*ځ؟U۩q{K E_dj&Q(*$UBu^%{Uq IZ|SLԘ9.Jx+j(1U0 =WRy+}ʨ@KIasv=V1&;#2&X+Ur:E4m{GW  బfPcמQm\%?|8c˥UfK[%GZ̍Ji)Z_YM>,I*ٞ͹ۿԘj?cMTTɷKjhcEX$T(u\\w4J_E#_H⟆||m;hu_F]GX%=l7@.ҩG-^bnxIڴE,J?fI$wj_=(?~οzfM2?՟ϡ'm}2#S"ӌ|*@ Y)EPK #DDCyf6aUGb0Qg1OK2;MC!?uJ9B,s_io9Wܯ=Hڎ*ԮN Z8k1;5̓1TL))#&JlLPj?c"%7exm+haQt wRXs{+\ʱT Z,YzfϪͬsEKd꩖*? bp-ԅ$jNvk0xGuQ՞Wb=yˏfk3rf e\4Hԅl@fn@:y.{Mdp7TdruTU<:x VVֱlT^ޛAZpә**}?4+4VQMRv|X.qu=ɖQSGǽu QXf5 ki@fN7|vNzDb&O?=lP劏[Q$V cpsWVi=e:QҋiKyF%Хsj *!<2UM$y Jx ĥYl,O9>[6n6*H0?g$TO^ѐ &P}b,U韫[%]()sV8}ecQ[ԵOK|F[@sXk[@AG=bF饨O㪦X+.700*AOʳJ@ࣟg0K^wVF]EkG1K3 Sc 5m5U5[#BzT{VػF]U-n~yMUg HEC"RI!GӲym*h汸]-!ը.K$r7H?,duvlw'`-Ei12-ٝ'3I%lQc()d*i>Lr4& @Xз'wiq{u^zPg7 D< UCJS՗*Uxs!lA ; mW5j**gq˒zWQp+YI`=+w+1U(~,gpȾ ?>Υbw2]ie'ڞ5GHбgQr?WǴN9mYG\ Ik3QG^9rUnZX\\H9zhȒw+|NJ,wU^bt`JT؝U.bjM5<3KH+tz(5WJC,ESb}l N $М|8̊*j9k葬,XV%Kܹ ;R`YWQ`HmrKk YI@n\$b]g?kvʡںMqJ,>1J~:erDSSԚYC8P× {?ɦo_]z>=Wڸi_|TχN8)ӿn5=C(4PF No{=·*O oEDӇzuǷ ]3=}%s^CbvgyRIϐ,4AA?[ tW}{܊z2POXX!d"i;ʃVrS.aǍ  zJ^_:*襂X?.Z.+8,j>u~45 NiVZ1"Ti1%D&mt7${nH]A`iN09}{$FЈaZKh!gL twBI@?oQjY={l=\x㊝#x!K&Q1 LL -{'4GNƃ׽W7OpG5]y2uWS{x|WEہC?ˁW꒿sK9mR-rGSon;sz'WqvnZ:>l>¢Q|,Γ]mB =߽4mw+ͪ7>+hY[%Ve>#.']JPX{oqⱛ5k9pm05j p(4e~/b FWgp8*HI P24R?QG }av֒s3 N5 -A<Q^>Bs.Nzc|MͶ#JڹmG,|0m^%>-~ߟhWݱ­tǕylW@eA=D$"8 +@!tm[[f=Cj5Y "Q`ek g} $c=|qn}c;1}GZJ >(m\TRT!'U$lK yKOO<1^RaH̭$r]xe<: _t:qB=h}kxt}M؂ ڪxi1S9ZF9_ Y幊vg Xɧ 0qar"A^ttȚ}ww=-ڝXiv~ɞr0U0KXI5^~*HoZTp$_||1di?.?ߟKRzM,FdS2GOn7-ڗ3s $z%d|b¬GT/g^,⬥+7W*5+-u JuAp B9wbhth>,xRCO]ޝ#3LiU=>Cwvg/p 5Ncvuch3m#g+d@#Q5UX4HXG̲P~:%iѤ]r!Үm{y ZtRjhƿRz۳`QW;fY^ 1@]<`xD &"W4܍ &}Mj_X/<<[I[<-XZE۱7FDdYjNb.5Wx![vҢI?_;k?Y;wqUlqMun,ؙ̾gy6ĐXyjyjdZfS2c~[<~Il{X77tK_uUܦ/];G,~ FvU5 )` @ri_㸓>Vz7")ഭ~z`O01,4=G >4Hljv:*M,rh,XI :"&mѣI.= -MQpABd|eE;y%5l*K7BS3Z|C`?z;2S7CnXc{zUϺ@[-;&;F0,{b4$EVkqoOçUHY'S9P4 >NQo'K3yVȧ}ž8x>pbt zTWNTVoʔcgje_J"QJj3J2Еr@Hp_i3Fu#Ph+Ӡݐ, zn3E FFTq$tTh TySy ߅Mʁ q`uS_Bݵ8?6|#a{{H3V^݆Y CVYݵygܙ)&%#c_U޽ΝeaiWCE8?i}>GfBMZ'HN98<Kq7أedQ֛1Hcf1OyBKYc뇓T3TO^uŮL?z{m,v/^(bf1?#J[p=9 quF2^#Ziʓ Y4mڕyaaZ>}ѸX7uRGgP # nϠ2QA.ɮ=_x`@IfJ-Q k_MVyS:4@k xZt񋛋z}6Mb]<,Iy:{#|=z)J'YnI26J&V4>#y1J?:=?zeE´kvyq֫5 +-39ԉ%㕰]SK}y®fLsT@H)kgZ$GY*4BAmaK_Tr?I\{7`6 OomY)jSfpɂ})' rPȯmo9ulTٙ|c_R\")A~֭ͻK6G|VE?kv+ɪKXJm¤@ӤUEJop*WHWwn2Meܰ[k_ )cm`TcK57* @L%;-/o,$RBک%~!LJNxmT&$c$bcu?j|=Y)# vNY\TkMj u-l^>}:%ZȈzZNh0CpcfV/ jIuxث6ܕ희[]o A]*K4>\0USB`"ǯM@ Spyo{rV|>_3E]ƍHUS:2FPXZKEKpSE&Qf.i{[5bR&dQ)ՙC*GƂ$iՙL'=սVe۞UXȧa0P4I"=ʌ|X|zx $E4 1Ob[Q $Ǫ$r |F&QO$rRSuT$!VAc ),?oQT?Uѽ]U5e,UTU QX$| .Xp6GogUĤSS?^bEOEdM%-?Gv፤M$}e?(nRH$qJ{Gٿ jI,r$T8I(Afx1͗QpQPTTfu0Pwc8^ru2֊vRMO,f 4⫆S]Z|:'::}I'kHH(rM;SMj @?=ʒ#Puy1#1pH ́0ibTqTe!$B:EGtc%L2vr(\2h۸>-8y/^*^&APaa#K"MHZWCk:1~/.?WϪĤWo^g{*jco+Lc<ߴ J@P>khȭ8˯1+VU8uoIU@F2=E$a;52R, lOXϤ:kV~uW=zO721[ USjJji I z(1$:B:)6YT<W=^H.xU3E,~:lAX7[\v?)OS5rHIPƓY+#AIºK_:jd_.ydFԫ H"s؍ 4& \.Z$*j*cHr 6}=G|rT$q6}8|q v}]č;_,Ylzzwzع!i6fvP@nn`5i3%)^OQSum q&ߏϹtTRO#dՑ̞'y>DQ"9sk:iyTV k\0OEu3,TI8?