ExifII*[(12i8-'-'Adobe Photoshop CS5.1 Windows2017:02:22 08:28:080221[(HH jPhotoshop 3.08BIMZ%GZ%G 8BIM%:Sr9D) 8BIM: printOutputClrSenumClrSRGBCInteenumInteClrmMpBlboolprintSixteenBitbool printerNameTEXT8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMO[ 9781844488735[nullboundsObjcRct1Top longLeftlongBtomlong[RghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong[RghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM!YAdobe PhotoshopAdobe Photoshop CS5.18BIM maniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlong&(XFrGAdoub@>FStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslong&(XLCntlong8BIMRoll8BIMmfri8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$epy RlX Eܣc56H_űHF7➞SHı9&v۟!GgMS TJ84G6#-7X(?>8χzl{2-7v]**I h`Qj,a,Tm_O,APL@z%} DOחΔBq{Kj>Wzd㩐QȲL)-v3pJǓDljbD mO'k >MTpV 3En iu'٬SˇElۊX^WG[ UΥ~8j*<|;s\cby6;XHG4Fmiuׇo:}Nf)ڒ]?,rX2Z68N5% ,hdXt?޽2ZYi ֟oR. (Yᎄc%CmaKǤo[EazfpH{ nDO$Ze Hp*ljV2t8ZCa!C _CX&%+`pgEg7Ar8px䍻Z8>GI76(ЫRH ,бҋ*O"@>oq[ߎ?vi:%{/}j#|zzIc4- ,EΖ`aRVnpztaN` S{]wG W:Y[)@kmG m&AПvhcb2KX ~GS%@^tj߆}I|Ig_gV )G$k{GGN5 V 6s:j8.GtI'6$Ҡ9!E)F1@^Wz&y4}6=gʧ $*Ž ?}\\6/C# -ԸSNno?O>u!tMf[O4 t#*[+Բʿ/ TV: [B_-/uoMr IQnH}&˽-3A1 "F/.4=%ݴ &Ka_lkrwNms?kbb=+}j͵"Apx>* eŚ(WHRڛOW?sѪMHT^&y;XnڛҠ`<y(x z!uIUA[ȧ_~}<,'^Ԉmu)_<m ~\?CR5CuΜA۟aȣ iAy6}9؏R[AV>-Ѥ%QXNɱ##ÉygH7s:uѢv$~?ērDRJGOn} FybyMܘͤ9D4% Ϭ3G$ì!#R\A˚VsFb̎tE9`oq!EBU8_ohV>Tp"I}ϑY%#5UR8؄0:vk~u#o>:x%#(j`>>XN0 rO?P?{NUT jv D 9[PGDIQԤKV>%btJ$VzO'}G'O{礡H4&Gn+Evو+m32Y*$f+sk{2Z=HF/?. i#0P]0#-ŞB,W:vͦ;b˨?6NVS;0LqUow__!(dpG\S{75fRGdj1Wsˌu''ۊ}M=kG,Dhamw$ݭ͇#fv?ˢ[ ӯ{3e8@X4*/qqcY#[ZXu[Icr8#1)5n1EGr>_#=Jɹs'+%GzE~oϧ5װ.>  _ds@r?в6Tw/>狫ñsp,q-P= ըLDZS*^Mw #Ӯ-QTN[PZ\|ߗK[(՞q7 )ٶ|>)+' ߃_b FU[Ѹm6i. `@ZF?W]̱5S{^AQMSJdSU`I _oddu?q=z֮gti {o4cdaA}M{X/ Tk$^2uƠ;:6m#q48|p$k{M*bc6r{,j_yak{-__1!FSzn ?=mFK {ڶ|tM{*}]Xc{ܺ=%8?'yvb&k ^[H&5OZܷb&/~BkċŽYKI4{ی۠NX5}f鱹5:jms{~K\H.o}FLFW>7 љMzj%Fi6<Hޞ ]{$@ksb'\3Z.xiSqp!u?i>٪'SZjJY$h7kͯΠI@ g{iɇ`}K:Smo^YX> nW ɰ{$pI^֒MQoӁ}ؐ(ǭ[={ܪX^ů^-ſě""Q.*puRmhjWQ.m+{ :҆lyuo#I-=?P~_\QW-E!uK]G _?>U==nhV0lC7"A6?゙^n{qS??6SϻFzN?Q݊0?}=p}{~[E2%\uM#)$ٍ&]"2ƾ]wAOW@$^~/Wc=>ǮK9#upnI*y6[ݜTtTqw'A\ Ο_QR Hl4~Je,50^Qozw2:5(Csn5XkG>Bx,dwn/XfR P^Z~`R ls(f RAGM Wՠ$3j׾j*Yӛucq4^o9[086U{m( |Y(V.u,|y ~H{,AIy 4mqfzs{k:[ic7R=jKߋtZ7L;{rƝR'6[[Vzz>6ho۫EB@)@#_lhdJ$X_ hzApt>}rƖCËZԧӁ^ׯߎ=ekUORqL?D5cYs{ŹSAj'ZI\NM?CXcP/BtM_xed'}l,!]T72Ӵu߷F'Tn℠# S_OÎ=&:0ސ [_M^TO>nd\af+ ͵Z彨4@>N??I*B:O"v)oo$z^{ R ߖ8DHuŅſ?{XGh@Ef<(ꞙ:} Ǩ+}??<~ġGU*|NEw+io{fk݋tU=eV?Js#[rnpâ(z[H)tTϥHM{K_PTWI:x&?y@upAſ??_A5[)k0q{zu{cNIzN?ވڻvupYM'}u4}- 0PA$>ƙ#K齸?בcuVbH:jyoXi"6q5FZ%Pq/^WħˮzWoоKLAI: ?[YBH'"PƴuKPRWeCAHв_wMJ:ޫ>$) (韐Wd(ѝ5V2i<dh -E8<|'UMnx6,?za{wv93#4USQ[+$UR/Lc7: ag~YT+#F$5$ Vy]$O>-jh@I?ד'ٝsog4?/S""oEs5dHc+*2 8֪ 7+ *P@Kcȿ?ެ T`??KlnIi@.OwIx;IE6.i 57uBPT669GVc. TW%RϯH1`Y+U%&J۝~=:oE_oe2+H%$BYJcbX?O7|kuo=lP\OR.7a jF<{ř3 SA55&ŵz,xo7`j%?[j sQͿ7Mw3}T&Y|kWS)Pvp0J:~ߟ.mA-#Ё/cn:r#}^@J .x)V40?Л`k֤~EWUKQQ , mAO6R;= YZO`7Z}=g֜zy~E4{WxRX‰`^!.,83&*TC%cO 7KiN4_ PS+TygjzʎQW{hEAI6Ǫ DsUQ&%(38*}?R}|$׺jEZ rzۯ9BcPp@G'zHGO/|~iF6F{MJawB)!㧩NJ#qm()qxā-Er_`IKn=H" }>=T5O*)&ăޠNZjrX-n8+1χ9YyO0 ''0Q&(EՅ^y?oU#Ϥ ֝1M$ϣjqoȪ@ӤŁS<'yo˫GƴD~>/HUI >Xx_mEHZf1T(6?OiҀOoc}j[Q ֪%?<Ēsh)ϥ4)mlkzE.^mZΒ tZnXm6_wf !ĀM'E̥_#y#\oet;LtI_iN$OH_c|ؙld^A-F8MUcd@A}/ؑ#;#b ?l1Z%!4O_REo>RR"m}A?'=#;B+'?ROr[ҺD[` A?DA1 v1O#kr>OЋX(_mz,_:`oAѲA&mUxtOqzb/$XqK%KUAqk{{EPy]}#SV5 cͭp{sLt~5w#Hoqb_hf_/Ђl6?:Ӓy >K ,P]WE}BZ֥6aKɽs`}⚭l@Q{>ۺc^k:H<B./z[\NݽiG?ue}H|s} _K{l%OoLnlEW+ٹ7 $MN{q=jIFzO_=\NN*+av}[۫&E$Τ% <_vKɷ$YI^Y̽u$?ǎyFHX r \}9K`hV .mn_i :yR(5vUu6NE)_˧JZHF&[{BK˟{o{)W~/_Ew/wW b))ɕ$_޽HR?F{Rz [{{âȥVR.틉3Тr}?_WL`TU_4XtOk{A)X>dsPȥ}_kUV4]/Vvk7ËxS?ã0xù(VV-q܋itWFv{۶5# ɰ`ZmG(y5T,\,׽e²đ{S{?}iz',G^+K1HY[uK?=NWbJŸWW^8>hX>Ż5$RMѝ,xhl4 F.TYp}x^:ɳ7؂ "ޣT )ќ*FWT%T rHq *Rq 1ǯ{|ʴ1 _ApSW/ѢvC{V$cK]$ic_gGO64/F^ ~y~{;&Cna52in!;n[=5K%Lmx!srBٴ^#zJ~!Pe Jـޘ/=6KѸuq ,X]J@"4pkN2" U:O%HHSǯ5ur2lJnO*P0OAO^KYFO'jR #縐3ub^e(ҹf6=թ׏NE$z m'{VƬB*@ɤi꺯3C(F|}t] #mnpOQϽOۛG'f#`@>׽榗H<?t}6} z<"9`oI>hMzwJpt>vd^2qn86}?#?^DA疸$=={ڄpnޢ&oе#F5zYG^utVn }@BkZ}2gg{0sC͊ @eo(:(l}7-\R$?SV#Ϸkǭ2o\0[7m`1?{O=鴃#g\QWpQϨr4x]>Ԩs5LG9MOoMb4BG*/s6Ǐ^mΖN>{aJp6Qw@*i^oc 4p~4(H'J}GQ*(n/oǻ`?#{*PX}<Wދ2EqkN'SX]N5ORYԒo>zʷHTװHL.=,@|FG\HÞӏG-a7%{nX="VQuy]O1xUtD}(.Hc/qq=i(Suj""dsQ4y }zPq׽2"ET~~l}֝C'}il 5X?Ƕ4ӤWh=sDeťz~~ԯ1WpL5ŸRnBRNSӰEO^0Rb=",?WqѪIE.o>تd؝ [ްqt{ʣ;m ׿ؼMx؃:͇~{d- t \>7ˮ^!ĀH9 cf`ިAs?~޽mx꼟'˥C냐1}$_oM&~n:UXp\?K{kv0 }Dy uRIeCV*2 qܑqskrsZzx)Zg"!{,_p  :`DVx7Yqb^G@ocskyScYGzJucb@>1DRY k ӏJboȰS?_Oӓ=z?Q7!Aص:n5}Lףo$~Ofi,S_Yٕ>#.h,>C6??{XM[-#h{E8R $c迟fAnyFgP5?_uR[i7; '_z+ϧÛ~>_iGHDҥ6@>̫=h)=d?O>}]?l<™W:ЕI]{s%Z\BPXζǭzG_W]PTK+1MA}ǗX$#`_:pd_a[PD+ NH[c^밁>ux {u4zB7$sr<|دMI Mq_1\q9#$һmX@IW^Xz"pS^f*ѡ A)[6ɂ:Uc/U)tGUyKIA:ҩ5>*9{|VM3"ijx@$VGUe<o8KJHpyZGI74\pS4#:kƔ N۷X4\kF|Jӥnw*j)eUhDhŃ+r4h2-q-x>.N<vaNo"$IG)bds{p?Uc%1Z@17[{WjXoB/ E3<ԯ3 $Ҭ@j9pA^0/CSi!uqGژf&( S#?!Q:.XBhcմ:x)yj,Ň8V$ x>Y]̥;[M]T UE;.洿BrKAP  s@ =ON_:QSO=Hse'b?=۬u,qp}M?F8㞰ITU VSMYV,tFhz&Ki㏭Źo2̴(/S\:)xEjMד﬍dWb;ZJ=G*D8%:igk+\|]F * l[e{oJרf+A7zyTW_REGSҦ)qw$oٛb?Xض}@n#kGҼ `.jn0U>sc =a>٭_wٟ:E5K_.KUkIY#P}H@&rJ!2e${)f7c+HA4]k{UELY J }HnB/Riy,O} '}2*nGA꺩iZ)Q\o>A="cs[o{G%m65oL8o` 4AH`PRy-2Jgf/QH$H[o}}Z @e d%WjעCn{IBQUpcƭǬ?ֽۋy}Ms/ͿOu$5u$J,ֽ~vY'$Q~o:>3N?{|P"AUGx 0F:R.\"~?'{#5Krq.OO5‘?}(DjJ ?aY5z9'pia6{}G"X_?IjlSn?{s&GE[H_i&c??>#Ry<} ?װtGP굈l.}//hWΟ@M{b|8}?^׸>MJr~E(%z#XX)|sGjF٬IIt0.kXjoa׵6v2CTkg(N?Olvi,ªgO!H c_XRO{_oxӰiH ! *5~a)uvb.vJ۝EsMB׷ϴK `U Cbb } #Bg_/Y ? _Idd ,@"I^@VU]8EԸ\d2W;]ίc\y^3-_^5b.xUSD5XFϳ@ǯ9} ?}cu/`9eҾI-pߥE-?װyfո=E^}kcxdqV/`MB}$(V({*+&sdEo6&[4O~cbeefV:XiZv[Y rtm97"œN57gePSufïH kA7{Pk~$7~)ht 7j׻r Gy:>7?^ܲB#G@s=GtDceXs>mtWAtiy+?\o N=\Ǒf~I 0ynm{>dtr RyW@`@_k z!kZ{nDa '{Q}AOmTHβӨp5~Z$t}%{ؑChbV6bݐOdWdW>}Dtm[ ň-=6堐àJ\R9ߐ/e˳ʅ vp0\SEU_O nAIQIŻHq=' {!HBċA?ioxX> Y"={bPCH`/a?5@WmbJEب ~>խΰ>TmhN_@HPEG.Qfd ^ #).}+CE럴 *77RH:<7+/:!AnH@6]9=X!SW׽dٚYnG{mTSEU:3ʖt/zHlq}_d[q}'ԣ8@\[ǵFA{&>*t@4??_l1ΰ"ی~?HL{F)-Gw][Oܕ ~Xm% gnTwDX m;Gw^aPuc I>3u׽: Y-v?[~}}b*]p<#_{NՅmd_kNVZ׮~:] [XV b=%ZQSbZ]\"{~ȣCkX( a:V/^ı.n ?'ۨSQ@ҿ\[Ƕ]Ł]|buo׮MTc{ksnmcotgqSx? U0,ȡ"{SVL 'GGQwcTp+:pR{Z@kXtȦvp :?}T1>V$(}tlm'!I<ْ@tge .x  K^־%{qQwdJFz/4Aj?oژtws6~?YP-ŵ/aoQzRQz#\|+*쬅`X ҉ףN~Z Uk5HeM_n{bL.NVֿVr5|=2u뗹0U,m*{e^ Owcfc[~mn?%DZ#ߟbXPXr=(:Ot)Molu9F@Qê]JXZDn\cn/sBYN?ƽ}2~ΕDWQg}Of7 @"噦j.Α:R-k7-eOM5ƝZ Ty >̠G$+~.TC_^[%Un"ێ={ǯ{^_4Pf.5Û0OlIp^ ׽So,[zWwqJ wmޭc=xn%CW d$_pAm@e=O+W}$2zB.>3yKQ}^kJAq* SW-m+uvydRH s=ۃnfUr8."Q~ֽX[G3>Y/I_p2=ƪ8ȌHLz9)m(rB؛X_kv|U4j S3E:.or7RjRiĚh8z&(Xҋ*I SD)b IoGM>Xxh_LN>l3ƥF~ӜcˏJ-*rmA&3#Ab1 ސE[*k#Ԅ,~H{F8цո:~ ɗHZ^]0w/YҶfCQ*ZUr/$A~HWyy\ڠq<~'ҜL/ eQW.iBY"C+7ۂ/BP'7&g*ls'f%,AW; 3FF3N#9VO];|I{^oPj@ Oh 겧+ʼn>r>Rd"p881ЫaWq/£=`Uo hXFet?C C_4O $Q©v'7@nT~\g{0(D=q\8>c&u7Zo;}\ĕҵ?3)j][;iLm"ՠX݇aߨ"nE>tQol_p}e>z +~0#?T_1oጫ?QO˹Wi|>,]ɿzu3n f[@%!Lc7сHXm+%Mſ{sKzT\\X_W[mZuoyOրHTf(J?A'{{ F?WUqt T7BD~%` L 8EhPn+hlztR<7?s}ƚZ}V%s ^ؕt h?W47p/^O_`y "$;xƟہrAU6 /w'P<HaEE+UsTB1qn=݊%?@?Me?^Wy*-: $@r?1ptFFA?N]7-QEӤ(}~isD{CWL~ 7׎}>"ߏn: ܭo3n?xYz u,tjmč\s:N1PDhx'HchO<[ߩ~ΓʗO:ȯM__1\ZŹ7]mAXǢWS&2[_lcӉSX ,=6<OǽJ ~6*F?Ϭ?_yԱ^?XH *"eޠW<[)Lx t/a 5[5dM`oT )7*EnİouXTY &ޯǷ)Ra:XpuZuLD*A7܏}I-M{xsԄ`?#olMlܧEoHaq["~AЈE@]6?_Dqb?