>@B|GG_iT3R]:@ peC뫣i"GuS mAYi YG<2HxRJ&xNi*L{4o}D'[+,j^|FziɧdHʾGҢKT V˝\6mfCEQO&V#q-dZ8f, 4z$,޻x3EG&92t0Θ̦탮2=7]K;%Aң+5W=Csm"U8~Ό!Ce10VPWU-M<,r\^^yݰrmj";ԙji0Hṅpim5 hok r<7:Ze Ư3զhߦk8:IݻSPݻNag]O>ZXOQUZcgTGedzuRJOWo"U)PnW%Bk+.9Hz/MDUN<`4>SITsM33hXdG-n>|`VL1Ov(`"Vg0osgVj] :e$F[ ):NRV?!UlĔ0wvBz7XM-̶>,剏RP+~ uI%TdLKXcN1JCPT( V*+;H$EZ]uvq9i$CC ,'nQclĎ\f9*87.J(K*7Pё&AAu'ZjIWl_.=/YDOQnɚ;42+vi⯖K#a21ԛSoQP/jvWщrܦ6\Gik4tZOa pA3:UfvH8uF20APeIZLas%<1>>,d+T e32܁(nLwH)ToFGSIR*KtT-:ʃKF 1S,  "[iMfJ5>N339*jj>^]NUՑlֹ$ؐۃI2'fx#1$P"YAmA­'kZeҕ,T~~0 SSZ HC#*Z"$eUeCtҤ 'TO\ 4M;E:55E8 zA:FXfH@OW"JoL7oԑnJj^rT{ٚI+MKV|DSJTx嚔-3#ꚠ)c2p=+htG gJSץO_OS.&5XƠG.ݯV-fU)kRW}b4V*"㙼Nn 㻖HK6/|xת)CFhרu85=,Ta Ld\OFjztmGrQ$+>6F hV$yu=FT:+oل+ 1 j.}5[ 姅NvA)IB2,lZןj̿Zmr9Ji0TbTZ53TҴA+IJWQex2sa]p;2Uqs̯Qfθϟ?ooi6idlu+d>DU5,3%<ѭb,׽nߊ?4Hq'~POfbYN˖sd,"[\܁j윽 N4lF<8?:b–I-ӆA:컽.^oz5WI4ebKM7Sڝ|%U:է'^WCV6p4(J:2̶bC|u)ݔ`虜(Gg[Nk-tb1YE[f;VSh/O?Wǡ eMٵv] k+m|IOb4f4R~v5Ez鿊B9:dŔCC'Z,O=;2+:6UjIJ=_,zO!-bc1?:Vgf%pЏ6lM4C]%<}5EE7Au`PJt>l}'Ⱦ|~UELWԣ%0VbE/b`?GLjR)ē[G-Lt(LKƫʨ)UPxz;igoGO槌\輺MYi:OqA,ʖf3X\=3Y|Virr)hf67 rQ9G%ӕN5tu,Oh8Gc{bqIE=%^WZ|3KEj=Sª]4gUbyjjOMN ­:cҕ@_~_g:=+* [u*UM}} RL^l\EU qOl߶'(,9= y,K4M=OP.U-o+ht8[P^ۃO>,=Icʬ_1:F-:#pn? h|Ll4S2*+:$\7LX~ܑGDUUUrn AmhWh㵔| |4 ӭ te$Oc=s!l wU,G2t:JV6Vd댏s.oi1VZP+.o~?GUTu`I\m_*sCIXg 7F]Á8x*yf&U:Z4H3E!,}7 +M-N1N vf栣4? JM7Oyhcr-A45F VRE- ƣ*h)%HrWVYf`{oϹz& ?3D݁ 'K/6ɺ(UQM >6I1'4őO8A=M[@:hMRn\4@s&)M.H'T\vԽEH}snzs<([)Ӄ#Ė-bM{a٬~^ m)/%U` GE,NZ-E$,ڑaڅ,:S?+P[Qt%" {pR?GU4qW)IVJSq_>$AWWU:[Gu*f Z XX#a}~/yb9QsTI5^IA㠧+8gUi&_x+Udu8FV%^4+ wvzy6>/OqXed()U*^2HBYpl|v<խO l䧟uWͨL0zI)oe'u_ZӢ[_g9ƆP+S^:gۓ1u;r˵-U~W*jᣅCje(bNu܍1EK-_4BOmYq:#vguߣO:vW':Hbyɺ+E ^ߝL++{qdwu3>:5 pTL頍D ʋ>]T|<t$TxƙT>"J#ffUq r#XkERLt`dѷ .b(|5Z28XL*B@dmЁe֢yDXj'ANPIJcJ%PV"9˫e-*֙Oe<>]*@ t1e`Uu؁{sx̥$TT4r,JeBѤ#5NOc jiAO=rF2lu,4UaMG}]`n]E>J<nDyW1E%DڙH0WڤϦxHxpVGP瞐xXl|?gzƏoWE_6JMM#y#e`. A.ٺSڔd1d T:票5e塖b0fPTX)<'?g'?lךi8qum4&4iDV` ow],v}AWuTg9v|t|lY*DL` $PHh*NzJF;k)T5x:()z*j zc#!Z] Wc-)WٕhoyFjPP [%l!!ORXr)-=%+2K2:(W)At kP*}]"W뒮3-5eJpxD1yur = fKu4=}{eJ|Ja*&)r2:iHҊ]E^ŭ`]/-*qA\^D"E$ *ݹ6cwgg* +ZZx$Lm(^W/)TEwh{4X'S MMU41R#KAP5XR -w%mw1iOBHryLkM|o4kV< ?WOq Vbk2KTbLQu#=%5(kE,MQy5K8{ǵ|ǣHy(NTquScJ'&I2"$CQ=c$rՇx_ܛvuNK[FL(H STbK6 @@Q-Kx=UE6nz9#wbR*]{.Z*I2fS1]uƺ bm+nؒ2n|X/E[cO5ifj?MYioM6*y(Rf59Ii^`d(@Gv5'M*FVf5&K"Rc\u-MxUCF?\39zQMLQ_3MP$zDgkd0_ ZὙ,F6?LvcIY}կnEBW=%7jM2E Թ$_ R\M(+LzTS}:hjOHI:_>6bpt>Nܙ*KSXێ:JPFUb .mey!h#]LB ]kl-vN}Jc$ӎkwM-: z_#1xo^v{/"?yn͞o,5VI$HJ8t5OQa3V ! Aq.W\09ZT>1 jsTP#ˢL`TRV@&䢾#oh>KV_Oݮ=tqtm:*622qjR8RIDBh+y2guO%MKY@i"6E=0_RW.p ^ _WVd?Q[Xز4_Q$J;E3FU%:ʤQb!.YH +Y և4>޺6W hXSYXjMZ u՟&'1 gTWˮh JD!c5yjHbbL~@T Һc|I$$M#PR3H"YdG5(zD3OSU +_<׽KjdJei!z#0WF[ٕUOF?~^guNӔڥNlerԨPEwI8V({ c^~?=R'󰘮8 $f6^ (ZBO?1M֪ѡmMr+>,K"x[i Ƣ8h:~9u55?`YWWHC:`rM0?iCBuE;Wx| ?-S_C*Mv[?)z hv:yT*}9v.Нt`2Ta**((HxG>.b{VhO]%´t,)MCD(=OV'?jb3agמH=36ًec_,f|hDHL|{,q#>H 'EPZ7 rI}/yOwkoTeߪbt1I.)tLl9Z %d-ƚtG:Di4, 4r3SǤerZR ^^Ska1Eݏ?nxϛ\[ul #6w+N:rK12OAQ^},lOٖHǓ ԕ?