[4:GVnNQI{}T T^عsely?(1O^ahDԏ~ޝMll؝z}Yao{]L+W-kb)m@d-kxD'_9)g)91c= 6NE~u\.=Ӯ)kB7tUI?S6W\!].F:EmɊA۫iu|H9:H$횽2c((b_SͽB`1c8."WAj 09 q#QBS/OopWǽ.Rުjj~hX>X;_M`tm #$tN{`[N"G(*Em(_d@׽ժRIo{ ѴԁMWׯ{sЭTj_F4?GsԶ!Xj׽*j& & Yth1Wˢa:E:iSIH>7r5nȨKro՟ӏQi5%[[˪VLCakE@I[Z9r`M ~{PB Tu+v~?.WC<ߑ(8tG}{ۥS\  4, n='zykXڛƤFoonSCc_.gM׽̅e.>܍6]J'nOOd"fLKMnڡ1׽䬊SӆhX?>ջW_^]5)UN5)O$s>s dϤdj+*(Co ?DŪ>:,}2P}{ o6"-~?=>'j_}{*eY Wp>lzxtg[Ozq) ~Ex^ok}?n(5)z/nz }L@`ox&8Pek Tp"bU {ۍ=ԛ9 ~:ӧŠ?S#~@[OnکoNHJ]{YEȱ&r?Zwz+(urzn&X{4׽Ϥdb86 Ah[wS7ݦ0^dor.X*׵^赉NwP9pO7k0``wxZ`p4~>,R8Sso~zlZ%#86#ozJE:n ]{܅/O_{ON׽ \r]CLj[\:M>Xum4q~A ^8tBzxy"\[R X[\j徿_z]txQ?#ɽ(# =mn ҿQ!zjW\m!6_}JdZPN#GOǤs׏N-}ϴU*/o$IΧ>rJ[M҈AMk-'أNM*G?ꬣGJiA] z moO{]oݣ:+語.,X $Q+zgzn6{5 *J GTM>]{%1y-=#Omc+pB E(.|JSč?>Es_~Ϋ=t->**{Y}!FI*c_pi>5-ry쵴=7RMNG^LZu}@ZWO]p׽Ӹ*"hr> qxgjcZ*|rc|#<BФFMK[R^7vTF =ɩ Ak_r"4 CϢs^n:V2\ _ =I}}`wW 'E>珯URnf-):u IEL˪Ub֦FE\HfzFfMNc!hܞ>}-1iXǝ>Fx <Zn֗@'׏NmF𢚺tFBN?ԙ6Yxn?ָS,J @#;WJ\0V6o!=O?L=cܸ8ZiHQ!i͇~'S#P# o#[_kqoaYcb%>'?ou2IdM">=7ffW2xt$HG?.CLeQ$W1{#2kqՕ)xǗ xFP rOpA+m*LzTٵR91Ri:H?5$}?ӻںI2s_#Jqx1qܖG`]jTL[. }}pF!!3FD!x[vqW}i$|0}ϐ vm`;W{ ,UKJJԬT8K5FQq3bfT0%kֱ&SVOmAٹ8-,i[$y\ ԑwFa~/_ˢX֞iiJ,9ÀqOy33OG F:ݤ <>FHl\Au4+tJ  OКW гٴRFޖ-K0QE|y*D,Huia}}wu\81NmאFAt[qX|<2c2 U\Q6WXW|wc}/۝*6$_%ܿq5wPޛߟmh(Jy_PzTRVP0>;SpW${S[' - {v9eJJϳ^~]&-0`JROЛ}yceoft>'8>}X|=F>7 ǂok<*Bz/HY,-){5}JHU0:6ghJ_\ԟ {QA[ i.܋mp9x*G\"Ϩqq~>OZ6>\-l3j;|/ΐXb?'\cvPV.OjUaak+b?.)CP86.? i m~E=P'KgӥHSu&Q=eerZ2Nx?{L ]liQȸ* (e_O%~ko>upytTc߉ZtΗ9$_sǾU K\ϨZWGq2[_|x[/W"6{<qz\~ΖRkr_{tY &I`nE?7 S AŅXK ߃nHy|>~>n©/"OHW&GX0+n.G_'hqt j7 >V} kJdV7eQ{ ?v2xt{nӉ(bToŇd;P:NmJO>,bP_BeUZ7[Q{|n&2ɨ]l Z/Ƃݻ$fZ^m68RK#W:G_~ߗYT87LqWetݾ@ϲ +tTu~k:^J+iWmtȥ׌@={݃rr!L ( >ͬt/N?=G|ϱvsn9e܀GFkSLW,I<{f$Cڛ*~*uwZi] /`KPI #tUjŸˠ\0S{ [ 15 !@UJ|?WϮ& E{/dW={b6%,:O}tF{srUnmpCtC*wt7Fv .wrQA#/7R EhΙW7Rw.s^垮B[YX~_rѬz# WFwzrI^˶`;M(s}.8#IG?^wWV+rtm*uA:GoveU}{JQ^5A/7 }Ia;7?і#oc{IBȱ_#/ttb׽4xbX oП>_]O9` ׽0!Rt)n,_Eb;(H+ԛ5OՏ׽,X'/ȱ{(t |'C=Yř{{U[?,I >߃M;7cj{Ae]՜`̺EXF)O( 5UWe`uxeE 4[5O:5m_:){y[SOgZ/j{ ܡ7<:j[M={8k,B_{EMtZ#GGX.Mpmno#2#'C^?^[Km}?ˁ#\_HmF::hY.}7}}f:s_n~)_ڛhGMNAM$X∃ ,G=`+p#_GΥ%&nOWI^IW[ bŀ7>Xӫ.*n  ?[[?˖ҒLahg,Eܓq{HK دH?Aǿu]={ܺ]jP}Q7qzd:iR rq$?׷Bg)J:5q/!U #f Aӫ^t',6{H~T_K\Iq?g۲Hyb,GHZ4Q瞽6B\q(bX-jҔ kPubԃIAO= c`HyЀiTߨZ{/OLP??$Hl,Iq>c^&s" ;>ӏNĞG۞ZzFc%߾uQ$>Owb# ԠC7Hܽ^"Laͬ ‹X _C4GF:ߓ ѫI3a͉< }!m"Nu+'Tdk)okott h:b {h%.ȿLD30?96ѹa:Sl[zC>?i\r/OȡקN`t TJӍ:~ш:xcct[yݖiUWX5'X7߁#&k7Volc^h:KF C5?_k!m#Ctнb9ax5XebT/Ǵh)n$Ҵ. ye'oH ai ZW w0^~#_uJ\)'X?}RA_a o8aa=C 1>aLBo_U;qs{0/{{l|Tr&a:lmEӣZc}?Ϸ;k.SyOXtqK%{M}C{sZ'9=ǧo nWM7`O=:|N`:ym8=(fYlVGoz!Bit}: }9|>K_FZYڻ+4{W=too<O Lͭ$6v:zO)rzOl;~~O פz܈)-Gm6V{_@,26;{iJaB }zQ-7{F% j4`mHLlIm_%^-U%nm-e^HRR9lE<@U@q8%HaAɲiRY_l>],H?_˨@k9H! sqV=x`Jez5okbn <hj I9C86a} FT~ q+?>bJz䍫m?~ͶR"SK\\X.ސM+۵4ė$~< ޽Mnɨyا^ut%&CUo;\Pjl#Jf(djz1Cj׽jP`uWlnn= GϤ ݲBxTfK~Kk__oT`W^ ?창G}Wӟ~|?gN莕o^8fBco&Dž}9&:kPya l4Hx.fOh&5!3xԁSI[zLEkǢ-*8O7;{Ag`t;p5.-ؿ©!E--HBuy %mYC,p aqKpi `<ZtK8煴FOϏ}?*ע;HQYnYue<[b\|ILZ”Z@+`ǸÛvkeiF58yc u {ԱH% /z. )GF&9ZG @DY+9*յX=<(TЬG ͭw͊l{e =EG:ש7GrpVXBQeEkcvf'̭4ߟo6VKH俌9^ɡRx4ANQcmЙ[A5`R*f?A?_m1M6QB%M3%,y?RxMۑ9+ZSAp&s٨7_?tRT˸᧭_b[5oQ.jh:pu#.Fe#V Z%m;(VXQoF 4Wvg)HʕH>oeN3{{1O4TeA XHRS777}>3 d*sֹ E~ $1tir[pIIPFpA~trlmvg+' Kz}?X6(!T ?ijyw}f^.FaV5d J'QN>F lUyU*0 6 \?Ӑ&I~{(bEJ9 |t)@oB}W^GH)q`(I#-rl>B8~>y7uBReB9{{Rx jri0RZU;Lt8 eHjyipN [{wzwIitu.欟Տ-ÏǏTOn+v&R&?4H'2DB4iǷ<:{emP&K"=fej]H˩H9?ɩ`*Ԥ) ?ϲ5O@]v="}x{MZIT&B@O퀍GHTZ,Ǔ؝ԕ 2]uX>q }qetQO4oA *锥ї@76#[df4Z$I$3H7>J8AtbM[ ia}#_ϫ!t[׀}fJ>8׻!N.FEG_nWLP$/&}axd_0aAZt! }9`A m:Sxt-T_ˤ:RdKr@j -KXqLCi_\:J҄ |/>楋FrbO_whQc=4`OIuu-Ou[-^7,׵#{xMJlѫWzo!5Ƕ5?2~GV`MHL[-+P-z̫kO7܎G_g^SE`q6z>z&h(kMO tQP bˬz s#ȩ@`[\X@P}kÝza`M9#ٽHBBb?p~B%FoNJ򶨺+f꽉[Hyj#%[MS^ K Pt؅~zgc`h9ʏ8l>CL, FG$@?ujgvO0Jjs_gL+@s]aO?゙j)ܔB.yf>i~:C$CYex{H{4n9O`}3V|Uox4B}?ֱ6?F1s6 1_X}!Y#^ȌOxd&!u0~>I_.2Dk*o&Os)*$u1ʿFT.$.vԐ3q:rPHo{'#-Cnxi\U֑ZItP_DIcI#ژN}/׮a@$O%L*2HuߓjX HoX佯ob3ѬEV]%5Wȯl x?_^Ϳp«3$gG$A}?mcUpR2 j߫%hou0I{} #8ZYK:C8,O66}mohF觏Үix\8 q $):QO}h}^GFjCPNE>Xr?q'n_Tfo{ k()%>X;6#'ԳP?S,wVhYO^+̮n=Em_ ?ˣK9CI;}{r%I,H."G*/mjug_z o ,o eJѸG"2yuϳSFPIX#?~״˫ uWˠm=]I*豱 B9 UwAWQ^` 6 ~եݍ >o7 !##m¸W8pGaNEafPW},'od5pޱET#U_!_'Aa4{yMdDwK:B\KL/cne>*}'`d[oF#V)׽SI"F>^u U?_EOujuUNIu݁%Has҇W玄w($\˧{j&*+\@#ۑD5(\t),lPumّ(9y }$-}}od&WF[WO:^YK1VM?brz \zZ.I 9crI#0p&[r8U9f!`Pnn\4r={VىpH$OE:h'{ĤEҺ]662"DgR_˯{6GrGrSaa=ꡌ??;W{~ճoNbm$BR/m#_֚o^$}Z_r})N{"'rkķIE1(ҥ:XQi#^xHK[~omͲcH[oup @olC?Ld[|ׇ^$2 n[nl9S{eUf 6?m@OQ׽ͧcCI7T^J3uyRx6soϽj02L>qanEzȼ|6Bx7u.,z4I?M `+z{r#BN ~>῟Nڕn{&TyE=/wwU:M?$'ME{peu@*˯{wW_ǃ~}]Gߚ@7o q,Ǡ{JW:*"ܒOzD8 )di1 ksooTz:fQ~o`H A 킁̪LH 0&׽{uݕOmxacOeFab8HlC6겐 }:w϶x]ce& n@[J/UZ.:ԗAܑҚ cg{̔Rk[z)ï_ZѢ*mr8GaaϺJTuVjRi׽aa"G:,..@{ޥ_pS_ϯ{_E%8[@6 \>#HQSӒ ĬVz?LKr17푎HTn@Qp~'ujU&׽?ڹ7> [eub%$>B߃n}EF)Az'Mp}\P'W:E|ytBg\" h9IX{X~R迤'U|KzvQ-R5}ny,G'ϣ`N >ث$Izޝ"nPn>s)gSNT-ǏP=*aq66Anv$6HIj>{h"KpOӑ{,>2kS:XG6&ϻtфi5rW[r6`^wXM#~?>ۨbi H\T/B+/6&Eo'e6WJ 2=`Y6}8GgpHCzGԟ϶W=22Y8}x7゙Lf>7Xյ׮C?zy`@\^>ujׇ\yǎ ?{?U/P$,4H1ZjIî@}lxs{}T'Eknncy^=(O+u@O6בk>2U! TR-[\7,s%${ * m$}@N=z/N[hĀj'?GunP$}AѨ<b (} Ҥ거YEGJ#Ϩ'-M/mK= tBiȌl}=So<#ۨ4ףbK}OoU~-sϷ>ޛH^ aǧh+ޕ'l?ֱf3J`pM_[ڟ RGUB-9SIW%E5r!rNlkӭCiOaROE {ojXM:O?I >=B,${\' ݬzqYoo_RԩW'. ׿f@NxX>՛$өJ݅h?_cv*bx[Jf:S@Qrhҭ8}3U:E^ݖĉ ׿6=65e _Uַ[~u>k =?ƽ{<;V -pJ\"R}ŐsMQ,?qi*uXvRI,e,K9"/9{&k*Bц$m*$ r}?{@<2qJL>kioCLօ?ϓ[*v$ti:QP.[ڎ=-61,d"F,iTqޡCPi|fL3NԦc\,`0( y[85UFN֊"cv[ٹ-_I''dEiq*cʹ:( J~ҽ,M!1VR$Bb&VLdTeX `z܎H X}6oEf"WqZw(n2+H4o?Og Y&&jY!eЄ>E BY#9g 觭(e2+5C;_F9`b3G >t>xh:(@fF)N[S&BCW0_S54/ƟۓoiCI%mT H4 2:VXml?mPn lXtZ C >}#i#ݫ_ $9cS -3"QHS[l3KG$$JKJl^plGEpރ $O'';A/t' IJfIM*ac.O!?5t)Z MA cqoMnKo$+xʃ>YME9fx!i٪ᕣSQ#O3?*՞Ï*zJ?VO6#ՔOOxv *7 q O9FZ''T3i=5c Op#_0ӝWM8dۂ~޳ϡ} PZ폵svEV( i bYzуC]K!b Ž[񿲇ۚ>><.?Sm*Vly@(zB,Eb?{ۆw]E>'_O}Id_>A?^}=џ 󽳱vdaӾsb>SW!=> e2>mR+0x+?MÓ/Yq,r~sKwl%B[dO_/-,Y@+Xs=̧ωp}iP?,+'E8M^unX_K)")ߟxgZ;H$kD]-'ljA:IRoAX?Ox?D[mJZEa-̗߿DGJn Ss/0OOE&<[{lUD}?,4MF?]1nuۃmb}ŸNo߷] 1_N)TRI^}MK&d/lplnv- ~ڒ{O?}k?qv I E_ڰ|V\<}*qX_J|e7%N/P5I$=y߃ž+.c}'*-XոGTҞ?b]73?нv >asn/yz{||{zr틫~)Mo G Cp%66/Ȁ@??j=_?~Y/V@v@iMT' n7RHm9\zr틪~8?={쾣%YyP;{.=ް6q"".{ſ?^hxL])X{y~zmt!B XOxN\,xNw@_{rD.DԆych qˑҽN{;O{x?t>{<r틭5'&sˁR`ʂH?MEߵ?@}wGl]l (нpaaiy j8]9_ >{Rd.xe>OOlC`{͸}Pȗq(qn/ X?]foԭuKxAZckGgЦ~=G޹Er틧>B)?rROn,=_qE.<V??Ow_o \n$Җ?mi^'ѣrIsOU nEBVP@~Ad"c܊}']*p'A,Ѵګ7SX֢"|i(ܯX}e /RQ#Vd]y?i[ߏ=s&?SlEj0?ׅE?ZCGEa{36mAyޝN&܏I!҅Fj߱KXmu#=|1Y([j_ܙOlZ|]0G=@\X{lOĪ].I$ioJnam7y=@?ӣxLykcG7 rρ-DAwOǽ'yd95vfQ Z1sT?mH6e&ɺ}A-:bM|㑍^Uos*>+TzEYAЀrϾz7Z[}N]V זMn8Rԡmr#ؔoy{ pStN=PY/I:H&R6_WKc+Eo[y-Xehd7jvnSPx䆪pIO2}JRއ ۹oDhx䱳OԒ?7?1|SF@R@q#9\ELP[KՔ]l=KÒmOzol@)L9rOK7?~}9+WCiuڟ#Otm܄,Cy!j=TIqg 'rl~$xe"[a{ov퀏ߏ<O`dɰ9RPϤ}ˉ:rq&w.Y~97^O3+\,Ffwn.Jw*Ttn/=^Qt(VZdc`A;ȟ_bU2"z[5 ˮofsOGu=f}7Xp9ypy_0dYL`TS\-}~><˺>խ1"k?O?ʽ&H>6eh$^x}_߾pgot7o k?_"?ksiӹ2,zOm^ou鳼nw/_okt 1Wj*~{uoZ}Au?K"? w#o#xG{Nnzxoۅu ?}'B?$0(#w^@_co'hivn^hݐPx[/P {/q+{vL pHO>ۇ@҈{x_²cD?P$&)o!ܭӛ} {e?izs&/CuVx?ۜɇ/;T'*W1}󇄻y}æwk&oӥۏ&#-bJ'߇ߥ:mm[ i\M\+|l7nt2X^VmI7ON}_OP{no)>ɪ ]?m`]};~??[pq܁odF۫g喽i{mU_~6G>uF oQpT~e})O7|^ڵ{g=usM̀}x5?W_N8ەF6kI~x~ݺwS~YU#9$/ܾKΞ)N<~5m._~GyU=[?/pbGf\$s~m.O_/8]}ܿKC^{?EợkwXA&_zZ~8xws\x}$.6K焛gZ*?GC$$a۹Ϳ'l߾wUyy7Id+b;G]ȯԛ/?