՚pZ8'唢Bujf9rA^ۂ>tŽatTM9d[MR@P7LO#+x|L[/cNSu6VUR0e!H?b߀xo~ɴ{6H`C)*;r,mb,HJ{+%?՞_3Szϕ?$vYWOEbo3XZ&ّӅӱ.pUy^9X#$}4swCs?]oGU!a3de< ui>~?nS; Pd%u䤙 }<6+vLc_֙'QOU]qcO{SYo"DBeo$ \w9VF$1/Em+o.WWZ&{=e* H$Mom,׉J|%2$T-J60ʃ-ƿQF>(Ic"Udm,m,GD=,O!]02@?Ow7_cy xRLZB"Agل</$q=k9bX<#-Ғ0f*>h:EcREq$ON ,noxqJ\:^j5iv7ih|uut4ʐ0s,U ׷6?rϳ7s)w|1B%sf6\}#gnk_h=nh鼋?[Yl)e=L 6vnaeYp>#ZL֠r*׵|zOIU~?RyB?=3/\ 451$aƶF%J3~u_mM/j/ɪSZTj'w?&ߏo-oo Y~&sY]vi#Asi?Ko}̑}DS1J"Zwe䰲$܏t)]oTzjgP|n:]lls6wxnxm: T@/j )h09ͣ&_>c~$+ŭ +ҀE;Y# $FUybuЃS7$+Eӟwϯ{UQ R#)u-TRp3(n 䁣GtruY^MD\ISjhP8d#VbA*@'˯{i䢣I&N?z`VF5t.}?@7&г0.ըOY8*c0WO ~>$cU=pmq`R\ȱFFh+^}V9ZTƺ|mTz5/$4ROLbHv9eBD }m9qr[zt,hR ?I,P2# gO<;$V /R%a8:U)TW7I&IX5\P!?QJu 8~νM5M$SG4l %"熵8ՓLgW֎Pu}-T.|p2EOdYH[roc3([t#1 n>޽‡ $SI* rR1NKHV&ĵ"b"PWO!t5^<}wF?PԔ9*ɸ%2ԫw58RʌX,m8tQJޠj(=b\&i)$rѯ>i0Գd--+`dMQU)2I#0v(A> \'VX~GU??QLlJ1'CӁ1zu l>55A%5KIJk!g߷({q` f&ZtTmfi#m2hid{y!b ctq,e$>.QWBM(Nx 6?gmmx2ؚl:xhrX{QE1n: \[bZ#sEY 4CRڴ)X5[^DU[?J9UX1"dϧKACo5z]fK <2VU>00y<:ay/ rtԵL&%c1Wk <$vBdXnˤYI0:uVde*ROj#@7zw5fǂ)z(YUqOWQ *p r3&KoOx ځn\TKU,T|Es8aO ) Kz:dpI =MQVl{t32>8 ,|⒵֙J̐[۞ jW.ddX妀:i%Z]%s96FʶgV0=!3*d%%DrIрp!sfa_K iI} EPQOSK]*))9ʆEUIS* ^\cK_uYކC7H|sR)M@Gh]%y#M)9Վq$ro\)abWxxѣ3"0צ9rmorevZ838*k1)<#MK#h,T dPB?+яԴڢU, 7b(3QFx4#5lVϵeK,˹L^ub(ݺFD0m6Z[xS>F}VJ8YdGm~M%EoQ+y/4PGOggXt}?՞k Y̓X8fk8T{TX'Ub`J܍6*8zwS34FH#eP[thmۣ$`*+U]2jIϦ|D8OK7S0j1qa#7H6mchɨcE$D$%M[@ISeBKUU?eUPZ?:vxUt#Jv U67or,\2lk਱o3b5CLZJ}1ӼC# 6rUwhȋdU/Uf,U/z~]2;\?ESa׆ _bTnYݩQ*1rm뷝%b4-r!l K' IpcH7 nds;PZ/tۻAp֩U}G~~]ۮw6sR*GyDHv*%^W_93FE }ro; jusU_8ܲ=4)LL*D1%vC-r(0GU]^}ޟi?QX],A+VCr*4BѬ޴#WOۏw #lQ**GKG%8&9PMJx3$Sg,JAz'N4H }1$GoI'٪S;\hn507*~Ǜ{4p5u0{[5X NKMG6zEO0Y$ VAeu_cowHmvop!zU~^!߭' !sW"/^L |}f7WWd(*w6#1ːصc O,j')N{YvwVn,[ ੪I UOi@vVV(Cִ|E5*/^7K]˴Pi/kBQJ5M5j!*e((dAj 39*]vH~9ݚTAYE>: ‘jbMZ⊢0YPͯQ!_rɋfJ֫UA9>]X}IERf*}m]j u4x>(+ )g1j5)ey~dɭXU:ټ]"Ctr$G { on6PW7KUK8jij =j mWBXmN[N]BgU_ dxXSԬgWgO3tyzlVS G~ 2K+*MWJcTSlyЗLzm'M2GS: =;}| #g$`3QN?gzk_nͳ7[9tLDm%<f99aEK;B^H |Q T&JJҲWXk9F 2K,E uf˥T7Ot}K 3|]5/ÊV<傳~VcZCIQSWRب$C۲ϕZU7j>VY J6熂j9ՖMqD 9&W(V><+>8?$ -_C~cU[Mt뒣J}QR8s4f)LAWM2P8kw$OKhHpOȯINFk.-G$1HQTObjCȵiUwnW2CIcJg&EԊF;olыycVxxiOIYdJMIZ+׸MGI=V/7Iۋ3L<ci<p[?mWrl*KSMؓj0eVib"'t$U"&gԒ͚Pލ/_n*fR"+ rڴ׊*DU, y%`=ƪ?.]ƅsAO}q4c4 )L#!udHqr*/y-[ĸڭ%>EXk$aS,?|?-b"Y&I$lo{=0򕵹jzM͜2x})}y .^ye qn.SI$\'nxzW`K-M[~>^m|fUEC=)P6=?{J|ec) &yfY]sI4ry"(>0hRZ"ɜnP$ P_@Ϸcgp_cע[[|yےdzJəZLߤ2e2yj` Gr#KNQPEcb[3x>/_R|s]k<.e5qNK5]_׫Ė~]ʱn_>WϠ헉ݵCQG?oD?&{3gvw?p/Z#oLGVd8o [S%@!YYaK SR u!7kܯ"@|@ijp qв,Z#P5WG 8$xG FG i=(ah);dzQԱUCM J1}DzG&]7+eA!䆛FOF [,ߓq|M&S;WTi135Wjhj^qF ϥIB⸎M|U:}MJHLxRzYfT"4 Oe*}n\VJLdvyӜ~:tZ-R8^QKr5H =qww KpϗZ\x+)icj(bRg2Xݘ[aڛ30ՙhbc]Ggi2JcHى1ۣP4$B~xtzxh3_ 3T1KPK̮blEmp;mfkKH*T^Q@{Une,69*Dr$%3Z::Tfzh$JfTDԒ[ED`M +.7O/nbQn$ul~e7>>ap:7:bI 51Pn&m%5ULTQ@UT3ʳE%5VѤS+1%I+fz[Iw0 U/OQ.1%M"LzMRQEGIMKh8ƻаewۼm}isRQA&ȴcSAEs1+!E 4i /~b^K{h߇UN qip?u"6U{vMQ* C 3*ik*E54n4;#2R'̶'oihKMGgIX1:S/ciY,KoRM =1קmJqO<CP`6^z [G]?aRX&Ϸ2Ape*03Lr_cX=G:D); +B f&| %OЀ;;*mNʤ2E0s~ߟD[}ѭm:TYgte}dv~>6]jؽ]WͰh6aXճ -vm*SsnOEZյ2Q^0,buYK#Q3mSǢ=k[%1>__]>s|m&m0r^dsQ\wDf4ȪJh`ie29ܶO?