ܸδ7KŨs뿻nyHp=o6 =\?gUwƣ_wQm^ _ɏ(|\Go[r;rޫ|{/2_˿O|x] -?J%P[}BkJ'v6rO/Z}qgJuѪ^ K}@-),S1#}I~0`O{ƦMתu_?FRn PARHqΪcb._/2m/<(^bc]*\RO?ĩ{W^ڽ=bǓil]K%z&"3y*dǾ{?Il]ֲʟ;QzܽrF*H8Μ !~?{,~Tp-{*W5u= U?_wQJ2;o]>XJyoD%QM@ߴ 1ׯM`l/bӟmw^F:C8V6~-pA7UtN_}tE$ElFpǁqaߔiSA1j\u5ɞwu+n`gw_UR}IyzVa{Gt=捂XCycq,ј-;EmSC!J)8]5=wycHJ8 A5:S,J .4%\d/um~d(fᣬsu[dX^9T2{8{ybKk#? 7[.zztR*Q+R~bN2CrHy ?Rq>DeЛz9v_WHqHH_տ{n: ӛ 'g#Z\Q_fa<#ۿLO^mtu\y??O?ʾ6G@o/4Ӂcy+p㹃e'OXqi7'9p>=dW)k>_ݮq^GIb%?g^6 0ТĀ}·AhA6 39ؓMy4޿鹎 zzܿWE|GԦ;Ze쿐5}Xj7>* z`#<[{mF _#sk-t>~{´[bzew-Wy+T?DI~ __}zϭ9_L}GIIu>l=r/\/ȧk4?R@P÷zHr7;?ۨ{'q$cs׋spm-SԁO9rO6>/Ϻ/lXn۸s?ׯVou[׸ VS: -O?KuCr6fAny+9K{nmZ,7Qf'2yI{@?KxB׋_+9Hwu`o Uaޜ}VrK`nR|N/\D?>?ʸ1q0[XO{I_?x:7\V} ny.>+hbu(NrH_~?qJ_#ؒ؎oG-trH?Ucui?E??9'Qbrߟ+"pX_דvTQKS zXW~,#C̶V \[}n%ڇzwGq IQc_~'oo9U ěEl6w=c8pjZqjctKs녫Hvq >{Wzq]I#r1pO?~%}:Š?x}"_$߃cˢl_R_Nyon~{$_7?r.JE\k_!Vk Ԛ38_/eBEԚ?dV+OjԠ"2RJ~{N>#?ɺ(g`4y>/wOR[r)_x%~?ܖ?`_7on,?8>+L_Rr0{r@?-޿+Mg7=?^?}+^'{'}NUM-.baeu} Bf*)*:2Ur_ {nP\A%2hxY$MQ$ҋmu71D խ5A`DɥÇ/C~o=g dsy.)fj'eR$%d?C -=d"j`G_nHwRkF:G"Pө!AqÜ.]zI7RInN="\))ǧXe[Y~=Ѥ:, mL$eroGXmk7~H"+ѐn<6/͇.F9'_?>T˨ [B?gjts"-yXuF6ALH?A?_iq`osaaem>iSǤʽR?}Iix "JJXEu7=^|ԦY>`Z[R^LڊR܅&p$j@ `cwA^mEn" t齿_nj{~Z~?{ֹM9ا+m#B`MP>C[.:cjS|6Ų=Ez+:swYjigroiq{\m= aʼnOr-wb"`8Zuƅc?/Ӡo'yY4E?SAPo_KlDzۭ,,ܕ GHo{9{qxS'R~۳MlMMr'WzVlΖYUpG-J@tGPrsPȬѲ%ɉ$czu>2'J| =(ة؋oM`@U$ǵ ʿz}?+yRK)6i!R4:/0ȍ]siN+iiGh%q3t___jMQ9tQoȰCs)|VoqF>vf%d}or~ʼnA@*?SZxi2b@?ǽ]@^`U{Go:?0bW~EK`&ԧ>3,=#y,o?r'EQӔ"F?u}gY=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{Ћh۱6\z+sۏ9ཿWJoVWzh⩏Tg>8CJhiŹ ~Oc^0S.cU:wlzvF͆2F+qtňJ$?ϱ~ FXX [{~Ho^W04jCt7"}=0I*U\X}G5h?ՎZ)aӔy#GVG3,r?Ho{q!/酧;A)O1on28rFBۍ?w <@͎#{VCX),`Qi>bKtgEU8t)׽[ %I>>䌴'^$=zUO~ן,G?>ƾ_Pn_iS=6wӃs wQKeToe?/^vbLRgu“7o~Ko?z }k羁 ?S~O}?g}?z{_];u_V_x_u.pf{S֨:wٯW~+//^&kֻ?{YSר:y7_[ֻ{S:w~+//:?[߾ n׽ɸ}ϥw||Pu~n+[juy=謿){߿w~//:z }k}?z{?һ{YS֨:Cr1+\?맿}?z{Ǹ}ϥw||Pu~n/f]_=謿){];u_6_x_uu}y7?Z}/V_x_uM?k㧿}?z{q5W~//:y7__:{YS֨:fV_x_u]~6+__=謿){_=;}+}?j{ܛhr{YSר:w~//^q5ZCeO7[3fZ~//^ܻ}3ek?_g}?j{˸ֿ{Sר:?5G+ WWVxq=!UsT۴>9m7&[|#Ô*Iw*~ :Rˢ}䒑uFU]M:ϧqqTDQPuG^POragWm?J?H73VϲI XkX\Mϡ{z5H\?ߔGJ% ,IvqWdpה\?>fKK6%>X?z_ϣa}y%.Q @ |7#G o߾ʽ#3kFb ߛ–K ܓ.sU `G>!P ]oc,G[)Q;ؑ{o.GRGUvz=yzʓ7zq)>a_^3t:GGRtGN$sx<}(s2* ?CmǥIM~\:n?#oQ66܃`y񾆩Js^AoZi 0mC/N}VQRIʺg=KBO͏]T$ t+zl׿Ou~zaYTYBo=eDo}?UUU8 *'_mCһw`J냭R ]BM^ͦ k޼QJjt`}/oQf[F[Ln^9VWB}7O&Nٹh%2LaNvKmx<i"H^XG'w@Y1%*$qԈc$zƪx] ?'yt憕nYJ^M"w!m~_EXHȐvI_mM"g+**PRBݏ1:篢*R6p?~+'i|&iT _w ivGSQ2i 7܏ihQ- (,bp7^ǂC.8ϩ94jE +C-ݡKD_Q U_igQЅPăr_pk1֨X]RtZvE4ȍ X{b=rE1/ju*3ҭ#sf>QRy&E"RHuПb}ovP7hQKX/X}dѵ[Vl~ñc{ی1تh瘐.A#nI'O2xWM0@RK@>)C8u.HQ,IXjJ] 6x]6X9ߟ=F8·(Gڰo_ԸCn?_h<$qU4jaqRKo–}>GNGHYc_#WII.$j@G~_{ُVY=Id@ ſO|˟Ӱ\y-?m=6VUS_Hz7?y/ZS,iYdEu>Q\~u߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽~{zM}Ͽu 4habE?K޽˯#_o^Rm,?:~*؋K/><:)׽׽ߺ^~{߽u~׽ߺ^~{Ћg?ћE g6G}$YZջ^wkt9tPm: z~MCD {~}vk0og_ϥ;uAJtfعq-m[qs~)Ib~] yˮ,>$*R.?ֽ~eo?WHf vi:?[-IhϨ.8_p}rA?N T95+ׂ?<SBy +$%"]^L W~gXs~~mcDrJo3c GF'2^WSI@ }O~߯PkTkT,“.}Ok/s,"H57Xh??"ֳA:o{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{;H?ܧ}k?>QrϢm? wO1{+_^=E?Oo n~=9`>ҁ@KFMիyWc7U>xm|ŐYy:VNhteiGu>/qSɝ(럿{^{{u׺}x׽Ni'6'1{=48PbC*%&DdT$faeR}9NCd7ZK|YV?M}Ux/{c|oi*DҲSV#*I$iQK1:T mzw~䧏{Okeom_zUQCU&FzZ$!Pu%`Mʖ^õxSZiHTYԧ !3nیP(E4 >Z8gU:JHZA :G441$@U7k}@t[ jd5xͳE5<͒mI,j7ؓ='77od0ttP菘].䫦 45Wc$!Z 3UR p,H39c#>rar-JV/5)=r$b~Oy isknv2$8l2P/H? ߱=H}IrI<~{ݙ|KW]bSv>"Hf8v͛9{Kf)"2@PU-H1`A{˾PlnԱHBE4b#J|dcUz{tr]$lJVhE ϙ1Wn|4vVmwlQ\>?%RyJbi=G~`|Sl_?|1U1䚍%+"4 d(E۞|hmōT[] Qd ɨ \4ryerC4*ЖO1=Dۻe+!ڛlicr/1->Z&=lxdh"+p*V|=4' =*=׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u{|%5qSsk=t?3fR\D:f=/{jhSEIIG;NJ_ċXOl_ b6G8PEԸ=de~8bSX]T6<cEjq+uXso6
    zkj?b`O}g[==sW ] ?OkL^[m:<'мݭڪ"HxJ/vM͋ ,JbxWZL?=3iPcQ̎EOp)uy"nX! A7FГg(l%?eB)_W8:>/U$j9};}8օT:b 0%]C,MlsTW>ڂbgϏ>^ZOMqst~,%drdFpPzG55sR"G*CMP>[c?<5'_F S"]4LɤkP#S[OSiv%4mTm/VjypWܟr#=xty W: k;zqQgڞr<{ 鱻VeVUpln.kod-V+wv]j$g+WfV{6?IA{sCpy&X6<ۏzxf!(j?>y}ߝèԛVk$eV7q(xԩeH={sE]_%p;hx$E"J8oj칛Mf'[FUL@Eei7 æ<ʟaUb;ݒ)*=LluK$R$xH9 Sᅰ[Kv&:#ֿFFo+biM!C>Re7-SG+IcrЛC1sp[a`̲"p*/>{}GcרnI\*XQ2ߨ0 $u۽wGˉU*~!GVOWNyPouX89r& %Jp2G T"%mֺgPw6}_w~L)J8\;ъ^F;9Qu6_Fk,)DZS"\PTRk>;^$oF?<>]79&[dq?Ϣ4%a.P)2_#8G6$mvUݥUH+kH 4h+5HV!(-|4$pO[\QTh3iV)* >OR4F8},nmX؟fҪM-4*FvC[4A ~y_HяM4RŶ|qX dJ7iAǠj=~A=}{ζ j)mt ԧmiv,,N?ǵg1!/=k IsblNX3tPe?`}ٍ>fXF*>I yYVF&<v:zG)#" k |ѨbխdwFP@4:XI7m]@$&#{g?֫%*'o>êݗ@gQ|yulj´'ͮeէ?*د'kfCmEI BsXt~Z#/wu*u0R>?[[_:k*H;sMNÄ_|R\˚;Y!)coQ=Rr-6޵?EIH|s1uGU?'M_GS3ugY}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽?@O{i'^cWȞSPS |V.)H9Hi#dh.w=q*M8q^/$rZ[h(V91)C jgDv2JCHO{C0wSTn [lzyrV23S05>R;]c]E6\FGf4sø9[OxV#G ;9"TM'q|zy[\b8=n呣crhݐG$D-w&o6'?x6bS :͸i3UTcXp6\9 zZթO p Al_Zj~\*ĸ2$E1CF C^g[=9 erb>3+))jLm )R."MoNVy'vcփpcej^l*Kakc, !FT1sc"P)`KB|٥@4=_o le,uZ?B$USUiX[&6 X}}Qۃ;n}憣A,P`1Д1.>?Nsr^znN6%7VK/3)cY)VAG-{BHʶĥ MAj y2G-n9 <9N #Š$y 3ٓ%=as8ʹ258Z<۳?NQl:?+KZk)" d.BB)z.PCm\4+JS G[=4)je4R"#)_mq_]|5!E;Mj0Ǹ\ ߛݒ;VV>xC=0r9F4lVc$7<õUkwV,DyB AVfx;G<?|uBm71vPWƴ>Tb@lSR/v'qsg(Db,2\n7j%$].B|J5Jns^W磖-snQxϕzA2cPѭ(zH*k}$5]3_;|m|+mvFWc3=d0YYMlIDB_L\͹~IJ .:/Nom}MDL˥M8weײr[Urf,nXW. L 5Xij]tam@s[NhrQEj*cVӝ,Z Å`GZ Eʽ(@fȭ i\?r;r[xxjGF$=+վMj7֪jn'hv`aʒ$TApA x~:W{ߺ^~{߽u~׽ߺ^"YŕE\oMß|+IVL?EO ~y?}=.>)JD4 i:Ԓ?I@_>`"Ҋ6#PJ VC E1j?^=ICI >}&ʼnc> e`Kj[zVois_N[zt4XQ>-}+c{X<?lxa?Z:u/v^FI @Gކݩƴ׽*BΡCq[Q:Q}J/^d[irtAݒA ֙D6b}_|Sxߡ ?pJ>$:mM Mgm4wm`ߒ}[J?XhteOp6N=#޵ S}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{ѿO|OB/)ۻݧD _k19ztA-XoHB??lwˎ>} h2@S{kMoFruGrb}*po-ōS^ډb=\qX9{ u(h)׽qAUk kՠ_ubf\_\*3OFG{k}?{E վ}ԳY[o{$!1t`=ؒiEO#ʍ,.+xpx}=9[;ѝQӄ\GhOO&t~{{u׺{^͏/[}쾦4br4u1XF r#y@jmDEWa<6vWŦ"t5t"FˑRnm##Mty#^_tך`qU|OGAM-LIqąMΕ‚O_Kgm۝g(ڇ.<2CC"E6Q_<]u{qrر ԑ@A HΝd0 DƁ |Fx=8*WNyl"z:Ȗn+&#!JqƏKzyr띭Cf忁364Yi+㧩SQN ̦?ҕFF$q$N9$qAďyy)ƮZLjך ԫO$ՑҒH$z(«,#?XaNbbnZ 5cnqO44(YiA7Omb )B;6TT{xhI]5+mɹd-`qbllIOoj Z&:sRs ?3ۻ`7]`S*Es_$5# ?ڕ=WR sF%T6erab OEVeۭ}PΟMEMA-Qǥ_SW6Nhu:VFQQQPuz6D&J>dj!0e?[?=t_SXA_G(⤣lBӼϠTq$qadg=l:s#L45jz?by-scwqRAUfUΪz0,m%--4d(0I?*w pE! (FrT''WqYoܙ}M6ᯧ> {3Cxue8B}7zߖva#pap ' ZA={'{\]H'ΤdБ#ۿ)pM|-:2kj8"ZZFzC4Q\#*]=I?M{olnL=?Vu)}> dFNݓE#5*#5fgY>-7K/.'We2SUSIĘzLiD8eJN|9{mxz)Xb\Ĩ j4Lq_}q{3bQtw΍Q9^H6!(+ۃoc1\f|U-B kk(d$ gSN5|wMlIj2N1*߰|<JXe]ua|ŸI\3*#`'4:*.]FAC|oM EI@DRkJ*\Pyt{:qt콓qհPTA6xzBh:QLw(8{D娬Mck?ەHGӭ<~{ X[ݕXMXx}9{qHЩ,O&VzPD>XG?lq ͍9JkH&2YI?_k=UyXI u^p:pXZCk Zꪊ8gFQb/{r2\\r!K ǏmMJ׭1bYx'~EyzWo{iZu#8oƛ^ѳ]³)V>H`Sȷ=^$JyˠwhgWI69Bшhb^$ jنfƤ"Kck}}.\.?AU]W=v?zk]LҲ$Hi`X_7j.0n%b-cyo`K`1GֿBkpЮ{OJ]K)M9b;ca bp9{炢Hw+%lF3$ǻönÏFnPĕM?oP.X D˷PTx>fdIDm=vRk[  F0REJD hTҧRx$aNWLڸg'?//:g::\R'D3|ǖiye35{9(ei BH?OiniP3ơ $}8<RwkOψ~^#dݬ~ޢ))$v+9@4e}6?וܕ,^  nȭr0k$}lU<*iG@2y3KQ$$;Xj˥%)A.}17m?@XxM̪ ^&*y8엂&??.< bJB5OA>^H宨10T7NO 2ơBbA:n)|76WYSPME5zVUe:H]*5SǤC\-Aʱ ]QۙdU^ۖ&!P"  Է_/ŅMݮֺXH?JtYh s|Exyt3RJ|rb2(̔H6 __>dg[f/tt1_iͬ-6@mڟ1[cHS>l·>GY Ytk 1h"qc,Ma <%V2ʤ͆ϳ8.5b{p4HHاG\7?ڶAڤp+qIu뷍H?O!&VRX_@͢ (f7WE;.e@~?oi\N&[IױERej?~.ٵ8 S)jc{7ow)RV56ܯܘ\*?P,G\?/'n-Vj_zaF,\{'~YFO3?<NQӜ?kB?sK:׺{^{{u׺{^{{u׺uiώ 9SWweeh5m-Ee.:bfM5*?@HKuib-ԋ 4Aà3sw+rmsU6V*kJ=}Iͼ6ˢ%76kPUVSk7^MWmYrF%V8Pc‚}ůNor4ui{(i㕎&ʼnARUg29“JY M>^ßp~-ŗ 2;`U *Uk>n2؍{Bzm%Y%h&JPcYW$eeG)*|cPuJOr; )dѢ=US% đ탙$j* +RUV0o0z>k\S_}2XGjX1#!_m~#tAmpb]]Q>zlϻ2sj)_xtIO l㧋zSCAH?v#}.ChA*fI#, \еMiZԮA yy ËΡ!.{M|/unřPgwV WCGQP5Fz VYx*Z*j*1I3TH$}! $$rxbFwm!B`S Dd0鹮 %jR tVǶU]_cWe744}j*:rI~·7ji੤3ü5?qCMMz**kj%_NЬt ➚HNuq2MRj O*"T}EB M,k#@™&"?B\C&NųCF4w0oOɺHdQ2xSE@] RHV.ɴx]avWܳK ^VLOIzꇣʡ͆'VV f,ҽuV 1ᧂ*()ޞLKqQF?xAM*Ur\_oEp3i[K95 E̶upҚ3ƔXɢj5aӾ *À0t;s[a`:(k2ŐZ5ddѯ4tYa%%1=櫨0$LB # X m:ɦ<}p'2ma䇓FҌEF'WK7lqe Tp.deLjHӬNj6 6],R))MOIt +.`$ldȐ]JL )D('c_MMSLB[ww kgpJ  Lݴi<.O=mͺ'},n*,[vYUQ3̱GdY d)詓HIKF2KQ#̢%69'FjeʚǕ4s#+ 'j Pk$6BpTJW$09%GϰptYMu ֍ =w5LU⧧n>Hf!z\N>*Ri]'EpFM+h2z((T){šh)Uyu+nxP)M)uF*1mTNb0XM*nDvxn}QI&B*(p1TKa7Yy*j sRݘqͯ2sG60)e*i<'ӏs*e H8|HxwXYUvVx/m# eOϭ> %||̤ bMO%,4?m=;IM54T4d) ALjY'ۛ3M>?oRaњz^~{߽u~׽ߺ^"Z+nM9_{W IvkS[ޛ4UsTѲ)/7W>(b8tAxIOϧjUD$NŕPUz6[$%[mY+$6dREU} .)z1._Plo VR*ԫ`İDTt]uiQxu)=>h,Qe$@ۀ-ѡS B4pæw!A`A#WO)g:R@z&;$h}'q{)Ӗ֭s&>=tiE4: C؊Ed'gÏ{붟]5iYtgG{RHM:hbA6*T}oa N?>/;!w\K./R o-?Z}멾{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{uhM-2_n_!}o?iPomO O_(]Tp}]~LIl S[G~&c"qQrVKslSqJ=MO!nooPhI=]dj<@i%Rĝ$[aP5/x#W{1 !׏M鰹#݊2:9 uR.?6lYhTābޝI5&2"QPsۻ>~ |\OW;}=zoN?[ީ<춾\wG,[+ҧoX3qJ:p?_e?ܙҎu׺{^bx-ۇtn\.+ %E]ee\8¤`Vc` 1_=smUI$lU$2x(,@іѴwdM4*4tb@f ?'_SN#RU [,_ie(e|^R(ep$Tỳh2f{Ϲ-RZ6iPևO͙,WK94Uz/;z *zL:%2ji}flީ+)֦# GJG#1-4+TUuB s–QV%:|6q4LS:Nd 񢆉eztIb*ځSWY%M8#%IfՀN6Z 1:\3 d\xK+k)鱕{Vo g1r1ɏ*h-S@[@fᨨLn&e1ffmdc+W\Z4kV.mA0M,F!WGJűiKT\bHwUͺv*;Sazq'qR$!I%v6hҺ9+#<ž8!P0md1˚*WjjrppImMiS̡)t// P2TV$"ZZ, V5~_A=Wun, z1UsOZqCG|=mT*2s㦆fȩw|I'N(Tielr"_om(kBRηi`VޚY%dSIдR.v3FY-ܯôꨎ笧nV=/Q)i$u5[HF(}iщch5AJ"8P_EkxSS)gz4TWhkJpܝ^ӹ*aMY}uoc!{ObbeqO?̑SdQWz(u->FXaR2jZIGC䆝Lbp{IyW|,6e9Zi=,jN$`Pdi0OG^ax6^++u[Sjm04ݙRh/2ꕦj`w?xfٻ%M%{on pۅ(EM#,5.1`ʶf)/BZ1< m5+Zb)W"`Si&T%jGH՞[KRt>y=ѷga1{!Y3 [AKͣ(Ӭp+I$>HeA chřxPÔa%ZJu}5-=\Py2TUvh%LZ-ދ^+sɧQWaQuv֚֏DJ0 R/J5(3Bu61i:!Y3 ՋVUettۿ+mK<}7AAF*y$.sO-WPnmۏddӖCW&wƢ1 t1 tEM#zEZd IUԕ o ֝g7}fJs7+s׼hk5$ZyXo?(ٜ^z˘Ag6FM%6 w০ YʨѢꢁP_6>`Z=ϖolH?K`ꅫŨ(=Uޭlw!κݧUY2Кts:)08}%ޓuޑE-wͽeJcYVe*ե䖘л#[>|63pT<ރM;0X+IEA,RUE XJӂf7nʟK%UR1hHA*ts7VRn`LknuìT4r&E) fw^{qGol]WNTPznbG.Įm[ZXIsUdZ. j ]e'!9o?3}j:)/R@,;Hr'd$D4b?܏-\z:gzyQ]sˌ1:mMOCWUGO#IAV>nZDvdtFisSmzkBO<|[N/`l k߶[oM%cYҠ Fp,VWڧi%TIS±$3Gy-#y~}aoivvoϏ]ͷlZZ1/*\r?~ٽһ췐^4sh>i#ѩOpw)mfIq:.:{^{{u׺{^{{u׺{^FHMzI?JEۃ}g}%?ajcvLbJdqcOeiFbp {픽1oR6]HfZOM]YpͽzDT)&rl~uM6*osnx}iiM-`AsM2b[ҴJ" zu0 UTk<Zt8~Lt\pG"$[jYC! TLWQ> (K%,M=EXN:+ɧzu[?6?ŽOc8㎤[X_ůP̆oo}@o^PRxIa`}eK[Eߏvt?>: \_P7Ұ]TQ{rX,颊XP9zڡ--&V9YQ{1o/Dornye&쮚0 :дQS*OaɶG)5B4զ}V'iVT56&&Zr ȮI|-'/oBl!rʒ;DaI^J?gsop@`8S-o WʟQE7$:qxڊzJ]Z:4ryx6?/&7EM$jE؍E_٤{b9EX6ǎF,#ͭ}W{_rSq u *c͹s~=6˖0gTG{~1uk|E=BJ3IP","4^V78cnc&暒|!D2DdVXHW~8)A,A- 8P´43>}I;^u9<[Sת#_eKm۽u*BabI],/;\8m80E0f)J:}zbvGOjh-4hn~^E,=__fV2 u?D; JѾy"rTbo679| E]]IWf'{.yϕ1W|z6r/run̪m6,; .A WUTϮȡZVYq$eva{ (($BXjZuvr\l^Z4(*̬:ERU$W&;WۏrPdwʩ梩nlV*OjpՕ9"uWaVRt/6l-=U#mmT;z%]uxԉ i#xjf K ve X .H ~ƽsߛqg2$AUd$f !K 7od7g粛tor窲_.1X1[D(ղqAE+}/64kUFbM%d2O0JL9M3(Yqyb=UDqQAp,] *F`̠N: kHot:E J1T3Jtڽ ҃lek~2:KEܫRbq3+6˳=t6r8Yu1xj3IºuW2D'8զ; e{e)5k Pcjel`V+';2$XR1(h-Qyo(~Isې**r<NnmxrՄ2}#ǵ*xz8[#lJƐ׫Fed AT*hj窫\))EBIj|MQ<V:%!J%:B*0%j9#(\zrh6xŚHڵQJ"P!u6ihu2Cq٧7 9z6JWjJ%*jePm#ODpj]`ZM?@ԾQZB_SVfʙ2#&wP k WB:.Uu  'NPZ@ێhVCUQw6NnS>!mcqTVGEV#.:))I 0U$yW!FR-6 \^nEKOxu~׽ߺ^~{߽uB/m>5OFS`k9QđemVz D_t? qa[zt7RjX-9ٛ/1#4&gϡ>81?V:v`MBդ (ݝw{͵颈D[DX`X/adz8P|抶<*$Y~?cDc]&F@҈sN,Q$x>lUVVSk0: .Iml i_/g_v ]F6QZ6A\OϱE_t ?8z@pn~(cU 486o4WqfgWQ HR?7ןg[fey:##C@RpI9/}P}=?*W1/D^:Cm=Yu7߽u~׽ߺ^~{aK^ {aKp{VxZc BUPPPQC%M]m]L*zjjxAgwbUA$=\ʰۡws@cAHb \]5gvTDRB*3Oҳj SzxSQŘ"FB<A&,1E)>{aϞdNخkJi].;NWxҘL4ۯlUGEI0U3c- TYƪ"'~b#ԤD{ `a^/WO=ZF1,$*AY lk[ O3zSq:Ԛ|558"aq= يAHRӺzP7Î렉+;ui0Y6|%Jdhh+%lU=PS|1WVb@Y^$&*o(o^Qv*X aN$tOUU>FJL+ViZ{HpH c4>1){z(TUE 4U QE_ KNI `HyU5ʿh :<33cVQPřfB5(ziӁ%,q.ҟ!Ė*I i` ͭpWbUUcq8VLQO]]%3h'Pʪ*7[H%|OF+1bzy2|6cce("d, 3Qb@r}R/gd姧l^Y4Uc[- uRZjt51!K4nT4< h**iעIx C/ Mt2ZZXTK1Qu"(#[16.pCRlUI4iMQN+RPfR=VPKh6'Ĕ& @&-Z%Y4D-w/8Awۼqmf rx-Aiqxg齩n}}D5gj~#ׁ:uRJu WXhG!u i/o?`޳{uN/v wBmI\hZjN:C$ގ76Sd` tq]\^϶|3#4yJ mZ;RSMIP" #fuV AnWko6'J+iuem,* ~{Iz{^{{u׺{^{{u׺{^{{;Iojz߻)]tK@6_Uۯ_&ΞNrI&lP徧>QJBLv6S Z.}ϥ1֦Կ:햚,@tXʼnd'zdzF<> WufUauo8E0--)Ƿ)hG R\'p8@RVd5!LDsadm'Wd"_צPk(Pkvm)jMT>:4h\Q3-G=SMd20孈a2M%M0mQseOl.ݣ"UTdc))d\IQ G~Q෶7!o@2t݋wdX\>f ؞%RWդ >BDщu$arznR_%0fsuVڽ}S@αŤU,.$u-m x*NHEf AR"ԟhjsU^چ$kƁ9i\&3/]YF>NAV Vb^esm%cjTE>T6e.}Ƿ2<憪+"ON)m*ssټyrJG,2Hy!^4]_< *u0#ƳTJ3ljM8SÞ=eUy|ltsG%%x 5%'q 4檜[kUy14TU-. ÀVnɚwN]7Gd$Oy<.iUM<-O!*RT` HU1R¿aг׻+zֹ[mg&lcèMݠ{.wZ)f$bؚjeh;өy7.pPP̮%>,ntw%BٙYט~#!˅`s!l;0h lZh=VXjGR 3z1=gjumZcq=ŲJzݻ)GuU8 D9L>t& PA'Etfo:4Q`a+gKT9'Uh٪fJGQ@ cPujOol]W.q[?p(rT`wvLNSQQ`uZ)݋ ʓ~lgfmfz)Ҕy*fikoI ;M-,A,%7,<,#V]+@@=tɷe44'ҫÊ֦ q zqmocv&Wf尻΍wgc34W/P> _)zn#c^$v|ٌ̬६AOAG[੆R)1P)9$,4ܤKHNAيP]si-~P g&؛vckV L 5:7٦,kW'DKI-4USL {Lm-fڤ}OC2TWRBVW'Reu~:-%\U(e]: I遼niTVJ'/O_)w8͹v.(n;٩o%QA|<VF2CLX9tazSqm< e\o*K?STgvNT,EJ^%ATE7m}ÓGVB\a4Mub!V5=d/˭X44IA"AO+v?w 55 6Se#1Sε:Hy)oۏS0tu8lKQGX[%@2YG[N6ږDWVe uiw-ԏ0U~x}w{߽u~׽ߺ^~{߽u~׽ߺ^~{ ?O_[ʗr?]b?gMK6OzyX񏭿o VE=$o$_I.x)&`=kԊ4F._Y;IahMWхI qٜ+Ƌ%~=( W4:SV~?Ê^ NT7{?.,GnzWHU䱸6\ ҈7̀'=#U2j[9kOl:ҽD1-Kr[MXryΦ:,O'OןvuaC;rY3 ?}=%zNx7mS"h?$@ ֹԽ7߱7ȷ#c'HTt8 UX$b&6&mW/iSgXTX^x>ަPA?{^zU9Ԟ]6ŭ}F<:||>sN=?RJzȓ%GG+ĶG6 {SFkm1`x?Ɲͷ+_V߸L% #ZȦ P==[R?R-/25F `fa V?|^Rd2TFHiEH U MrT ᢦN< H 8)EqqgvۛgƝ M:;KA3BZ-E]~Ch>V /4|4nߖ}}5_}vrUi*2%RdYdm-BĴȦ#RnB(9V=сx Br}NꚚYQCBC K"+n}65.*GX©$X{J#F-S#} dcc\z(Xͭ\NY9fE*A+2GUBjDCuv5RBO?[am[R^ §In ZkuýP|vb8tKv ur5~z᧎вjFcqa`M;{d/(?i ri#&uUgq=K|}ebc)?OԠYd+"<|mϵ & Q%"4T~@mMrqJ$9^}Qⷳ7(C-rRQM#0v%{ho,ȴF"5 +IK"NYS}(045 |Rzgl7n,EeKtQ}R1"K5W[-F< }u{oZ Z/A}L᩿z"mC}a|t~mA%qy`/.GOzntyHx$ݨPWWiLVpQé0Ԣ܁'w#N YӨsI%{eG(>]9DL8o>XNHPHo>݄א0`(ۏk·+f^x7B{qf=' A'P夿{C?uWwM`P9Öo?tzymc+XB}HP>_n/_(Ώ#+ev /?_ugY}ߺ^~{߽u~׽ߺ^~{߽ugL\㿀5]5><%cm--[Q_>bF5%{gTPZTTW?3^wg6dfg(P8 QC6: OWOm˼rB2y LE!|bPW[ϖ_:engMx,N0Ƿ< YC5.g'Q-mL!1OfTP㡪 F%:yqP ,4f,,ޡ@Y֞6[4oP| 1]ERO@$1,sKX 2l%wubvPc D9&g3Sy'mɝfTn>*BC0T$Z1S 8U#ב16\_n*ݦj_qQ5,H eEru(8uNff7^xrT~Fۇ7ZtuĴƎcvEYaՓOjIB!Kq-* 85#+EYE"V{iSJT,X K@ӭFU!FhHT H9>,vڐ]ߛ'vۋq몫wTy "f)IFREPUmdIGrO S=cUcSQ=PUat S7 CRTj$q8t(@Q|$P>uٟ%vݩ:WAg|סyWwfkw.Zyzat[, 5MSS1T%&_O?((&\TTu4͑jz*T$U}&ڴ2i|(2z$ӯA/W$tڧN4K1P&$EM:Yn]隫vlhϻݕPnɍYLJ|PcfdJzH?QEC@ʼ2uJ2_5LijrPDXm%L2Oڬ&ZTJJ|S 04AVҪ 5f!{B5 $IUEWQfqXx{>/ݙ]wvgf岔qeͷ[؛jq،uQVCH'΅lTQj&dܔۂ pyz,3c ۛQc`5Xگ,2e >*$b-@i zf+4QKpɫH`isvKO2*8jv2?gW$\ DZ#4:ˢ&8̝$*qRA&V6>/C$T,=6/%KSMJ2)DUkM 9$ K*b)*p\}tm#(BֆDMi4KfNS@o #'E =L6Y%ued'l٤z"*5qwCֽeXۓkOF9(Em _+.bA<*<G?@joWj_mz:G->s'2)[hOۊf(?^KfsVʖ,,-p؏pƟcw ^aq Q'!k%s,bH%7Xmo믟 {ַA:o{^{{u.U-تskrbG *i׽/;s,vmD$rQ]d5B*#*E.AaRX#!q](+k; "9Hxk:dcE, "ӴSTG~5M% ~%X]\垒8|m-LbQ7.,?`.л<[7ux_1yQ>b iVh֯[:kܲ-,K)Qш%_֕Com͖J3kN捙WH{tg~Xm̾w;nA0jģuc"CWK/ [ҬM61_>:n )il]]QYS]>~SGE&":Frm埼G$\15 o4y2,ZG-&Fol7P,rNX…tZQ]_ Tuz͸]ѱisy]u"\Wn p <!IkI QT%IfY/ŊڑGE_;~ѭ 'P<*K)#),d5 mwUo=Uxz|K%RFܙh--%0K,b)!pD˾>.9Q?kQK3l#e#W%fGW$#rκMtmDs;q" mE$ԜagܢZ ]T j p3tm,KfaQ6=Y.f o u|Y2 S FڛmumQm ty]2%[ êFVzXQ$k dl0ݪi6hШu=BQ+Q7}jMمICY %QVxPzUzމܗlu_ɒͱS#/W1G&n $ȜO5\L5iIɤh$ŶxAS ,-[fh)ڢ|d1b@2Y&1ԫI9 V4e ҋ¤)<'6h t҅st֥M@ )2USj y&"%5,>DdK*K>'W'q/{ jk'4/51PG9mn\&O4qg(1ٰY̋>ZQ"k)xBS"f_o䂀WR5ƣA@E#[oI#8i$`z?~wO7f[Cw0; cWiW۰B(f U2:!;ٝn+m!QnQi0ymS\%^2.?o;ՙ|JOdՅ+V\Wևcch`Тz.JG}Rioʍ٘멳x޿{y^]aG+H2x 鶲J4^z锁$Jʁ9 ܻCw`WnTp``d V.Vb +(i̻v<7ɥpBcUڹydYFd躌/Q] ȵ$1۬][[p잇݋MəY>nʍ4ج}|^S D:U<7Ś)t;W)vX${cmN>: ۂ%*h <,%oYNCxiMewGAz`$iET=:$+ʶ1Q5Rl_Ux\L;gݹy*\tyYkVj2䊲:!