`Ǧ] X*WY25<&'M+IsTV:{r$ ?*ףYk;Z#nڋ[K5MT4G-2A b|]%YԌa}YL}1xcm%fА'ƨ[O 'g1eӨLGՕ&!y] Ӹ6 kdеq3ejI )*VH ե{iArb7$u iRZQDOYWEC"EM+$bVSk\gW&;dHMV.Īe!W&m[f?SC[2P8SjTT6]͹(7m)қ? e6#k5XYviRԑA^\F$,fp%_:>ḽwRwuu+|٢3F+KRT/O(H! : r%utˑ|NXhac_948Mz9 &/VrK]%.ܥdB LQ Ə1D.cf*qv ez=~߳RwYnt(#)]O)3nەT={v&#QgSf*R .*LE$  1=QPgk(wfX5o14sZ)CQ3M {)yRAҙWz2-c~}_א8JҶC!;ne-|'ZɞOBeirYVlf-аUI%G֫,JmITKèFnZ~3: Zui|XbH?= UKUv7`⤂QqC f_l]yevN=3 cfmʚ=X$@^'#Tn}ٖͥ_覭ϤdH_;޵>W6Kz˦8ݤMpi2MMFjT< pE;^J}[('J4aP$Bk[ңS[l¿֧JbH؈S^C[AQS>_/GGOBώ2QEҷ n6 tUx+%+][ EHc#܋ F&Vj~<礃*x_ϏAWTr^*lN{3\> qKqRvV4WA>ۣdXl-e= i+,AR@)ae$MTWxb0A}+O~΄le6EdO2IGnmNN!W<ت="2E* Ńى_=Ƌq$55I>Ud2uT&? yQW~ޚ $xz~ϧ^Xv4،T.JUKE!,P"$WZ!.}0[=VdsTLcEWzx`:;D*O6b=y`n-Z&,Up :pQjh#Jm=WZsꙄ͛9ٴghAB-mVl44tLX7{;i5*#$50]^FO"{?MGYPN==:N4UR*j)MN~h&Ԡ"+qb/kHmЯpKVFHguZoa{‘&(k-?S yb4#CI}P)W9ҟ׷2S CTI3LOˮMfwYO.R# Y`~`rIkhQ鿱+;_03 |*k;2'ArG"kٞ[jEpok Iʊ ie,Y]bv,V$>y]QWUɊo*͌uBj^5 f9l,>j|)jOdGVz$VR)"<>+T e|nݳMAzvP m͉B1[y)ft,H5#aU_ *kU,MOY2U1*_n!ETp h[vsݬX?ݬT|ф7QDYvxi<Ajݧ['doeUr (!-AKKTUGZ@9l= E6ƥ؛7.>KY;yڨd<%=<+)Nt&9-oWf&oUt+@ ?;֕K a_U 5]Ӷ_;KmϮ=='nuϚjln`FU2c.cZ='N썽D҅jk22TyDzPA$l`,o[20)X/c&X0 }|"?} Iu*!ܽi2ʫ5nܦ"q^72yݷ|i֓nҙZo%4YKgx͈Xpqeحq+e͚U~榞y_=kqr4՟.sTz՛:*\IbEUD=`})KqQKuuc MܖĽfޮuuUWK>|@?wuP49Mr4_ʆ M>?4~}?hdj53s)iv1L'AS+rļ=t"ϣפ &nrȑE4S ~yF8p =䟽/'+DO]xLGHl\vׇ^N5)r%FKM=2->VHg+kۓbV+!\ԛgvUUŢfd $N+YHPܰϮ"{VgKbjA#H?fMNjlRE\1dqcl e/r=߷ W]EqZܛm+hq t(} Qh^tV 49.Und_)`#rY{# :)J94gA:;7q|R?/`d0hOZo&ڊ(#Wj,%40Or,jiGk6>ݽؘ|^ѢTt!dO)OE|=DGDWbk,1qߚ6y޴]*YZI/hVeUbŵvތ"dN8ᠩisu;{btO2]n,K3g0 ۸ Y KM$M4PR"G˷=55֬ΧX}<_9#ݘ)㸻GA3S& ??߾~njdzhC639YQ,ku qҋ^jWke֠}9'*اU͌]D@(xna7$. qEޙ*-l f5bi̙ |TK)hrx^ JwTR-eo'i^pAZ`.97ȩ%RӴeȣ;G$Ѱ$^8<ŮB$݅z6>N"'";cd6JTƢ.I$rxہt*Y$.<=TX??w7[KmlcKed+CPq"J'^gT{yS\;/Z1Ʊ4LʄV\Wέ-CUrP28O!\ R9>'|؝v~;;uo݋(+4J 4_qS(B8T잕7̞MZn i%mai#hjU kl썅dke𬝤/m_iPQP_ȏiэ/?pGuu~+z׮id|-Pf`a!?:m1筻o#_̊8*4qA!?gV1e=-VLD Cn#z%3ao"QQTPelut9ZZ\$r^Q0+Ddk9 _qwF$V:ՄmjMxP\sO.#1L+2EW[K,ԕNJߩ}SԾ'&HafPY̭VT#$pcXiiGӉ:V[s6F!xi$iRwS E+!dA}9W}8##y ?§j[ӟ6mBUU_ɡA@2guuv DZ EqWd5?r]'>=9QG( hOU}-z $CX~u7i?%G ;LLIPcx&ofR4#^0Aǎ>?qfS }P)/!h<1% 2h̥ijwE|x?TcʼxzIi\O<FtM N$vvlkXףIc.@I #{vj.*ii"^oŁZO/_"}_mNPxF}(G Bc~L|T*/G_%:ѤZsH”$#+sqʑ\h1?آ ={j |%TrI-KֶCM+M"ET"^~Up V׽%DճVYٌ+Urcfxf ~](&P=)/MkKyl$Y FK,gS2?o:fH$JZ!3VbyeekK>ۈ)1<5_^Jh &G\i-(JS2jPOj)4>|}:VBcgY^Yc 4dyF=?K؋{bܘIUzq'?Ɲ{ۗW GGG/DTiG# mH&t[ P7^>RFeJ*d#h`javy!US\"EI;+DeWh5cQ`.y6}ÓU*QI o*GiQ0[H" ϴ|E&]<~V)D4 5Z$A|2ȯ`:Zuʷ*֌?7^2A<28Ezq0.[hdc{ >ڒı>BV:lG^I At,q(gVN#`ϯ ])ϯ{3R2uhGQʐ}ETL ~ J~޼%u#g+NVH"ƈ × r,t{S Xq%N6m4׽!VF2ĠI/()@ T ?ZNσQޕ۲1zg) H:s MK;j%^81xܩ/'ʀ1z[ kC:14JJ"0G6#6"աQRUjU)Bj.lnBz)e3TCjM(ӣ h<,e}cQVy^%Β>_⑌jPq^_hGS 7!u&ǵVط-nBCSC‹G31LfNIF04)TC{Skft,p#>uC?ˤfJ9ȄWJm=>KP**VF CT}8J:'TRŏȅbjeXT @W{pḴP>׍1- kf^mk>ג4h2FQԱ54צSbI,m7(bU] 66 2PJ}ߴhᒌ`g8᫈bT]裂ăKwk)㹛E&DŅ1x-O^/ݵ.C# ޢAQ?uPU%#YC=@ m$()N9R8aC !J&jԤ֦ҟ|6TIep2G =C־I=a19a3-$ #5*iI %O[OuSj+TU^")0|?] uII_L/J%%OX 7+y%lN:eCGhs5<)/ԌP)!pT {Ws^Jjc@ޣTdtD.gȱ:&݉!fI>}A ޟľK'0 8ȑK ɦ2l]QD9fe.RbO9]6WYpAOqp)eP<2<=E;xhCDN|?j=Y]#A 4ҿϏHK_ٙ厴x-*6a}SDSW!