_rҀ%԰fV<~Xrwy)܋eᩣ3\2ɅiRi08 8pq"߻Ս};"̉M$qx2k U5+ԧP #*qG16V>A( oIdhXB$GF-c7۠yQP ">8~` +h K 0VoI@B@O 6wY:6r|vJOKPYll.ZKn[^C<\UʰVt'Cu A<9?{{u׺{^{{u׺4|k _.}k>QrϢ]?m(޿]q| .\[89>iu>D v?`CO^Pi>3ic<o|.7Jfm{d`I[p9ޑXRx(: !ҬCޖ5Ӹj u.[%7&޴]#j:{ZcQYI!O<2z⇨P?<s풳LA vUu {{J&Odnm>l{?OxO6XeZ0? F??_z|q#?ُtJ"Ǐ"GS7?_eI}I\(i{~!sߺ?^"c[ܲO}A-yڇ_g8z]cAj ]QeSLwe`ҧ'TG`!.<& m.Sn]D\2L1O CwWޯ/FϽ/۠h#bU.@T7޻4DDڬcj%U]02nĮUl-,8f}lY$O^TYJ!e+bZ#*W4Z(UK>k&)\kQqC?2EHΑ1n=Mk骰̎ĭ)h*Zϔd!5bEL4?qWME5T3SYc+PME!I "GI$zvIiKIPoY=ECU\t0\( ,>^ip}yQ&~Z@NR l$*Z]NBLP]e#ԂZXDbuIcP+ Dv0k3ꂇI&ЁXEtN8S9aP)(MNGq@jLxͽ]ޕ! XjpThr'$uIS\RːVQҲU^U|dMY%fs41'SvjЌTe&UI:Ewj]PJ)SR8iUf O AN^ޑC- ֜EG y_𯩧5o#1ԏcy7R GĕplL ԳҥEfj\d΢fi3U*cbJ#YYTMzQtو1#6YA!b÷圞^l;jFBqôsԛpfᱱmIZ\2\,3hvk@ŐU z(BdD1@Lj)5 QFZTԠ)R H*A*(<>bc`"Uo 1mɚ9jM<.FUkM3q#5O]#HĸB]e|lxyiޚZ B !0oH"&'ڈAYNQEjP :5@Q,>dO.7Y v'Y,pb l~R)[YQ3tp%r!^利gL5JzY/NZo5UȅK9EX2jմSSS#̵A0wV9 K BM(x5'ӣ/!J әV⫲y\ZfڰA(2.Sw<btZNB##IFʥz|r 9:mنy꿁êeD54:"T (`0@lE@vd թѵlTTbh]<@kՎ:YiT0ԹyLolnq凱5 G-B~9u)NAW=BUtIǔ(acXTWN"mZX&hݣh#2Wç ҧ !PH+Zh9kRq84S^?NS;n:>NJ,7_dgxX5U]%43I%V"e0ZHPc#˔NʛX0({8ZɎkTqv_Y}ӹ]ٸ]OQ둆hk•4ԩH}VJUJ$Fp$_,&7x6{;1 lˋ)8P$G\sC4Siq {PM:[uT U%WdHRAM#V=#Aಽ8 flݧj[7Cuuk:U]ÓG%fbHTHeU-7wV[T+[31l;s׫OQ_S6Ԃl}=t۞b=1I"HִzVd22 ՛z[4ϜEZ8'NS1WJ nN,R=>Ai1'i%$'"j@f6#Jo48t׽u׺{^{{u׺{^{{[7?ɳ#KE󹙭q⿹k A3ޮTUnM{{n%)^=82,?b#(:7[6ii.JM. /xͽ*cI$@jM4]czx_YÈY ~I{k&OT0h[׏{su_CTyu)CoZ4&akn,NJ$fXw>qYAM ط"׶@'osr Pm7'z CzD=c{\VUn/?_֝6F:?\{عi[PGUJu^(T֝u>'û#"IZOjZSp  !ċ< K`~HzT tCk<?{o拋^_U_j]+}^Va(b;}/9l[m1Pg,pUͩ_6ýK ,;OŤӇ[Q}̪gmgۢ2XBG$PYC7H7 Mٴ0;fzCrMUZYbmLWԊohc{'N<m܅Z*6Wϭ[>pWmWnsǰn;-6D #d>_el^N8CvCݗ6ث*l,\MlUm$uy xH,WFFXWPy,T[\{ZK, J~/ӤO&_M,m"+cY]GBA`H$}:Ck14Ia,4\A{{om&@3Zy⴯Zg6\|UWAZSIiC$ic$<[dv! m]"RH^Nj_qh\@䚟=qO?gBM9]SC׼3VQISGS^cF[/dZʷbAska>Sn;!>ASµTlQv̭U?X  .C䋐5szԿY%$ZhԜ|8sw!)>tt &W̊q(uYXѥ<$1Ryn~oZgؽF@6_&j~h֟oP1?CMϥMJU$ђ˪u|HhFڣEP$TW$HĞH?_wR)yp+!}Uh[ϩ9**^pDY"*UCK"h$C1ل[#YF}+C11m/8SE=2uq T ;9+TSI:c< >> ﻇ}괉Q㣤_L'pZŸ35WN6U}mZ#sLmG*+_vq@PiRT$6%]E4w G{Җ{\ .O 6+ǥ kWڙS_CkKhq2}9?+t5t98W7I".lf?\`d: T\[SG!nA ?P){OmSHJ͹U禙# GSq֫֌"hjzsGF[{}-o#TNWG_fywWokCiO({l8wu|ċI7x9[x,1Q9f?"{/sK:׺{^{{u׺{^[϶~BꮒZ4c}|`)/4垧MA 萮G|]^̉'S汖[2xu>}6>GbH޺ZqI-lʰ2xa1XҴ„tAO>'#*{rO[SLf\`Tо:8OLT3,_}>1lwU(iFXLEQ)fBQK 40A'zqmE Qg9VBuՠCZgߊ[1X&B AL$SNTO2ҼT=_VƗ,MDw.Aq4,ȗYY2ь H7Hj6SUj2OvSM|E伷-`*5H{л.Qm޴;/*09P ̞J9Vzz:'x%ɉ Q3UrbFekUJZJcVweLu U4'F% YGu ,W&"B(%hQGҙh:E|:74wfEM^ nMt=j:S*+R|u,U3b5@18Yd%lDLNd#Tu~#EHN:~F'kȎ Iǻ;(vSvj^Q=4s){#NV%ň PU[8F"XjspYiL\i&Zv?QF"JY =C; ).HB 'QHSRVvwGTm(Pր0AFfg=˖8 1,go7ar:[wP᱙j*\\#98hd![ *ʑ3JE[_1 qhJN9I}buؽG(F4**~-QGPJYfS߷uS,"gE>%yR,UoioR$r5&i0*xxodwoӗm#^xgu 0xEFM}&Kso -.:j2s\2FRsԘ#Vhf,IEfDLLS@'z"*,^*Dj-(&[W ؞덱VkA ~ ֹ#R̷eFC p)5JMBi/sgVnM:z~XPWG]qo\ѣP YGYE T)L }QJSUS@lܲ;TTx)U>*][vk =N4u5%֤S UIҍIJwyP]ool=6/3GL 5:A/+Is+ C5$Ʋm"b+\i˹1L% :yqfH* V"V xz *: 8w D4*h(_BJ))c 8U%SâkI b2Ue+q\*T+V JS:Yp"4q,uĩVq^ ǫD؝l En_.5]N#9A՚ h4ti$Ƃ5L bk++gMML b"b mR4s27Vr2^m&&[l@%agI%i@j3}us=.tV*&`%S(qIPGɭnG76Ir&@PG-[MI)5 a,ݭʯ=sUn:2>/- Fogb`phX"<ܫicD.m$<04\H\F7JKXYMi^#ܤp9=Zm٘(C-BS ]6/3c+Ѹe! ixfB!{u Kx}u~׽m}_پk8G}i0ZtO/M5UO?G@6 'USaX>fu(n,zocڤW"ϷcSluN a-cztaqq= $!=V#+&XK8u=8E N-1%u_ibO/= é3ܭ͸}eMmlee/`5pyتVzKu#xQB k-t wa=-'=6[q%;E[YV_5\pΛ=3A$?SoR1$}oM>PhM{ֳA9o{^{{o+"#TX{[A׽7{ }׾i-3J=N{obӎSUxERB&onHgR)O(A=½[5 NBiMWxmQm&ʗWz,er{؛~w[SKrT:ꅯRts(*sk]̲W%b#\8I*OYuP>Rґ#H(!KmUt_3{c ۘM,+Ms1՘Nݓo˞ئR]]T^\jC5e3kvv5Ud2xzqO-8j 0.VQHi LޡY.bKmYeP5Eé`jbu2TzyV=.{euKw7]v;)75^ovQddTNɲgg閾9DGO$oat`u6c o=_|7#Jjc@]^P}9v!ԢyiXԫa,$UjzbU #CƕR6xȎ#)҇mF޻jJ w4\]-ugor s+7l;zI(Fv 4T,s'Z0ߧNr 45EO)^wi{ɥ(TYUWkGOtoZ=u{Djv~訖 XcTeY*`o@j!sCVe>U[xQ;"/"꥞CQ1'6]B"E i ^g5{FexRіf8QYu5+,qn7N~xumSrGfow=lV:=%TQ}Du?S㹋wTVܦZҪ*HPp5m{bUj*M*x%});yWeu4e޸ڻGglM󊮒KP0U"O,4+`>Fݩ]ՙ“W[dx`ofS#>h%ʬQˊr3y=+t"7)wolY|EADr*ʵ:5eeEz%ȌF;MA=ϊE=b:w:k&ؼnΊm=)d?b4ՔPYƭ Z]}\x]xn*+&qT.Y > (P?i(jʼn\¾}PM;FeRHiB#yy7AYnޝ-Λ EEpC;|f**m߭3 {Uc!5WӨ^Qg+&NēPLǺ@&b0T홒8 6F^X) ®HrC!MM_1t T'諷fǜuz]ɷ֦D1Sj:Uʵ" msl"'pCݕ(]=q?OtH qǥ+^TNQdc5</)x@HTte M] e5E,̏L2*4gDOOmq+du+) 9葕 7k{u׺{^{{uhM]fk:_H'.yKj?nӢ]??G#j't҆GO5 ʯRQdG?܉ɞ, T JǬ"eQ/nLm5LP i:_P,ծ:q~=mD-ޯ PMWI5ʄì mG/?ט26׽$AN?_oovZNFOX6[}1\mLJjS?Jr6ܳߟ7?ۂFY)-MWQ~.#wk^ޜsb.!P= ,H] {'3|/= ı-yӠoTF4::p?_e_t I?}(\槉rO.}O{($S?w#tmߨvS>dt%&FJ(sU饤|UTj1nص®p4ʽ6R(G(n#1ISy} x(0Sԭ8tm%t˒ E :IKD%$C4j$}}Q0s)1Դy8+IjZqUO3Qe1J(#x#.eUW`j)*0A]dXq5=d4YB֤ZbyBxW6SuWevChQUVUsm{v[ PCVJMLtPA`ڨ$C*QtSTĴd*uxa!9ĂjGTZ!fAJ/O#d N+]K2>5uHHbjbBK"fk҂Bb3V2ii<+Ģq92 U\1>!b77kKBx3qJS-4"pDG*z(޷hkTM Z*b zR,t$uE2]L MhkAPGmGJwdL8#SRH+\Љk*(gmv}.+7 j=̂Z )gjUVɋ!hwY+doz,[2x#`% r% P*@kO_cridwEUl4 WC=HxVOT#0(rZbP[ +QFUsS&2Xp) J8DiP<2uz$[[ixmcvH’{$:(Np7p$ xӡ[6{3|&V}`55%E )R:J|:-XMV5V 5 ][/Rwn4=2Tm2% RG>T-oWOpvF+F`恲${Y<WBF$Zi^"No;>l :SV>%${:Lixi-`=hWWg#m~&-u>诧IGP4S)bgYepց\fo2\{ #;WJض&񢭧]H)zk1F)I!A5OX1e6䪶$2ɋbE UtF1hĻb,wNIMjSe:Tu~Q7f1MCU Uk ~*S{=;{n͵Sq駦v'Ӵ|%~2J:I=ED穗's0CQTRi'=UVAbB(V: 7$^"Q(H442<'Ez(H&-AAip;[Ŷ;'kSI2x?Ū1WK~759UM[xҰ1YZj%DsjI#(]5G"di&FV8ZBRZPB%+PVGbTq\x$08~ފnb[S8pd" ˌŒzAS,c뫽P#,yJ V_3Ӵ4^* e5M; I%<'-❇euD" õf+P5|9WMh8/Μk.[00%ntG:hϗL5' I$54ۚ%DNZ( Su>6B?IG)CK 5G,g2$E,!X=-a;,ZbFTV!T!%~UzןCd_/HιCmVocWeVVKG#IYuy},{mL2D4Į ࢀpujn͠9]$Ɏm79zW0Q|Fc)O\F ]nIn9p>7NF1E ca?G*H<uP^FT'4l:$7O~"#j)S7_ϺHnE.}d"qAX#pA7c_>\uӵ~exVZ[[B=5T~77'Oz}_߃m>V}|+vs~y7ժi7gLq$*?)*HZГ9>CCsGwn](#WxI+̌RB4#]ӗm{@H\3PS/[{Xuwrnk}ņmǗe 4=e dݒ3q;' *YCN·qy5 X$\kuFdu1Lㆆf$SʄRq֩9b*! ~CO5 vW|2TOyhZhNB|wE HdDۮ,O`R8&.* 4RP#ܕ]@X\Um;>~Ӭx.ǥ竒xkhFF%^eTgI/| _5_o0_*W cX;F̊l#gp~OTҼ%VY&ck>nG}P kcރ8=\s5 ):\Gc+風9iKH mGGߐ:14*cr|o M(\E0+Ɵ/*~}>'~z K"c溲u$mة[oǵN'ueql\dar#9]uuflfAGϩKDmZ >ސ7xV)c:$m7H|ݱزX֝IJ?CFoRЋ}!-#T^ן!-Gnn#g>DthZxiǬG)̢eb}_aԘdtJ kyiä~{^ߞ9R]p\b ՉF_UUG'USp}7\_zJGd>X]ڿ՜~΅CW?Sa5IqyhmK[O.lVD%S?):krC"@R@?Եx(I$.8GxḴǟϯ2(~mnon>Vw*E86bOߦR%?7C?/6?n$PB#ۖ+oR$j_YdopJ:}Oq׿Gd~{߽u~׽ߺ^Lne2մ^/K5fC'ii(())ie(R>XH4'8ny{˷XK@DDvbH*䚌g*,U嘟q-z}7 62pNŕuT9 I(3*X%Ks̜0ʢ5BP8*O/>?zۮlOj%hxo9niPVВKɖd+P52uUb7; 2jOS_I7"(fUPH#pj][GTEIEBd_*eZjZR( i[7ʨHԴ!P"H{} uO椏+A" c(' }]kw}'`9j\ eX%+'2sۉ>BxqԸ5;O"$}[XK ]A,ի9AB8Wp1REaRёj( @M0 ŤuQwGykpVQ \V塠J[7WO4&h˅Nw;e)v`qdM0L=<hjF 2nvbOq(Ex&,EtRbE-PYB-kVڛ#konn;28 xzj<\=Nŝb8Hj!GUL.#ϋzxejj CQ TBE壉CR_tdͻz۰r @9)ӉOgxWOA$Աe,!A /y_5ocbazUg7`}3!*61ILKUC Ք)7AMFJvL+2ꦄD-C]mi+v^ѡR-"xL9KR(vkeiK$m.ZJeKwfXL_ '.Ch;G2yid$Smh0*܊_&JHiP⦡y*̒G9*㨡5b%04BOVd,2FgwU`AVRAB03F튅F*tW-\sK cv)wnJ]E[+8э\eF0>.ZH+2*Zr~ZzX|6>Zi::*ɘii$3ZwA} ,I)a6}ib1Qf e$vmZEg!& [Z_Eia#7#SKk,ΪBZ0f>B }Æ|v{hMo }3,PԔjE0.J "0\qLQ5H4x(hPXb IR(l8h E=|E߸M)!U#hn-l(dW`Ibk+Q)QCHU!:7VKar:hN:fLnv>W'{bZݣX8FR:L6⦊*ZTP3 W:,IJj9~'aTv.oD{9[R+ck &i"gdHIVEBi,>i+SO1҉^7E*OJ4%AG3\Rnf[Yp7,= j!*A#)m\nGSOMvm<-~'7қ[. ꫭJܴ^JNnW0Bu$2A`dxHVi0* RnA>g;d255A;3% Δ89ԫ32'P-Ds<ĞI5yjbWSWfq&MacC$,KYhM=ةȫ()M:yX-}zbSiu`kVkEFCCX*ͽG՛Yv=oyy%V bI壆iiITi)&g3 X^}w/nBD2:0è0M8t{{m"sn ۝w۸zh)⨣bh*a&P#65stGpw\}]c 7> ÔӍRvMX jݻsXa 4ҍESc|`d]tpXRD^)!Mu°$uGN|a{u԰ɷd*GYqԕ;U,+ep < lVrek؉z_gFsOG??7/{O3K?cmVm: EӯMG ?dG:0墦@cϾD[*TeA쵫G݁oiZ Zνm3_zSɰG^FʣKF{;U}'YoXtXFOX&lEN-?j*$mA[J@er˜ŵq(f2jc&*TLQu-{??Z'O41i%7ἵ&wF*:opx7Iiw-FT?WΜzj]UX?vU)'UHrJ{}^nud&|=8?h7&1'[4|^wuܜ_SJ?XEhuI_Z{ַA:g{^{{8>8է}m7T;w}L5 'Mm%FNY"11Tu~i/Zq:(xugGٓ·EEQk5jVm*|=Zb ɷo@2uFj|lK6BhEC.ZB';֚6FQ7&`K.QWQTct6qLë*Bv{>{$fi}H.g8zHCuBῆ3'LҌ8uto<[g[뼌RQ-5E.