+Ud򽱶S5][cxgtRUI ѹƍϥʅvh&nI:-E8tnZFiKQS=.Vkgc!IhUG(ǝ9K*yJ82fYx qPP}Ư&~å2]ž_]$劆QI2&1Hb5_XNdrixJJ:԰M4Zl`ݗLkWp5 8&1^8exܰ1(m[4p1-vwl9!%L/6I"}24Q &֨n!]"2 UHpH,>c.Ԩn)>X#Hx京h.Bߨ~;#7۳#^g>[ B'FM`dHR=mWv6lljU R)b1ûlw)7[kz5 _sС[#YIݘMت(24)?@Xpopٓyϟ WŦ+_->V=T2.4jY&D":kpOzpg:[A$桪gLe,TuD+,4G#Ip+*I*$1X"NOUf6I1 z%> )#Bg4fI|I*4Zb9`"=D*,Gjؿ7J'i >,q#K,h.HꑠR؛z͑iY,5DҽkPVgzym cAhUƓ9 Oa_HԕS"H-KGWri%*d[e,RUej/_{ROLxG*#ښqSfpACBzzElf^ C !&W3NE>϶=(dOzYCmrMSGSLlV<3":5 q- hfYMA55>1I0L1⨋기r_pÆu Wo/IB`h (>cֵǤӭMh1ꙥ^L؜%2vjLq*Ctl"TފPdDLrQX݋Xu xO?Ks3^e?_ݵX5k)]K=JPDʲ;/ VZ;{S@k^ygX8 ߴ6E_GI] \ VFV6g;rb7nXw+nj((biq|c+cUd]@^IoYiEhcO§㷸t}z ݡbV]ZΨݹ.?2Ͷr9Nޖ+GB!AKY :jVb.2e;Jmö z̳SŴѷ mզ٦!VXByT/¸]>?Ǻw]Iƫsm؝y)tu*Dj-R%{ݤw"ڱ)U~uQ--Z:Ք7u>b廻%W*KpQÚ4[Gv&S֍ёeZRR$QFc4Ơd\.1z.۩SH+%!A14k Cu< )1W?9EUH\}U4 bmSiITTCqVewWYnܣVc0u>C#}貦;3@IFEov6|mge2Oa{<&jgS6 E};|Uj;S;OJ&*HI Z9$s̾bd1*{m]c*0r?a$ pd#M\R޿#4՘RN9s__^[UTSúOWomUVAc%EXƖXD #2o2Ƽq[o 6+rd)Tbi2K/R`| =!}©5_Ѝ% C uy8L.-],=SQQPڼ4{gyP"g?UIS7~1iw6% Ծ.jcQH+TBLHSfƩt27*R_Wg[ȋP|BP,s!`M]AvF5uĬKzaO!3$rocB`w.7 .RJGEXEDBTDUV*O6  qnzWFQ LJС$,%KȤH%G~ןk;j\&|Y'x8)BZm<=S*Wf[]ԛev#6cz_Db˗ۇ>#7CUu s/{ۆ-Xw-˴*?sXU7.cPĂgӉ .R{0Z\ []@.Y4u|MoIy,Pn^ύ:.~=ѕ<.-ʃ/KICX+6UjI0d:D*4F>lԹ8%z 4zV ī(n4>ңAT|,x?gK#5U0 xWz4"a]MN:*hIS#[VR7/+2:JK_w2'H^2LU=݁ueYW?]^ê)$DR3UR6Ym>ř\USp] V %(QJljO j%%&8bͩ]CH ,mo߬1ɡ*J7ٜ:IŬ?|~Jo#S_;_GUG\*GxT<7gw2nȆ\ߙ.}哞J:y* Nz*h.[Ou#}BF~c׭6V8aÍV17pP_:RZ,|kS[zj,+/i㚖Ji@`&D%-\W~NdhsxPuUa 9>f$R1[Ok)qc玄  UXG=.[lmo-'Zaċ,D.QƩNy82zJc#TJqQ<*$*DU'Ԥq"ܖ8Fr*OЬIN'/&IIIRB׀ VQof|C63VckZ,*)ֳ!)%=аԀJrZ".;PJ:titA* U۹|~W2T$5i:KKSRRI@>&266 hY9]I悲1Q$;dЦAkY*ԭ Wȩ4t_cӎby;dz2C6Zh8'@q)aMvS`_J#=ST1ZMmgFd>{Hg%5%WJ5Uz wZV⦾un*mB:gSS-A@c KzUX?ADz˹ l~*m,)ÛwVY%HkƮrpdKBW$ հ)~ޔa/8 \ײͽ[!Ui`+'8j,B㦎"Df`]Sp(1[ۇm`K8Ϊ Aqp)q1I#N,TT^F+.7 JL͢E*x,=**<:MsvP hji@z({_+G2\oOrnL\z,U3b)++" UPMYUX!"/*]:{W}\ᒆ6ۑy :y?VȨ$iKM )7{elW_>ni@iVˣ!͑lj*jZ]KZGC.N}.*r=^-^U"Au97(GE8)ä`HI2Ϣ)y E(:ۭnc7?$'MIb`jEYV4 t*zO3lo\VM0TU**Yr!Ȭڢ{5g~קMkn;Dg(+>▚}J*7]Lm 2[6vy(SA-VGCQ"La+N)QHX , aKSSڼI*;uy爧?m: yWl6/*wV꼾u牲SPTRgY5$sy">_%Vl,WmzE:zŭb}  \ԽͬEb(W\x0++ +J|S\:WH&svn&V%QSRU&oqgY"/ %|d JQ3Olmru"z2K$n*:;]LPTj۵̖ *il'ԫN㨔־Y3tY OŁ/=;A>-sˆH}6bscI&Klm֢}s9Dn’p&$[V- fbhZۚ ^Gi#*P.m {'.jlx~#HUϝ +<1}޴ڲukYoZ+rcıGL*DC`hrjfEK;OHrF&50ho% 1@K#/ bI'on#$`)qQRN:ᎦJb[KNu|dіUשC xvl}ñ=ALG|mEMEE \ٚ=QTVe$# -HOwʰRϬiiEFbJ?38yc. a4sTi*Ei`)>>m)vk&CMnˊ9:lM9+#eJWV"M 島V2)[rttR~*tƯɞ5;wjz5iE5KM٠ٝc8LVL9' 2tژ V<(MqǠ#7) X_[S?Q\^FgdS|*;f8-h8=:e4;"*%S*$yc &?k]*)p) ڪ;SA_1 3hd9^M%4o ӕB۶O`Cgl#+itFҔTI(u*(;i©v?y?xtcۺiӯ]48ּQ45?_bw)wus?ޯ}Gߝ\{_riM,c!rHw)e1jbT1f@HQ+BEg[{jyg[,cZCN(X8ڵ0R@аY8uA/NOCK?ƒ.P*3Ҁ(ժ+n#Pnyd(=Tƹ`0ꏕ!=,]~+Q2˥.zۅFGz8Ŝ`h*"fm4qoႧS_?.  Ԟ#_׿=TRધhFa3Q_o0`m콭'!G+բQ>Gxejb,*K U<#L5ʃrA%U0ѐuc??