ئX=ŏn O!H .^s|^3>EfN;Z-ѐ]v|}NFDj0Hei$B'A)&uTc4pU{7R5SI4O tL;VNպvnt,{/{6ٱ=%&ߧ(2)Y -Hx3-Qvd8 }N3|~Oq)wHS^amadot(lU kP'%&\RxN;jƆA!NGPG*z{۲c6mvGwmGq۪1}0bb:U@$W8 zmͱĮ)ʥlqkg75L ; 2GcflPim(j e NF )]<:vHʹYIR  Ҕ}i_Nmb.ʞ8z̹\^c}B#=Q!5FH*igLjENS\pQc:oܸ>CiUuHj9$geyC\[U)E4*JK()"jN4C] PiR 4+y*žSJZ߭݁6-ټ;T_jbIA:1mcںs= %E}gj)hkY ((hU.E6}h̰$T WPKTjQkibٯ 1+(V2̠N>}[Fݿ{>ll=AUWm>:/ƖlJU9'$i N|7>RhWvEzT98ҬTci,XzRdM&F3X̤A$@ 3*RFC(Ri@j4QN=(nPvWvg:j]'hi;.陪Ɍ3W9GG-%QVi`e@gLk0M߹_+= sdr.O۬Y\3B Q /YqD/ZG5ZN0][طey9%d 5]U_qt/l{=ě]nwz]gsWVnJl٘zvjvZ 2F`YC@Izn[oAGl6ۗ]ҏhwnVibZ K4OV1̎auG8gx T2+r4a1ٌHcJ+FRBu4XFlxnν ^Ϳirpeź(=6S4&Q>)mITo_[k5KTrܤ8jL#;wvKEEOlx:hg2@BG@%H]+rQH,E*@\q!C xӎ-C*՛-OG&C=C6=1UqYⒷIQRURp~ܓ ֛rnmK؛OEYASQ,8UH["}p'T1ȥ[WMjp*NiTF2J"±|HT =8n9w5$-wԪVjs{$)Oʸ)vj>4idj%8PhNgʝ[͋[#\h|&GjeKZ$C0Bm`QN5ԸPT/g,$Q  ׇ@TxS sm7&Cˮ928eA[@XIWҤ:{|י3lWav[fb^sE69h mH8jkT+I $T%r/_6 i OUyTU||[#$RͥMt8l h>}T"ٟ09]ԛS;BvWcg^xjmrUS3V:z*\TdOw|pkX>ٵCmn|=n:q7,5tr$SWL^3$uT,kr#Z9u`2!FHSQl60̒ Z2T j%J0tퟍ Ǻdz.&Ocn/7қ f3I(ifiwlu  uX͋7 ~']N!Iٚb`,6:V˰h$j >&Ŵ#cTHMd"]'uj%{v-XC7uif;7iV~,F6Y +ouQS6C%JUFfYĠsxiOz7F?nnxZXzc{pW`1=N Sʏu Hm\l,6:)qcv@L1fVWP+MHu)FH|UwfȆ %__fQ`cUE-rIH>(KΡݓ*EwFw7T٣E2EMG`ѓ4AsR 0AHP(ZNTwVVSE]_5pZujp[~#:H#il'~){⫎,훺YW),U:7CI," ɒX*so_₶ƴE+-xj,BQĨdg,rI>"HX.A HR 3WM #5l6)V*N[ʹNd]Efln mװmי 'ޑӵ%MUyj%E}2ZYf*;a7*eY['IJvv2u#&Q!*eG{Kr7$n/V3mp:_jZu 2Z]YF&J1$a]HhvAتYf6v^8}wQ3CRkJ9>UO^hG J\%V;+wWMOumm %KM%AI E$qʫ+iC6A0I\6 k@~"O˨ke~n-Lc?}̻/oMxѫ:| pd+)t6Zj*dؘ̓E^vpR=+MvJz dV UYLT,c nd]GMEh{*&} IF+jӚ׏Hv.8 EH#4ZzփrϝUB 6.=݂kq8ɨq4==L& 䩛BQSG}ܹ}iUSTbsS%$ʆvDFFh 0>Mj^g6{ưOi vWD$T)@vnK\l5(izN,lUpKD0T}<#X| G)F)`y׏`ޔ^׽ߺ^~{߽u{Gi 39OCq{v͏p9Kjn_nϢm?g3#x~vƯo8sfs>sY} <ysԁGmĉ/{9ݸuV}UHV:庣ӧ9ߒy W7ۻ򅁽ͬ-u{J|z-gGϧOp2-ןxVQJڃ={ءԱ%d{O%§wJ[˨ȶԋ}/>5ԒN lO"mdjo_WQPY,?`z9Dk`u ~Gșc Z6CV^ \@_'[W>W} ޿Ouz|R>m|pO<Gi.ld?Nw[>qE6Eԁ7&jRuݐ.o?A魋=[*2Wҭe;5_ܐ5ሆ6.} rV[x y)S> [߷u)oȒ~Ul-CG߁h|3XqF edKg#T[YQA {alט*mm\D;^Rh[ZYLU4(Վq}MuMJ^Vj3sVf5}FY4hЍ B(1j3=]ۑnZ ;-cn 4e*mղzLl3|pzڮ% TVPUύdVPVQGQ4g\>2JYj icC*{ȤX(^5 `5 jB2 =+R| 0_m*>-XbjuI voxG9LHp4%^ 7M]d*|ղ H dJ8*3Uac2"&} A>gMR0bb1pXу|MOETͭA'(VZz8jzVRjBW3JeTCM^e*jYs U:WA[" ٤{ZDA|kح$<~(!e@]5B/k$Y-WOA xCB4+YGSIX[{56$,T,x԰Q9jJS-W4K[I=]4oWIQZʚt0zZHHM#DI@̤MWP"N dAϘZ1A<:v#Ji8AK%3TǐxTTS$Қ1VɕHuL!]Z IM %)#+$FԳO W4D#ۉ:ځ9QRϩrX0Q.[hfH@ӷuyyƙ)iQi![9az\z$ c(TfO;!x䨧J̃"+SK7a#E VE77/*`@J\g*\SSAi(;Q85>=;+J!g'3ЙkT n ˹^3Nb/ؓ0rskj{VN斷)I5jCR|\+V%6"XZ#+*tWT6ԑ\ \ @5ƪ&:`عHzIip"'2vg Jqihuȥζ#5MUE9V_3@I H©˄XY\-!{I L$(.hh)5F@vWWs@H>?jygU Եz$1ΆꝚeq2R  ='[PAMWKOWKeQ4UF2r3\f֫QZ)^^{+!jp2 rF )=U?:~b7{9[WFسEUE4c;O8NZH{7A=/OQ-5[#0Gv2*"3j%uY ӰvR- QJQEe!X*ր12bśp(B(iO+_VM|@٨S+pU7 \12dr58LNEiꧦhkLJ@i\y]b((mJ|sPHVD4b% -]Eu:u7;kP>y;"c1P~uOӷ^jgdޖ >괊wXNJ Sp'`0ՠ[w>?>ObSva{Ev3+O3KUX8Bi;X#w-wf t;kTڐAc1MWvi)%CU2ExbҤ (e 0~ lVk9<Q j(F# nQvEgB*ͩijeu΋ >*<5M\]YM5&4з8=})>2!KT́@qjVX'\9)|qjyaNat[" ZP%,U.~#ZMێ#8hG^.rWP7JØǏj+1Ai֓=z!ҏ}4[)SQs;Q9@frKۋNVnf6G*(4 hWtAҠ`^̇Ňř̛y#PRv'EYJf^g'K4R$g M~TNآC/XbZ&3֬=i25SI˜J\,?S*Ib+i"\9SpFB g=35 N ʣ_Cٟ+w$Z]ET~qAQXbR}L9 L;ջ gvac{noX ,14bc>%f@d)ܷ _LYh>U pj(l K+i)B@:xib>$kORܻqcwsunjbZn%SThG{S:<fe;J'#a31d9Fzj+ %=9ȽY4@.rDCH#~ZS]mG$Nui AA=uXBhU`)T,IrXC|_b4l^*ZZ<ͻg#drXQY +Jx!y]~.>Tny䓱+w.O_%l 'HHR@<A?x͞L嘥۵aeBj1z¶Yr܋ZF RAP*~΀_!v;u}l}W̖9o#f4R]E]J*JCThk3ᆱf<S`Mݢѳ9cp4UJtYXѹIZ얝{-ԙ$+UcҌ<9~HhͶ]|FHBCBVfбg5z+k)2۟;sZ`d6T4"&@LQg.Y*{mK=lvlpS(RI#MvUQ28Ks_2I̗+k˴q"Q-_N6޸<*'/NƢTzIʬ@x&zz~BZJI⨥++x/-HGe<#zm-'kkh䌕e`U"#v鞽׺{^{{u}O潁f;Z'{⿺9MK6&OEQ(k۝"hޱ&GEXaoß9 MԊL' &^30@=@aʞ8??C?Oi P^\xlө2F~Ijg@k^Ć?^?{{JLbzc%^V1I?n+UsN,OS#6Qs{OHLgH=^3}\~y#ڻʑ[skc#Bz}*IϵTJ@4zGJ3MKqQ-oB.GPi{hkrJ7~}Nk^ mNb-p~_^/ojdR9QqΥM1b?O$qL2lXM(`n.ECoܟKߍEmy:tOM1iy5-̖l>toX "e15rʱ=}V<FƏayp]Yh!r("0s nYY[,],4=oljC *щЂ \ [Em>WqruB\Mx.DSOuYu\O<^1'-$ԑ'6W6)ڮ(vZj;Hi຿~JjܔZh(IQAF`tafۿ-nmmb j TPy*<νvNx#ϙ.DoI ]HiZi3/}}6b.[tgLjO >^}7m.,$C:Oyͫs!=ޮTKўoP1U58j!E},2CQ[z*;u$aPR*>\1O/ 7M^}ٽxb+`5QOMH)&(̜[ʦXo6=,2HU[!6}{J u]qNkEXjҪTrıGeQ$}~ӴU2 Υ[XG=sw 0k$՞j: GN,J"TN31̦f?=>)Y$ 20ok\{$?=)]v{oP"Z}<$G ˪ޫI_(婮cd!MhQYC'E|=r`G~y^Ϥ3u",%U#D֑Fu s~np!`۲{nkTʿ:jQ-?j$h}KD[d]ɓ<:2]⏑YgP:({IBhϕ.8:Ik {Y7'Mncr.SR {KRO*Bog7x\|t'2h=7Gܞ8?Ϲs["+0v?6f N֒zǂmEV)|`)d__`T5GB :YJ*ַ &%WI"Ff$hdH\ӏF! G7.Z?{7FԚa}_O?~vS9gߟļJXZ=#{KoyY}ot_Q?j?"{?sK:׺{^{{[]o]W5⬂ 6ꚉґĥycn:'e+xTQRN?/z+޷͛-m-U@rIU㨵X:F*jk&%$1 @WO~,ڝ񈛰~ESIs:ELslIoȣOOM.JbB%9]±E5fPf Gއ&a c^"g CuB+~kqlNmN`ry ̘2ng^ DJi&_VWC$*)ROέ s=DfDTHBtDf:DTSu{yGQ`D8EZ1KT]y-,WctLQᤪ˶)6>4zIɸ㎋1K5v3mZ\BDB*I)HJ:hㆡaZYTc[8 H.XkBd ĝT:E)\B Ӣ(̐^3G*@ x RF #(oA296>qek`gڵ2Wv}ty'!=5GIY@>ctg2jJiU5cgJj(+])%V+X[tDlтJJeB5|*~:< A- :$BhRqglި oc08c:a0Pzn&V-KZZ =FT#[oWV}φᴘLiZʌ0OK69\rCO*zK} KxR]P@[%hQ/-[.#oGi$`DWR*5*hB8?_,nĩY3u!bV%?^!{fCxf$ȫCw2j$*;)ei!$FVDViEac|CLEŹu(敝G&1N*(E)ж/hn\m;l[xK-<E &@Ǧ?yfs;Gu% *Jϼ["3śjI#4>Bjyg W$&zz*T "nV Ō 0#j.cr:,92|;&$Q4Q56>*:i Q$ c tW_<7Fb^86S6%*DP(rda/\]1'"E5"3kLBPGƪefYMndeƅQ~Z8Rs\џ.en2h@:51rZ`Bmx䦒Vmޚ\Dr+U4;'m}6Y16uV)hZ:Gө$Hݤh*  0)N)R^[+؅TV@}$$z+m0v 6ܘC,g#ܸN؝t*gIjg{碧U ,>Tӡ:Uai!G++>ΙhZiR(*ircun 9*t2` a#Hi@<зk67;m\⥂A/%̊JP0WO *Zc ψmPik_:͙F@SQ x-yzR OMZ{OiO7H"weEiSwخ,Y7;i@% x-9VY%UQ%du[6o >GSQ頣s>68WKRywTyulԥDEJt B,u3FŇ0<(90bh#[x_uJfyxj` 4&-MPI#Vi G?!;_kuVJ͌\S1ё;{%45F*h t,AʒDutr LI @Tc R7](R0ΨHjci@sxpirx11,[50HI*_]2 (9  O`*v8f uma sU2Tc;QB !Zd/? id,Ѹ NU6ơD%Un :@0EFKԂE+CFEEV6F]ag[mQTx4.grde'om7%شGO"ϫ14Y_$0K)[䦊c4oBGI TMO-RQ @ -#E2/DdEr [iHԠ-bP|4 |9_Tu0FJ|BbSTi]  Ф mRRd3-Y$tae%WikkG5WG[: ut E,uIPD*߻H QWCj2ߓw IK*IC=5'izڕA0TTHhe5nV|[7w/L6nۗ_> 2һ\+)2K[:@D$|1rTREI LDqILJ4AIM5Nfopi*u9:-ɔa4TMН4-5Y0sO B+PFv 5[vAᢛ*=ٛ@ReZ}J3;tna *e=RKJhH#FސSec\3 HhȔ!}@K[Q,̱":?ӡRVjF/*n-)+ [PbFxdz[JJl]\8p{R  ρ)K U'nԇ)ؽ7J*jkOC0I=ljJȥCs=̴MNJзzE_C9@;ހ/ON tv&Z=ڵ P,}]U&JI23bh6iQ$RA>4Ϸ:rdY]H³ꢿ42de%H<1>$p_8|?:SϮoYe|j>79"yn`V8mV?J-?`P7!q1zbpUH/l5"PEǾBRG:{26R? |=$VJ}Ϧ .'X=3oks$tч]>]'u$8?y#G{m,Ŋgd+֗ %Mh_Ur"%(.Խ.V>J<G)Qt~7蚃%S]2PTӆJX_r"xijL6D%ꎫRZ *T5 5{8dJDHA]&mHkE~-\gTqnƩ;%RǑ5s4Dvᪿ]Q%]fneF>zQFG'SG&Um-7vĚG Pv:J`֮ 1a)RT@U{4q4$uz-iiY&þSt=T3Eԥ#i#WQO*(`^c~Ϳzwd6fjw>;->>Lf۱`DX$t.%S~E̖5Uhp&=+U:x2WygݧeY$BE4j#R-j1֧ ["n.umj:=˦2zI+TYn)h* 5-L٤2_ݠc7f#aTiGvb(ƥMN,Z )U;-?,RE!O9S!,7ݘZ+ )=T1Aco%´JdCJ`VK=םGQS3=f~wMG'6Do*}Vг/~KnY䳸OÌ.#STd$׵'|5fkp*hSD hO;oTwٟ$6d[UqiwG_)#2͏jy6<ŒTz46-Ra-F6 ŜdU؛FFhfhIfYu*)ǾffIԌxDp@c6&\HVS5"ӨhA~ؽ[u6߿)w ,&1!WQC53RT!2nv{E-ڙ,gqؼJr|.-L3)y*b+ķp8fcũ'),0MMWCxݠ;1Y&{ =y;qTlqԐ5XSִǶ\AAMT`7<g0 }GG%5U|qFƾP< Q4D!Ay ]XeWqRHfj{E[n'E,V^6~ Oh:]hw7ǹj ԙ9m:xkbWfwlۊJ:9B!L e\Ov(uT`$dL8Lm[f-O15Kt.6_gm68UiV4Ue SFKۘ7̺Z3RHo[{l*L/^Ԗcdx咚"Bwh9wvOʷ?O#1ycsw'b %ZcԋY&T(RAN:j~#AU1N?A-E]/wai2tb䶞R=%*Fii I-{SvpI큸sXϑ"S% bSpA,8}nCMZ_駘$FW=d7.s+*I=)GD,Nt V~"G+fPvL~N^:0»Sv1>+;@0zuycqU]?{Ya]T=6C?QphTj2F$4`Cw%,IMO JA= {CєK!W ]$W ^`l[:zm*,U;/S[)/%fRUSu5;s:DaWXה뾇y:zV #5P{C֖$i]4y` {Kx.cRYAV*Er@pk^HBgBbxBB#yN+!zP`zev-n뽗{Gn*F>lg{d1G%O#vkjV1(fVH8^ۣ`|roPl|etöze1;om[-&v.fuz\_0(nҵ:M#: 'ʬ;t?Btt,рe-4,T14vuXm ܐGEUQ3 $3PUpĿpjv|<؜OWIlJ|lj]W]Fd2v5hAY!vMzce[vwm$ HMsMDϵmP=6Qk"!;JIS#lSN_rIߝ{%Qg3vot0;dۛeut뢚:zJzHVJx~l A MFKq--όoC]Q2B=ctt mCM 复B1ˢe%"]_S  J-Ziƙx)- P; `<oDϹ)1U-_;C2cչ쿂a7Ư]YvdfGH&j'%W٧e .7U-U.v 5=]&J#%ǹsl孓kk]LcYv3)*Dd" yk đr|1@@pk#vg_!&?;SvvuNmunrZM(ph1rjz=3pzۻrXh oSMU9E dJJѢGJR`M{r&F(\$d7@;xdm8ctM1ƑVM=#RGX.