׽n4g3X] V6^qj%ִ #I`4^N߳x131oҍFfgTh#&8Ӈ,} E{waM; [&޸r%5 #KLy]kb}L@P9v?qvjmlwb尵xLte(e8]e>]DTIi}i;M"mK(|'+TkN$R[W@|x7Oy_pbeMռ3 u=Pz TRcc(gP]q8|ML檪IkjRM<e\ԟtd * c#$҅]#_ZNiN$5?gz1 ~Md-#TUV=0OM):pi\"΅E`^X/ommo3ԥ@+>8]ܟ~OiܵhdUTLO.gQrԋŬCDWW[RjVϫUtQ~uocW|~m͍'\6l669#+ k)cV)eEŢsW+-J*N_2$Љ*QNZ^yVҝV^MϾvLؽ:D[d" EaRWYfPWT{Xo/qxLEE2G?e Ǟ@H.Y?zpRn}yuLUx'8w&?W4$٢zILl!VTw>_ ؊ZR}&.3*1$ҽĕu.ߐtfv>svt4_j鰸 S3=*Pv٘mw6#RO6U8=MeELd;3HHY:vQv7Kf|(ȯVթW=:m*4 q \3޹잷;Q[yaQǏe!("[݈,H[O3y=͸q츧lU %SEA,+6HI >ide M5i^~&NGGUHPÉNf <S˷og!\Py)GX'W[X?ʮ)p[ʶm-7j6U#1O; Z)1հMGK Jyk`v]jȹ tyE1d^E]Z5Pf,ƙTf8(q>jO@kQ_:3F>\R$7uU9ݛ'$<8@" s۩;34O/OlQc23O--Q8ާ$0 "ƣKw0rr_\i1Y(}=έں֎xǏ_/OӇw|f_-62y7V|QG];AkiYaVIC2 pܻ[l7;.*9Rc+iVS$/4JV Tjs56"I ḍVJ".)pi_ˮ}!:S*ڵBtP(r|%]f>pդxݑ }B4 _&I3졎3O5k=<5kPЃ33:`Ed^y$اK0Uv㑴FÍ:;uy|ר>D8N٭1q|9*QG%|?4yKG׻*62`ުE-dɢ(!J>ES,rpP6s3s z\4:6Ƭ[{[ΨbkVϨ'~:I͟>]1pӮٺLê ⮬9cʢHUibT(TQNR3T&djxH婚| %HM>?‘I$HeŌM2 \;oLf'oPECo%ݖY}l/,Pz,nBCPDTx:|R5Hj>֘JM}w.]R׼+Op$ޝB+M4TbU`!% j@-Igr<Y.W9I:HJ⩱5HS/ۆ{vn׋HfUt6Px Џh:6Tc6dL>Gu Kфc/,R=UTc$I-0]y/?fm> 稨=vZCG^dZŬ5E%]9+,h鍢<-2mܵ{g|yL5XR+۩P4 4 dO?_*x TFǟ3/r|H*̉ B#'@MBwÿfb18-E6ڞ{$uWSȳ Hn>帶 c"?&W]+|G_|.N;)wnf #QNl?n1s 76>Scwy@*1P v~G~Bjzl.w՛SvCgpVӘX+,&M.|uJ+>ty_\U].cmrS#vft?d7om+ }8P¢SW[/+2'hh{޺y~+TT&*1h`I$Ѵ5fv ɰ3^+#!5TlrSN/ &=Dc.K[$=&eo^"ɥHW֝m׀PnL&qb+TTϏQmOTn W¤3Oڝ(cr\iW6[-GKN,W^: ?7F0yՒY#]< K_U8f5jXluj1W#?1lu{^a]=u $# ̕ǐ v!Q!8 @{!Z?PHVo4TxӮoohxHj@ R80bКmYW: z@V<88xp9.-ZԚZs= 5N3bEq8c`#gVrΠB (vОC4|Bt?o\ƅ)iE\IU C] 2ErY+J\ɐZ֭|/LmRU[8~+0;%,u0"ec\z4X(`Di2v 5SL(^!Q&NNPU}{6L3C5xH++'QqM-T k[ۢ@W9\B4PkQׯ5~.! rO5a# $a9-jˉ!d^Ui.!t+CZۚ}uyq窫(U:hZZT,WJ$ޢhIcyPq_<]t=DQJ#U6=>e ϴ]EwžA}*1µ?ȍ{ƬYRƈAU7b[L<=,Yn CW^ʐ=`zEq0VԶԭqw_Pu$DZRm]{܊:O /^ꭌIePc.,Pe$ ]}'RGGcrnIКX)y#IZi8+:X[zdp;mK~ur $F]'3xHo",g+f}kfes+ӏu9*xE/X*S x%NdWQ=# ZKssqF+nQ-;5A'*zY4<$]w.Êhj`GKUb4brtR5::1kߤc\FO?ߙtO#2=2*GGSyn1rpW)]1&u_JM`|V PU`thj ETTRjT"7! RitW=˦$2EA?_w&tM誎HH$YkrfqQq=1G 0~꘤i)*=:3fKE|FCi+~ 2K I|BGqmYAYjURSzJyq 4q٢Od `XmK拉1׊bSfZGo_$sJe1W`&]n3R4}5 J05A8'eumH)`+f*jյ͏2Α? ([O%;hk)*&+xʼn^2"V:gzOC5n17Kbr?u"QgP}U8٩Wڶ '2Gzj)WJg]T,v ǩO_yASM2y)%b18H_ )s}IVᮄnDScӪNCCOOKpi6@CŜ2̾*&a䧘)C3t9x$?i?u '!G*_gnMʋƶ>ZY \mjS-&VsL:i$"7*dfF]/[kI)lŀwW~]]$Ja_0izz7d5 T,'KULESF%>T apA=MxÙVc%$+bdVO oq]GHV-tRbQ Liz@~ފ4c#,PT #QU2FіF`WU64y\vf(2XbA2D%e2ԖU* vՒCJEK`jJ4]7:<4ϟI .WsnNT7'ULԒ|y*Ek#Hb$N+L MC-b:YUkT^Xg} ..RÀG"wGjm:OtJg?CMQDJxjtd@[IIڕҨ5BEF?nbhjVpVR \fN=ɸ zPkTq?7=ɡf5tc+|55z]A! {t͟MnŨ]b*TLjRa"KeCq1"hV*jԶUf\أKYSQI'V @$] BG>rym1Y #RKw=!:Jhkq4S=M<4N#_#{ݻ35g:TTCO[=:qSSrUE[f<"Ku_]*dU|OS3[p=Fggk@nPo-ߪfP⡤$T"M CNyQ~mn#TKsԩ:l>$h4-| 7GJٛ˱:5G7k4~&+&gHfVX́Rtc,(sFX1}_OM)ԥOibШ߭d>&@7rhY+-ھ ^ Wkz=5-冞 Ǯ'S>?˓S-UȰFmkc˒$5suӁ|L;Wd=vb&яyUuJzδYΏzvk;t]K1ѩ,le;EfIok7M1jC' A("Hf$U>É9GJ*|?FMU%LR䱱dVIEP-^J^;H|:ʏ+hWH`tMN>pYuU-L"2VՂ2,yFyLmNL=M-^>)P4I:˒ʃ,"e$^pVmY,բqG)uj~^pQ9Ӟ5Y x~bSO]i(ach7 v?nTWvDh2;G9 v"`[dG Ig1+}]qΛzmNa\VRh"_n(I5\JFD3,Ln }Nj#ԴaUrzhe JcjidhI׳@yۙmU?S,iZ&n*-]o#h[y<Oy|_ .تJj&RRi%1bUJTBuΑGPM_SS.K'մoWR,$PJ_:q`4ַ)Ie%kFSO|e)!5+_= 0)xCtbXޠWM]R2uDUCU44ᆪ6!A`Pom7;I8\ 2ysDˣXV85*i_|Zz^7"I VهMCh*8nr렪& &):exR_سƷU;59oy5R7s>/Wl<Щu^uc09)E1+`,=tGrg f6xj\1Mxw.KB}}v}nY~%r/环$fh^x\?:@폐Yؙ:le.maz۞JcX!Hг[UmMٻWyHԴ0L1I$`LxjdB$Ro6Oͻ@Bta"ݪˈ}v`"z;ߎ]:c{R6=FݨlSnLR) :϶,Wcj43(V:߻]is*-Q y mqũ ^6$HyRIMRꁷ-X# "TNo*TTz=_^1A iy25tfPy宂wY5dԮ(s4A9=E7ݥUN:* d8uF3A@ Hy!