û%lo1[@ۆ"J86˻:Q xh 5jOfYj)J ctPl*#Ռ%45~GEvroiY;r555TE[`䨉2RUhS$̑f>ܟz4r3ku ZH+(-Ǡ*z9o7uV 2-t1*ud2`WӫZ?}w&hdx^{{n5~ۻ r%#+C R'=?%Xjajy!=l~{k+e,u^ʌRf+범1tLm,#41s^Wj&W,@i=m+/2;m"ĤjsFA!^>MgRP~3g6VLjjv3 Jm 뚽 BA]K4-"!t[/X:dF;IGFmh+Gσ$rw?Uߡx'Bw߫k9,46<L}=B?DH[mNx7kaL8=dxևJt2^Sk\^8ȽYV$gTԚOSc}3>}o UATL/?#{sgJ gLv~^몊D6 `q ZH e2ܖ:Q+xGs͔kG?~2W:}:O#{j9^V=@\㙐-͸U|$o5RN5_zOwdtdtIRXa=7QFCv /m?{:?uiKN[>XG->xo΂ːXݾGQ [+im?Aۿ.?XN"7?_aIs76zX#555,f)_06 K#pF\{?*ܾ+RùtyTWVw s`--mRe,~Ӓ|R(d4Af LEGԒ:mQm/, Zw=8|R #8eO;{4WA/QiGpr/rk\ZLA%??hwZ=uDp*&&}9)! KuI f ^1d8q4y*yizr7M? UKP @b[¤1aQQ]ZTjƺ5JSFI+(d*iY)"%zJ1 䱑W!:` hD,*{QAZZebf#IDⲘɵ>x^6#i*."RA=eCtqpP#ON<`*QO1P*N@jv_CK#*g;㡣}ؤB'q]\i2 ai6B%%,{uR)QGOXֹH>"YfV-*Wp,梺3\ @ҹ+ jC:VG'צυ<ƪz,#Vd9MUx99ڄ %Ss1Z}WS[4H,5R)T-IafYk$Ab"<dPRF? 9$8cgh A2 B!]JH-dC0+NWDž4@H&is8 3:K$`Er YUB UM80]"xm]y# **jMIQfZ3M2c~ ڞrrS t甪m>3OUKF)PWz"I+ Xf YTIĨNkS4$R⏨M(2U@)AZ v|M-]5hi)PГ4SertЄ1H`uHZI#ؑʑy1b/A\55IEMLV@C]"WIuqFՇ!GIOI'BNu5>O]J*Z r)KY-.^zjLQ{RĚ޶GGCɤV--*c^"إL\ʫd0 Q%jHe2YjLSK–$ZAjZէMDuXքwqe~*A"=# ӞrrT-s&5|jt7'5Ulvݓ9fTGIAJu:R@4M)6Y5{cցR&CUh@u2`J,I5N2ϺC'Pi8q;._0nZi)W=% kI"RӒNגz>.P *i%w[9 cbߵX(Vcc"W冾"I(>3DLDzKUW1uK£Vx7qSJS͂ 6i@S_VJ6oI9_ 6"d1Pya\CUȚĩ%2PY (,[mF0ƥ!#E3_ɧxau5u>ߎIE{Fйg&WHt0MJqY8ݟˣYLm SVZ0:SWFFiLiX H/&Cȴ7iRU@䧫I!:R E r}ff$O_?|ME{Bu <$,knR塧 UO.#e tMH<-ʌ(}8BQ2WSO>G|n LЂC#Σ#6 \Fr>*-+ts ZEZEG^:0K >RC? Ms,i*To$1F]MI69r4q\Q;5T|Dl$  it(>̥@cҴAL*XT^)R(|}ALWrGOX1R8;(Ufu _ bR[NY)R"2VGVlKmٶIA9:y~"&*rUE.>rtj/SOz$YRM:Nؠ#fҕթӊJ[W2^cEFRO XMxT8ڟͻ1G`7ߝvpd)j:wqWLY*KI8VWMQaRP|ej (l-F`VT+9hL@*iP+qrEiC6$T|5]P@$!$-{@1&}3L@Kyb.忚?Lfu}ߓ; 2{fT>dSe1f1tUM5u,$i*ZH)tx:,ԔĢMcM>C03H&X\pLYKj(DS@Buw)tƽ_O$ tC?.$}{1U(]O2x|W`;ll܇bbkSv=vs/R+2X8-YHdVu4o`a Cdcad6?kozyCmJe{K-LTK)Hq[-,M@,EAn%Dea`}=   8j&+l|GY⃩v7 Yjf;ww-4vpQP[ϪVa=\8Iau8lnC)rYHևkjɱqԯ |*DgZ8ɒ'M!H%_-6EAk ]- +hPP  Z+'ZU*M@:kZoA|vNJ5x;  tfI)8|rMFArƝIk_'nvv9]84h⢬\EE%J+ZzɫSYHݭwOwZ~SkW3'PT* 1~λd^[_oQrM(+U(a-bGO~7$p8Ղ^n0e)HoFP‡+-ӓڷSrUA?ڐG]^#6,?g },9puc>kO[Jg a`tatmsrMgէ4_.j~-<>J^sn=znx6GoU=G޾my{pIqO-<V? Z_yM=z=iU[I +P+Gzv7#{ qLrMt@|}lcu1gk{HN9]W%m]+-vY)M4id\^od4K .@BZPS Dw0$G q)ɾE+IQOG53!jykF2v%HŔUֹ0UgmMLꂎ6?~<ýX@f! x$-1\tmk͗ gR<UKPڡVHY5T*Dmr>ߑWJ&C ='8ek`U!,=ZwPG4緵{l mAh*(N )A-yw0"ԡ"C^}b ZwrKnC }%:sV[zpE3=~Xj'6^A 8 kv߾rP(℅P {G WKv{Y_xڤ6ĵ)U5tgkuVl(*ITbdcyT[P;m>?66PU>A0>T8i*h+$j9t6<  ) h[+bV-_o=j.unrt2|@EE4aA3}Y{#u!>?suo`VEmgF0FO!]j7m֗V>EP N*T8GS{6v84g[8=ͺ6_GZЛء܋C*eM4UkSK+ũ@&{7]O08^Xc W²m/}ߗ/ 2U$ԅ>:Z,Xg(O"C%42Z+<=a_*Nm9e(@x2^OqnGjT]10 {•u&>qqp89j\|_WWQ?A{~=Rga{E:ـ*׽?~)|NRK,-↭z5 >B؟q$fe9 @sG:4pVzBU}w^Gn}nWΌ9ז=yUyoSD)7Z$Z?qʿ?1aGt},/{^{{z#3wdm꽵{p((dz*ڬ~ߡ}ø#u+Q-HRp5UV ҧ~toy`>cH ̡eĤ$dM#lk܅&/xxZy?rbUZ_?Zv6" G}dg1G3:O36]o=-G@8g (5'Ӯ8{u/CgG x,H@'7Quv(:{v;>|C0rXp[qn:RF>J%ǛA@|u-E~ةfc]QLiĥby\ćP }`tFhdvgN έ)@["n4)]_"u2[Kj^!p9|W}nAUOjɂmw-լt&RbG HTv*2h&iq&HDhE#9Q%@OJj qާ$P*;lzQE}5\.yn Ꭿ61OhSMa&x卓4O lO%LTXxU]I& k 0h6$E)JwW=?r+*wU>j-EHgAiJ&No)yڜW5b)Fށs? mQUR>TҬH yc,Un#UP5P^ѳs6B݁*.\cv77Q#zvןnmǎd,TPԭlԱGAhɜC; ULb53S4$>vY%A,~1]%I eu#K_2(_H$h}@Y!!7mqR1$6Hł.5DX+h޺lIi2>[ovoE{m{99rt1@eҵ%#K+@,+.ʠz/*mm*mk>pWd=?>t`MH )!@A' @kRxDy] Sij={.7eE,l1Jy)*m`^tߍ#.`wϝ@&Wy-ͷx2Ct%)w_p @9cRȩ D*TmBȥlkpu @<|ϥ+W@)]8m5Q:C;qϥ5yl=Mmtu O-t5,,_BEdzAOQ4M䘳]V6uv+(]WO,[`HɭiZ 8#Ө},Yds,DCVQ|Y_"o$ju&+mgԵ i)j'B!a0KQO=0"'{jUJή6Ԩ+C10G2~\TR*~Ycgi%f0Ě-3L}AVb @S)_9.&14uCŐjmQ- Qej4 ȪxDѺ"(K(B"!G#S5IncY9(3v[}BfozI4Nk*+GrZ`1agESH`ܕ4sU⥟i 8zjF>O? dԍD1IJ=dSDRTx?Hci$fE%E}"ii&j)|Qi݈wmĴ2!8G"NA R-Dqp|͋G)$t5I=?|"Ze\zFo²7f4tRb4XjcHS;DiQhR[ ̬( >CΆ-N$ҩEԱD!O\ # \IsځH߬ВxH` M1jkC{KنimIqy A=TˢjHsJJxro'K*vSG-ELQ,3 0;G%O'љm^(WrTvK;:i5>$#N)U-Q\-Xj V؛Zm_f18zVœF"v"&nF@pr||q[1')c|FFbPiN؛֋ycj)(m_$x(2b4LoP{cS=t2RӐo[o}νdGFK*(H( b[Fѐ?.UѧHVO7T&/n8IܞRW-Z=Vӈ#oXX]MmyYk]qqqc5SK%MNbȠ[%T?_Ui^0D!Xz!D..s5H<޿otOV[ߟjH:OX/Å{MocB_gHM_F~=?㐉_}2ٌӤl,k"a78l}n#_LJX!ɵB~&M_AR1,]L?:P_9><oPX?G]LTeToVSQBeq+5T fY?0m=o:C*DŰMzv4ziѽmv-^qn; *XJlf#`*q@,xUH 85C-lͿ-#+N(sê]b(nsfzpcq=Uo ==͒uƘ!v]R;1s쌿Tq|FjqG XɅf:IrY=Jn8ٮ:üǥgEuyF " 'Y4U2*R!I+Q=g|o?5;;g{g#?jm{e GcwᙡPQQyDk#w EOT޻_[m|VCgm[2ybD, cidD#9ۭӔI[$id aP@t%y31{h20:*'ҿ(7Χ7f}ո{26`jsKZ6&sIzj'˝)Q%,u3MQYv/X.~-FYx˸>C@Ou /x&"|&@I$Hq4d=Mq]w 2#f҂b)BAqI3akF#516cW YM\GgvcO&o!u 55Iw:b*z;m>[8J=÷9"SWX4$|<0-%8CY pH4dR 9#wz Դsm:|PHƯ ^yD]OWs-NizK}m'IeCqu(qpf'C>*9io՟3M1cY:btQr(QCqT>Id{蔉yTo"RT :-?$/%D;{jwV#kGwN"E1&qle\يXd`'EQ#"OEI]nuתom(wsq>RW󾝱R#.'+M {jF ݊8_J*UJe՘ȜH9 vsyë]ٍTj.YF*>&Sfka*{1.ݓw~hsn6zheIlȷe|S(2l\|q8y7 Y٢X$5$+O7VX6MDEMFQT5Q(9RxzŇ0C'$tJ3MˁTZd(7v+Wjr+Mr4[Y"=$edhc؏{9LſMʶJZF G7u* orĩ42N;+ z/{ }!Up'W1xTtm7hρ):`c1x^ǍEg[9ɼgTz z6y"/ +V߾Yoո#bק¥Vqµ;7Mk-qE1;wnT[kﭗ콥6e~qTT=rԕarsWk2S#D )}` 2*/#qdz̮_ 9bhHN{=io^fHc,C!*5مFΪAOI_K׈G5{caɸyeɶ6䩩7 7.ԚJXddԍS-O '(}_U&Ljޮ}W(Y$WNik%:xN-{h;+ `MLJpKUu Lu TgI-??*tサohx-Ø~PL{gyhrةꪪWQ;ZrQsq}W,fPHS!(ل{/qGbRQ]C&{M>-B =-SMP+ME 4G-`?2EעFTK(T#,jWIL'=ܷ1m[413$|.X**[QRz C))6Oz=e)=w- )wN/iK4T42Tqh j-:~snSn6 .Gn*(Eu.xEBh>01Aa ZeZ!~8M`w0j+^^_Neg\Xi#;kֿWlMvsqG}Yd4˔xF掚O3' f9*pF]AUWOTBDj7]`uU(VJ"}B8̀먭;}ڲ!M!ȉH]!{TVHPcLd*R~>}sg?͘ݛFx} A ^#rSu}8̖>'*I$ T/\nCj Yd9L 뿃IfIг$4.{Zwm; W)A!|TjE2.FH455gJqaݍN:,ZÎۭ>GU;AMPL%#7rU{+;mlx6ZSσ(*YG*KrAlcXXRO1H?C`*k6ݝ{"=}ɇNyɓ=J>ʮfiR(&3VӴ2qF+cɃRe+vJxbBZGHW6ng`fBH|$`t BycJ*mܽlݥOq$jJ)B1EO#gvk Oh|0CpnT1ݎN|l$pD7\Pż3u$rOY%f[zXQ-cS VB#-ZdFx_{MvV cjfy!w jL5H?MHHZJd܌I0F)u1ZIA)gWغKk /NYmuFBsb/78.aji.肬1UQjtJ}Yr=>[\~pm' g=5XR*ggxic&XO;ƌi+r8κh`PָREɶ1c+j(KTՌY78MYO[5/Uownj,IEE4tNƲol,Gsf}c6nSYN38h ^Z\^WW; gFI< ;JnؠP+UF0GXw. {[X7>(%V1ȪxU ^$02g$Pg~1WQ]*k"VW{0߽u~׽ -0)ۏݷͯpGj_>?Uߡğs>r%\wٺI6۔WA*/?|?n%os{+F(m Os<6Ҿ Hcq_~C4^c(*O۟jOTxևϮԲ?ŏ[?o!"hM,b>iI?n?{uI^ xdt~,A'HϾO `?W{զ]x槮 @H~AQlY,|UQȆ5f#~>E4禘9Io 1/{{俏=v.+k}Jq忖ui#+#OE? VB?Yޤ7)X[t "vk*m_:zD}/ fG=WH`+o'i `汏Q/ ,ѬKFRCa_۱ߦcJ\aN*\c$[M4)Ǔ1'|:Nl|d޹AQͅ#+'I|t"8JJQImSǂ52%c>ql6-cO4sTV|ζ7`Mi6}E${_5VtTrQK.rg* ]>ޟ O5 :G5,s BET=3|2ͯ]TTK7 M6?6aUGL&4V ΐ TȢ?AmܚB|Q=)5mWoAo6SuZ%%mxx*>d*gܕUSP䢣 k:W`~uOm$9NQVh"ҪHefSP )1jӾBjM1q5 )Ƈ Ohђh<4ֿ?"~rU|d*KGĘ bdhG4A L4m;b߆"<L{.x➻BJ#x(׻[l Q|]'?0ߑ!fzcʴ_F:lRvvgjgGl hj)*?L6Q U%xw4xʚj zbGV[L 〄 U, }|ؚ>_yDuue I^R/*1YǙΌ'z&@$[)ޯi$TMRYSI*:-B KwfG]ApxQ $ѦxW'hzT.[*3\St:Ij`׃H1غzڨk$,^H[G3:F "b9]Qゎ:!W 9z%sd c*Tp`R i`"tPAU֢)S&p 1k_ISMM^j(-Xq0yLԄ2>LMS>>DsfϷjru ͋(]Ll PuNF8_ ?ꠧ|Z݆?$J*y*RqS>EkMl^n5%r EK7 j)jS5==m8?޽E=H9*(?ӜsDi@Isr6uaC,x>s%Ì+uB(tk{' :Uo[ۧH4Sa!z~O.'QDoY<-Rƃ4X@O)و?G#ɰUC@E.>mq=B6}(6U.}G(n n8db5/P4 G4200{Qola#XzCԿ!e>G ?R4ž?MN$Ӫ1C _o-Nb+z֚<-Fjֿ?h*XTScKK䢫_ܐ_|뵖֯uv40_ I:ll㽴?$yhvP -5PZxjHUM22ГEpEF{"#2V-=Kw\-T[`]8x,5uеSiSaLՅ` # -o\nj1ykU᪭%ѐ(?OԞ}M=H|xcZQ^m S^\:3iO/oϦUH E`Rd5 \a[=ϳF=qU#&-M41qȔY CUs|mr5I8Xn5vdf33xh4|}|ۘW{,LTSˀܷbj3+t@.9 zOj|ٴLM(94r4LX`۞-hk=ﷅ&e,DjHLyfŝm]K?/o,/zjT-2qRa"5f"J eC}}{쭹ؐt'6V LE kMF 2rH}W.{* m:IOҾ] O|!ve6udXSymdhkNz$$Ry:RRAD aYurt"Of)a9?2Q#x8^VD&ew}8~\z.՝퓒,U5tc>A!$6c`?Ǐ>{g[ͭtmAGaO_U< 0xW<㜟ZB0w"OVaϺL?֒nA>QǛOg_vĀz{j`._>۸7j/og^7RUyVBuscɽ$TFSxf5wxίRMKtU@dl Jwxp_Aɏ1V _75lSӱuBlt*@\T-1^.\ic/:hjT.׵RN(]AKFy -;JM!L@aSA19h\Kt&=t*~T-Ƚ?_,"#uGU1Wd_GJG_u~gY=ߺ^ Ru8A}>ޱOnٮ^풺1%bRRZjauI%bκb>tqx!m2X,8+ >o>WaƪKKY 3QVg;_31 4f`j)&cE[ZzSI2}2C: ̍{&*+iT9J:Y(m5:jfp9_U5-GuG=JB59iKwqMoPJT&!VRG_u3;tԒn|i>PnXjWc:;jl]\ԸJ˂QK1CL i^T!Q2EOec=LY4Thh +<^ki\TMh*A$,rɊR$` -ji)Pj''#OA m A%EM mLj?