꺳O~tVA"PcdA]NuJb8?M"foI?/nlL[c<Д ,+I5sQI Ԍ%MՀ[]Hۚ=Wh?7B,X 1:w}]Q>''VېqK\V]&-U T~̥V[-H.2q1#TBkjK3(Vr lMK1iQJUK|O+p?JRK _\LW[)WөdYGԁ{;UU+hv+c%bejE9[V(Tsutv[`,+4WM4? yqYQ> AIOǤ؍I=N)ʬ Ycx5ZYѽM Ձ*E .ȦnݧmG&Lzihjjn_P`#$9kZ;|~爵P~tk`Gw~-(*U4mՅ,iJ&+'DA0uub)saY28yOjռ0mm<nSr"w/kIOoKx5+q?z>rج"pJl$4ESDQhFHW^C+qM2[#OGjωIWҢ E/ 17 Ğ >LdR 4j֪oTvoBCMC>}%5<'J*q;j堒354zTCg@9#rB=8J;iV8)3T Ow $i_EFcjUttD+In3w5S )JcuߐCJ/t[S 1p%Gj*=޽9},H1"%4gUvi ZOp1S*䭧KUE AIN:b@RXXѵ٦AT"CLcOڒvi*S\~V*Y^Lr ZL^C+Y喉9kUf5pb242XbKQRX{FXEÎ{aB $GBFE.f(Aǭ@~iPʼn$~}[K]ϓ n?:&8h >2iewgP/\?^ִTGC%QeTjY-#*(r%;v>pZ5GIUJJ6kF$eLv6\ϻʹC,1y&?ͺKkؑJ7ٿyUYkkaLVyYǂ5Ted ϳ[ QٸX@NP$dAQc/-r4<Xayz2]-8Q3~}o\^O"UO45W(]:?W'K%0IvGJighV3x*^7  )H$kOkhw;vsFCˡ.]MjOν_әnLrTԨ,v̔P*,P$AJ1 #7OL{-s|2H 1Sز I {*}m#1o|-@Jd\3Kz`Wws!ݸ8ꔌvKGX&C4TakĊ{68qK;-TδU!GvgE#ڝiwۭc񴘴O>?]&HLq']gۻx*&sy&H5:S 1A :hvOD+fX0¶J\},q^ܘ)xa]23,ȷ 8!S#9zk9`Nي髳P,2muFxGc$K'0IsAUdjYl[ڊzT ԔDxįM,,8 ܟm͹-! 3:kMA2Gq\ӦR,+~/z禍כbVu, K",H;<%5 uAl7 (k6SR&ҏ!$O JPy#XF#Xj{oJkK@n-LV6K%|O5|Qξ}TL.L5qVǍYx$ZHB6F^|vdfj趽%>bhhLEX`Qy\,YQpZ_-p/ 3 bgEJ] m]f"٘+?gu S+ʑ#(I6]>DyXJF-OIuSzVN_ߩæxcrvu5>mE۴vi)2_Q0B"KfP;7-fAݹYVP\VFcόϦOȥd`Iar 7Ʊxʴe{i~:&jFiW淖헊wNZt` YhM78EvX ;?o/率i]y+@eN5?Or?? >]z|޾1||MIUJѰ&h#H˘H BIm2p(Lb(?#_yuTzuVtXh!%dvCP\؏dՑc$ ALK ,h#NI p9UϪR~>MI,4Ju,BP4v^, $}XC?o:%֙ hrx' (Da#.hl8*=$(H~yt)#2iH4̏_{ok8kH*efH5@GT@-#0dcpt]2?xt8ARG}{ګ,oRNӴjpBФRH1aCtSkUYMBWQ_~=R-u Xc Hn:_W ԤeR'L}^ykwn9OʣS LQ~ߔyZx& Zz :E[ذ‘6? 3R$a(Z9DLR}AI,h_WH)??늅Zqcol3VİM2<&HhjЯS*{* cgWF>CҼzǼ7 -2H5 5DeCסP@%cjTkA}Ǘ롫 &O)Q•jU Iy}w4Q]K e I>˯\ÛʌyhZycEwti'R^+*:biQD_X`6) jE゜4cjy ꄅ]r>2S?N " \܋[/oͽiiJ>#FZv"H\!b{{-SY|@eAÏGyRS:I4P/ȅ[LTY/oP}V_=DQfu%;8sG*jŚ7y Sк4^IL"}km %)j2 S_y^ 2Bw5*"W("VF*xp $oJKz$F?D Iqv-_#S>?>©3UA=->*双,Ý1IAS")ώs>EOB˪Y}B`x]Qɖ4r}F1"%Fp?N_zߞ&]bBdК#x>?۪?J|^}x$L-- H^WR֡U}Gbuj<8xf*鷑v ~_\zqo&Z`YesJjҪS(vKpt)X :ЮgS {'CQ4*wU@ ~OH /q} aXu?ӒHF'66qU^h(D M$\1efeOhib` tݔ]#$|,u˞?yǷdgg4e$?Q-bbP=~8GRWZ ^˱5&(ޟ`_UyޡNU4OCRf4v}gXWկUɰ{+NuiM>4 |?Þq< 4 rZ*؄$0Jo á**4 MLn…=)<vđZ}zc@6rGZN cd\1]Rd/f*[۲ϢM|OM0gՏGӮ\ۑca?g#ͣ=N{)U(LQUՌm&R2Iw+-r&c6kKkela"j7zjhޕ㪃`W?4^qKoOEkiMEyZμKIO~ Q߾sQeyr0..}M$Ǝ zd i%:V( HO}KDk-^u 4K]KW͆~! ֟#CR?-VГQ~=Eػ f/9Zc|EZ6(Q$n8娉=c4aJ &=Ŷj8pk|k•1n-{G"[r(c)hY-O# ~FI6U:};~8=THtWixj疠zY(yif`sʇsPhjå &5*?e?~}w_`Q3ޖeoh+Y@0f4z4LZ~^wc_OXI uŊ #//aaC Fk]BOWu RW]Ǽ.43%\3x>ut$j{C%4J)WS'ȭrBɳ(1ץq.:~\k׿EB*Z0KMި12-o{IО_n % GEN NL2 '_i穖i'WB@w^xGTUPu?U1׽ɧYokQ&YhiveR[q5˦`Bfc=,ydlJM !K"HĒBV՟˭x܁ QO>;EGNH݄BFVSS*c|jR4Jw~^O,YT^w<h[$͉OЖVXLXuy(穁"KF SJʢp_A$#B]{܉ yc OOr'B55B#)uuVԹ={٩诈;v+|=m>f)>ZBm .#:*^s/o;5흼 'C!Y@aXQCjAjdwhsiz7 m 3#Iu`UxU`n^Vc3uutYII<tHVTPU\\e y&&xN_56i$"ΐZzT7Λg*#-> mn j3*Ӭ>[|ks'0rV#@y^ZF~^@K[8L6ͅUe,K.)"nmkWR6ZSTISeZ'dP*SJ ].W aY~?^u3[I]ҬiףmNiSF`ڄM7tktGןʆ]>.r#tO* 3+DM넋?,`#b0[~^}SJFk'F8gSXiIOT-_c85 (~]/'p_#l[8̌YUCRh)u4a ' pOڸKO z9W&*%<E6ascoϵYr=.V&0yjQT%IS=k2M5Ӫ5h,TI۲UfJί_χ[Q|fq*uZiI)ֻQNiH1x=RI*ۆ9E+3W⧎C 6 ,ċ3[]ZDWOq#3OcϦ:LWÁhcMOq9]Br@}[QQ,SQh)VXk6sԅVPHͶ\,|*?JP\-8R L~j~`))QԄS0#Uj戏 ras ]MEU5|kMYEUM+2G+.G-^[KjU?\M2RggB#+KaƙZ:i i Ajik0|$\夭"xQnGRƦOєɚS6g<>~yNud~s?rSȿFjQyIQDߺMWK#5շfпڼ + NJg$}n.)H ȧ\`/`lHcWv'?%ZbsY5v$Pʫ/9] n]35~-CyLYUi<8t tF/;VI㎚hucW*-75* .x\H I!Y4Ivf"](C%YSy\z ## GfVNYC+!Ԍk[Sȸ"K?V"*D(z=k6%u=?Ң  TA_CV.^7O*sG*°0Z⣨FG XX,8Y$U}*gRs@Me-E59yi'Ev[QSeO^ f^.*fv钱'! BUc]ԛfʲޅҊUe_?usCۦ'bW-DZ!/|e5ۀ=7y3I^f /"$OT,~"hp}[2qON?gct?KDqN;R ~"J`gwhh*FfZL0SH0R&_4U E*})pH;鸤Qy~N9EY59y'-E?'@|T13Gi N!S̾ԅFTDqs Zz5jyK%rK 턶JcS{T$q>1`tQN̕?""1X$/!OPf`Jl!tZtTQHT$ 7EȠ>U:]V.(JdFdhبlTra؟bRU- WWlXIWpT̲ӛIu6oe*ק|G҄T4\y̚l>Q 45֑F Di$*E[(<O dyh榒2@ P(Z{+]HFg_hfݹ}?T`m~BO20GYԱ4IL/k[S$F2KoŠKʵW_ץbqN_׮^b%ȔZSO:W(: 4(In#*@/>ۼ敯?zuѵoW)V+42G;Xe3E$yrz:|4ԵUؼLƒRƟ\Q9VoMٽ+6eXo dG𔊒3]gwݿqHcRԸ }qaQnFL>?10OO*.#Ȭ/תJQj[SmԻNզxr)^*i#SyqZs J]ӗd*AGKǛlJ:DsbeAKvR"MHD~1Ǣ7#cӝ윔Smr07rY>B%wa+;h5&U[HjhZIr٪4.ɍ蔨R2t^}jw5?[ 1}+=e:ob.XSND24,~Y?܎ws`w=dk(1G%\\b7`O[{pBf A RB;vY@ i[l]̭F[Î-5&OgfZ92_ON; QgV#Ӹ+RbfV b-uU*eyb`@f WAyȍ2lJ_DsMQUo&I IblIͶfWXiП[ý>! :&K+k)kr*Nϛ( yg4R$@9y4[ލ2J̞Fyfb(k!h"Ҏdv`H0Q,LgL]kay=[?_yt[T洩ϧ[>}PELմ>dV^:Afcȹ'^"J︞ϑɀbh!lacq;NرXU_WJtŽtu]_MP`WQ!4eɔ HK pÛ`x'yҫ5ȑ;r%GGvn ̷?:j?пJE.7;]**1Ha%T\Fi+*[4Kyolb֤8 uԬ\6W: \CFRB kEPtj)ckH#hj\O=tⱿuU*Ɏ&EOH5YU :EߐޫݦR`l $JjVѤ$6 uyq,w:]@q?+ccӱ^򬒹sEi)h5QxkEe-2.KwW+g9vlf*\**H")RoX7Iw+fvlyuΧIMq55|1;H]V6WCQ 3ӗBV`_Cӹ3RWɷ!Skofv#W{,WM,&ੋPvT|Fn TuY?vQSE!X#:+K;?O $LS+5"HO>5u\_6SraJ$4K5?lȎ4KiЊ[/{Vh-5k?DK,/#qq6k#SZdE4"4(6$=LB8>\ ?'Os=:vݖjmG PTTSW!H]%F3HԡN5MF?3D S&;+OVZSPYU)UR%FQ>tYjR#nO@_NvD{*|dktREQMᒞ\G+T&#*(r4=:gjaUEn%JRH+ qI\G2z.7vA]QZMCE,5Tjjj:%%<.(x cc:lmީӷVA<@^ TR*0T ~Rԙ;U{)4"@W-,.; nKP&eZJ(ڝ%Fإ W1TPTVUfLXu72}2vG?>[O&:F>w&Y_9Iݞ@pIfeRr>`CS(CkFg#m}0l~W=)L8धIJ$ҫ'#qQ㤫ygP-b}j ĵP54IWK3RI2#]ȼ4p/."VT=؏#"L꧐TR%8ƐkYc>UKY2 ]ۛ^)dddN:1ƞkgmL81-p?FR hҼ~HI_T_:Un)Nv;jr$WsStaC JgRxcPŜe5<ң&V-<Ԇh5IeC}??nܪ_RWϫx+$W㚶 )bJ,y@#ٌ;\cz܆F ʚl}\ĕk~Cj}#4Z,hk\,N*/uRv{E&{jAઞXjJ<ф9Jl @cv&ܨ!MC5;e2XԧYlAS䶂cʟ}Vw}ٽWWo]nPXܥ U d'Y4ռT* $31IrP4M;Nc?W6}tCCw ~u|go7_V{ӥcYgzycibj rq,X@bV!dRרZ]:zR?o>uyK-d*jY * ziXKH&6d.t{Eyf[_>}S$4PR.-%:S f(_ujHfz07c9sz[hբkc^Or+)r5\,~|AP'**q [.NwqO/,xR#;NƢMSXFܱtO#k֟ӉtI_{ڨWQ?N|mEc-:gt$*-1I 9##?SK H;*KbX2O"_aq|ܛhw޴ړo.s3` lu!j(*)jgo'hYcI] wq^dw&E&Z/ͥKM7pYFTab#?|DbG}m\.''nuy?hMTٔGMFnVZ-.緺7oٻ9咏fo&c/SVsX@(̡IX{/dv?ih.SzBFx1 QW.\Ca5b61WeT4'Vg2݊\n7J&ȮJQ"=:+;ޡWP4J2SSܒZFHlP6|sK9 Gbr23Ao>|=,]$UK<2(㧄007Xd$X7QMr m.?鋉C]:>a`O~}8MT5q-<բ3NJ<,SȮKF傒k?_zbj˟8MuT^77_\y8,muۉ;-cEۯi+P*&$ U]dA93'<&%<3:=x:@AB +~}kQ}c ŷ$h?RDP(鐹/ݝYؤZm{dQ>:4n\7Gje%yj`ڔ萘J=7 \cYƺG0IOOj3扨MRv}!FS'cJK;`C. EhKaZ%[P52TiIrD ['[߹~%|#c DYںT*}ϔMzsJ nT mfdeQih:}U۴,J *c6h1Hc6@%䉁SO< EXPa3X,IrA$ϸ&a t_gPNt=" ItUK1ȲE4XT+o7ժ&+Z`p@G?ͿǓL5^9YT)E6&3;"8%S=/𗰶|Svq{ r,%«(%Dž#1mRV]$- aǯ՞C0Q:u]lx7Ox)[]t1C0TGvAQ&0(Ɲ2ÖPP럷uUIYD2INӉ"5^6{0#J&e֔_קMď}t^}zzX^@R+6z:I Js- .HYy#}r422F'nFx0 OHDjui8>&_D)7/UoWjO-VeeRj2<>멍5Jk`~o^b*:u?71I0͉SM·vi%6H Woe?arƍH