Ŕ^xiT^XqJOEt+$-(44 yfIz((bBJ\"=Q:t+qZg!i:z{+jA U$f']O%,qf,pc44mM SIZR0ªzL",D|Gc9*3Rl$0O"m3ԘJ|ͷ2=S=YU.?-:ڕ#<`+$=8LZ8IѿJUE !ܽËS31SEhEiLgw{urZ֐BŎj6 K Y2^EW'>^l*ZXFwgo;rූ_ OpǵyL&cF@ J*T!q&WU=ȱG+ #|UM2M>])|m֮#F MP=8Ԃ(SkS)PmS,1"StI-̂mV ^/@QCLSj0>_S|2]:B|9$Ҝ"=# bBd24֚4' 4H$g=>qXm+${4ۣ~,#M|?3NOܝԛv|J>4҇P ʮ'Fabzd9cIQ5kF,gVD^K dYRޯj(1$yf ]O$24uPNDM=F b.G:FWd#j~#PkJUPuW$=OEX|Pz HHI FtG퉱7G/.[jf*lˉ3U䌴KOV`ZlTh#֠P#EET+/P!H8׈PHGe'PQ5Cɺ\39UGI*8Uf tuvVߒzlj`Gs0ڹ2j*\"?1JX ʨby  *L(&)]#H# {$ ^a$L z|x6t Fmyz/O ;o&cDF&J]*:J3JZP^2 Spy}߃\#tWQ+򌨵scrrSda*RJWh$ 4,βHW^,Z5|)PTyHT<Oiz|nGkp5Џ"aB ()J6צɹ/ydmfs%t|O^rX\X$+rd WU43$VI@TLS髎U+I`5X_DCVkCm]¸8< i5@8%BŕT_ӫVV:OV^|l#3`a>K#)q{57l7ؐ-U+6YydiD$ Mm55DFvBµXID_$ԉPx $)j, Z^$t{$s=4Q-䦕Sqfx*/z0{)n,4|̾ /8NXqմ> n1TKfQy˅=1/GI$yZhYdZQ6%ZLJR,GƄ'tRkހ jn-{w)ץ[DMI頒X@|X̎ X,cCJt B*цc50dt'~.nf۾5ۻd6z;U8B j)!fMz@JM!U\UcbCgk7!#$IR?Yn\nOm䂎p#x1@t4Ұ*XԚ.ڸ^l-p GۆLtxMbO$hDqQK6(ȳ$1LMPƘ1pxNb{ &,f T3|Ua 5:;>vܕh(@x,`kJ1|U]nMgrpeS7&KKqLWOKM~Y:D&?:cZ5TUtM]#KK樓ȍ,=vJhCM t'N{飷E&HJ tGr \wv]fw?Um]߷* JY,rvF5ӌ0ۘI! OeI$-F+f蠪՛1(^=㠧WJ*Xj(-ccAύPU6^K*D)=E,8cU6u_;!ĂĜkT@to aY de#t`4`X1VC B]Φ|'zn cpcs8Xv_`px}JG$U (%= UHAQ$lc2T ,9cFY&Ga'PB-^̆8+UAZC4ȫڭ i֬.e7/#K#A^ u%VTҌ)Qɺ2x]v#QJ,VmP`v}?ul"^*GQІkv/ziAP0USTR,HrYtTک]: ^ǩ%zyH525~0#=X Ba 'T eAj4T3{{v~;i l&K+3=D(+^\~L)zD Wi#_lZZ%l(ZvZm ŬMT:Я `iACVUήͽXH0Z_SeաN׮ٺ}$۫d,綯^?4`vDi=Nҝ8܌oLӥTe1ǷIVd`%U.Noљ]AWb5T23-Uf}nrjΪMBH%OJ7&YbJ*!TXՁ(4*jܸ0tgmm].ܻVoArM䮡zU!E.=֑U+rKNBT2%zaii L,S/2Xs~+3/v0EI ~!B n4i+[]rW9_phxu 3 bi~⧕bQ^%4:94T+ 54R6R TW\]$_*!zHb5ph呄jDxƢJe3xQR T+ @jE<:2[Opg8I8jiL1Sܻڣbܴoö)@::s%t'i㦣AEH} ^Ǐ1tfwț@3l)Oμzz{T`j&G垶5dzr5nErѤsCq$eB\sz8,IC%QW-d]Yצ5d% X1"7Dj#*Gcͅamﺺ iV?Ccǵ0BdjNPs$@K1ܟ'+%RjLl8kI(n:rM? l4eB#oU~?č#ƿR76?_{TABOms6ݩ.df@X_~=[P!l@ H d1Ɲ|?1+1#ټ[;ɜO \`$~}Gt؍2856 "yi^B'9i bwqd-k{ʓb魛9?ϣ?QZXkM{?How1x\6`c7 tb cG27 Ł֣n6-9-7( K(gtD PALЇboq:{_|[=^|]=E+|lxd0a*%e'1,MeB3Gͯ_[nnlݡbtarM&OlR.ZXjpJjoGQ.ds3^nas iAjz!@a]D-*sm}˻rX|nU{o=rd6nlm}e/뚇i'nLIQ ASU3"1鍹؞nߓǷ6Ճj].@ءUT; (Q*n$A)K]_uE~[Ϗ}an]QQl<'h^XJ<=c%R:X5V,vSY|r1C%Mx\]%-,b\$k$ъ5;3z&-(KG1%,rv0@ZrڴЁRNOS${%bt}$5a(bHVJӹY̑Q@wvc~N]3[4ow^ Őܔ5+ =,UbGA8(Uk5=uqn\O>=i|;S=Cbt砉 53K(1jRc,/#ub$`uV:ͻq[{vE_GF\ujV:f0Xt4K Dzx[AܛWxKŌ=^/-bU pK(TI oS|V /Ŧ̾[@1oI 5<IU8Tg}DuCㆶ2F)u= ]PݳJ}L5h;Ҫ:Lt|\ѿ!ɊsҒU|DU韓^ޏm[vv+ LT8OzNAI!4r2"{FPEqD@ xTwi$VdP:Eub1DB+FUm4`֪PmZmQmxz-" $ZwEpyiٶb|j0~Cwm95;5X j(㎞6*d=KTU]-S3_c8kv )r;ΕԵTQVWf-{`a6}Q t|ěIV ܦvZ1WoaY|PRj5 ))fB̺$63]3w?[Y<.-> %QJX#@i]\, E4!AvAxͻjni6߯ݽYC݈;>qݛknVd*srt4mu)]L=TRkW)z.nwa7[2L~4u[0l/C$4-)C5IiA0'UudcՏb0V$4MR*;4-2rG>򜹼vdSI4+ `J- +ܴUPӤj.@T}IkJt]Q e_+=u>l'c&{w5Klx^#Ha$|nWGma+}= 2{pu{z/GE__IGL)2%P5TT'YF؏f3Ig [{dnȳXMsXG^:54R$kKܻ;tc¦9j08xp{kDԻ(51*ʴ@AȨueiJnxkXdY)j@UR8-fF6A #EA!ptK{E=Ǥ& *[sc{{Km<r`DSZf 4YC[M#oe(:*-GcqSճTÕM XE3O )zly1i3U]b:BiǷ5&MH`hAq EV./s^۷_`÷v~+Ksl}݉Q߽O-1ScrBR$K]zGh5UlMўjm,2TGG3G gۻRDL#4ŅJ\q+&QAB(X9mOB=jCy*Ɋ5Zӫ./nƨ?'(Wde{͌"%(ilG'i|SmZM띱C6Gq6I3[Gv5/Ih9D0 ]"Y=BYp\TUU 4U-d`,rB-ᐨ C4^ BP pϨ/ܳ9ǖ!au ȊƘjOG5B)IKJdA-4hG` +{\>y~{߽u{Gh[e_Wmo|V:%~W^?}iKk\CΟ#L}٩; $¥BՈiCMz^)P45R0zavMPZcck5UF,QQ&>,}E%RWT՚* s4,deG5=48:͍W#W=f4,T+qEEA5QTAM(Vl diB3p@Ӗo*UUIAn9SP zڲ:O*LZZx#@ }*42%'VK܅?q:_r +&H|JIRpɩukUTR@jQ|ze yž=eAkdqQS媱HD3WK/R1&Zh9joSLḩZY &fAWAEZ? P@W7b B4EO½EjJ jRd䫳Go9ê*jjښxOZ Ce G֠mEGDK _IQPōl^Yj%ҵm 9PcUIJC>Lj&R -~P;$ d#+S"%4F#E0ߒ3&Bt ui4PW>}{Q%@f+_3th~ֶS9]+7Fj)jX)!D]J `T=hA<49S&j"]\W1 4huU[ " 4ӆbN()t,:C!jj쨧;sd(2I$0ۘS v11*JKHRLU#@4&dQɓ5M^B'%Sv; @* !QDY:XVRtң uۨ$P2aw?l DbwBL|$URO$(RXvDŽ.FZDX, 4_X*i*PF~ᐸ.XjxT *#'F( -j QhtNѵۚ!bdžs@Aj [v?{!YGO5O$0V桥(jc d(A,7Ay"|B=!zEh%]nzI56:&&FMuh'V5fi8P4 GU =y -xJNzOv+,(OQF&kfH\y }.3Ji*WYJtT 0p6#*F,9f]?0EONM#&8@#ϧ T>>w%DfWjKF0#2P5k<jz'!9 B4Qr ^y|#Vn;J6PtT 3-4TqgnҤXXP<*ԑTթa H W*I4չkJ?Y:H&Ih>tBz+ܣ/uYKCIYstb|Tݽae1^rDrK,n̢]43TVTp* d'_+IFZFR RFXi(%V@f' P9YP ^t|-38 O hG Jjd jˮ5SjVOqp9+C/{hPӪ37%f4 %j*qE,4}=CDCuTv\NbdJ ]=lpPZRMPjIQڭG* F|T \p$4]E q?;c~Hu.Kr6c5YŵNܦ$e-G.?XJU_c~\\)('YD};Vb[`zI'Y}:Չ!@@iO*\Πlkմ/C-6kmnpRS`*(Yݿ*XG8PƲ;_nbw^VmEk$RV6STo0,1&&A$ vTET],I4֕$#UJ+&P6لՍ4ֵ4TûȃӽK3hg$ÿJlfe(>ζ+#VzE׊i)#VbJIfӝv;,*5'Ta,V2 Ukܣkm)rh+RY84>|PrUTDy)˕WhOKFU{ \X}+_+Tql.J餫4sՃ2VI?i3k؏}7vhh- DkDB P'}lv7-Ep&+Fj[MH҃pgɋg(4.C0GIS}%n>{{KJ3 |Ne {Ǻ?rj Ay>PdF9y& h';8Bӱ (=Vd 7Xx#>J?NkF{WF5D P[IǨllpu{׵W$ԘmoR?RSRx4QwffgJh3mCo<,$o r8ܸtv{с?^Lp$E7GEPU8܎/kmΟէX/{sŽ)jx%Nm*;ONA0> Nd[[ Q +T7:x7 JA7 Z~wC?+𞹣n~}AdX)bG݈5Ԙ=WʝJ O7l>/B7ԣ_[8U`EPm{ކJ2+qYXMSWcRF\{+͒wW[ϞJhzwZaJ=mumuTpcc) 2 j9[L~>l)xn ]EL:)ɭ8P&۶Ÿ4NeA@G='ҜW*: Ia KhZY#WdV쟟#2{\"I!2etP*$jSKBT[ۓI`kw 1dr3AI`1!c͇gʶ\cˏRd6ʳl){kN%5<4Ьp DܞI';ivgB*-Se0Za>/p*eeJ=cR9c9ecmc3  ?:w/mg.Yo ظhO!T^J%ȩ,m4NHƒRE}KmAkvݙ8n٠*L}l51`i%M,ҖVES~{9s$n0RP騎RkX4Ԋ6WuS=յ_wNo}v,Hzɲ1#04G QXB` Q\:\EGcTI>bN̅cp-VךV}n_ZʦI4_/O˨;!K{Op_-=kqUKp̆WI3STU5QYmD,r+7]G}ڌQch!5Hh"XeP4#Jcakc.3> s; 5OyP:TM$+g^5SG[Sj0[X+ EsH-g#Gk"pc|6,nfv\/N cV VL[X }O;SIa$[,kp;۟$ֹ6d^O,m[=M>__A^;zeթPԊQe6.SAz( =m7[O\SzytTe`WXehj=N\Z_U0)t ytg@ڮEJP?ַŚ㸽)z>{2zm\snJX'G77rUUh>}n2DtIeu>ob:Fll+suz@BbU0zp?wifoh`YnBg!<_ȃ<@Ydek2~Mk{՟ȾYDG:?<NQ;f/"{/sK:׺ pGq`j:/t|)ގO)g'U<ѐmVc%!u#Pu}dc. ԥ@=#.C^YSjK}? لqq2Ǿ6h@yٝ_;cl݌'B4)SS5<9aCTr!_B?54 =1[4#22\@ ch8Cw-*bbѾ". TU&1ݬ[FjhVb$UJ4BLPt]?|`.6v嚖<|eNFiIAPצ mJr dPCvo'P 1TޘPT<1Hj52^%}<G#IU%@cVrz%;VE U_JP1z\u&S]TȥQGWN1>9zQZ*-Nt)Ik S=Tqc%wGQ ЮYՉK:G`5^ڊgtI{)эmLJd2V6m$4r5YoB ƫ<H$ H~jl)Hr~z z*iqRTIV,e$)5NX. ieAUY}JՏi!|t&-%U(tX\0?qUzCvӃqg9_ M-W+qn 0U\m,U99Gt־jzWg.p8jUN+.-zY)iJ&y‡RMPlGGׁb$z @T,q⣨%ۄQ!ӲQ. (lS2C"+bgBbS :meJIGX3DYel:e_R,7(5 V 1GXC2Ms[ݤr$l' g.59Bɧ#F}36+] 4Q W1P&+*VBs^$W"!M@Ω–'X8ha 2Й$%2ݷ⑎Gi`_:fznLFKp|uNٱPPWf iZzO,PNa:#O[iiT`i1n$ Tg*5TGARx"$ JimC_aZ O xTtB#6Pە j(24!uk"GQcoˆ VUa_M gPenƣi3̦2.9A,&m,a%^ו֏Y ]YRCt<XUy@W:ޝL>b@!?R@pqUJu'pf`|3kcP(ɢ%f '=]G[n6 ~snjwbqT(b5*8C_W2ʴV aֺi뼩G..MJt-De4賳>D"hD>H$ Pj r@:kPnfpY[PPHK+`1(\vRH59ܸFѢahv׎hGldg7.Vw|s>%d%)djz2TBfZdsݻv8<R7WK,JCYO YI25O4Q \LM$UFP^` uN19w"\M<] l:єfS1D餰PNtZ{IgE1ɡIM(u5*(A"qdM[ammJ9}|nYwL9`m$¶^'kR;7yҼR`30JMVevjPԩr'0$gWrra4+F"rydBKKT=Gm`C2|>'t緞&5}9hCOo}>GXq b*%dOv_MGZi&8<-]-Q4%fBUQ++۱ٖq.BVOHu(C"hCi.JSVgwr**%|`^5/)[Gx߹sT]yG6`i%'؍.(^*Ң*H cqSSGS`nX7QA˱N*f,{}#۶xbmk2AYCMpͷo{gMs">ӨCKhĢ 7;zʝ㼷hVd6#Szl)-6 %.?SƳWGMC~+K1%V [aJѷWr K e/%3E# hϧPmjj5Q\:N@cPR+VR qXoQu.TT,A(R*-Ǹݯ}U=>+;X=lTqOt?E6V*Jvjiɣ TE8zh JT +jc,%5DE(y ܕӷ5bAG0zQP>O3qX "@l} z:4յNīr.1-[@JU5nIln}7 `.@okkPW%7h=eC8?X{O$?I4_S.#8D<}8_>h AeGoo2ޑ]@`pzvXGOfy5(kXX͘-[ t\I#V4Q܂HߋBԺG?ܻX`^-6Ɛ+<2Ǥ ] K߬Y~C'K8; .-x?zV8,a첐%eϭy?_ea_ƫ[7}lO1/E:y6}d_H̀$j }uG?.A |PR#^a{Wgpnɝ,UV68iMj0rQDULWƦ>gI, m̡̊׎ n&-bnZrV2ܻ#SBվ%@AaF߭ٽcٕ[ &󒦡n }mx'_WI]K+SB)#R盠z~ &Ӓo2r5CR\^~m+=f* 5.{oDq(|Ȍ2ͧP59{Ѷj40bXf+ J04 FVGݥ^š5{%>7˵Ve1Qxu&73l,mrHTy"/]Qf6vZ}mʌk#Mpry|m D$ƺ;#crړVl?Z+F(@ t_JtU {/nL" CPMO Z#p7\ظMjE׋w ^49iEX#ijaR_oPohPExav&z\#UI-%|LeRj0BO6zdq(07pRe{cv(FxxQ}\@;7<}FK-5eZA*+^y/KZ$m)r"X]*%:ߎ.t̏76_7/nfbMxMۛa-EML$?Ĕ!QJyQ$}D {l=Ҵy]C]؟3ܘ})10m%EN.-^%hi@>H|QI]r1Ktٯ6k6x[CTR6ԭH3[$x*9W:_ h*묢 r/H3`k̶)eIcF`%ԁ&[3RGwUn|ެb3{sux}l*ZRS+X*l}`!@Fs_iP2 >p!,hFFxp\$i9c@V*Ahأ8Q% +k+E!RASEn 75ݻ%_w[o.Ÿ6Ud*qvq=Nbgcj`1r1fR4 vUխAXBkLC:$Ff* BNmO_]`{KU)5g](Z|=S|2hyI-cg>m7vǷp62>QspFKgB+_l[xm$Lht5ir5wzn-gZ) Fe4*O+N3|q6e>ޛ]0_vQOSC;dNzcK2k`ZdYO+v*lf#eޖVc O]ݔ-]&أӾ7)C3R,}M75W M2.*4vf⚤y$8ZKQ!xi V쟯h*J:@00jnSǸ4-t[N!GHؽp~7k6ܙJ׹^֋669ӛ"s秠5*jPĐOc6?n_u%5eU}N+/M5Q >BxT81ܶĭ"*.:A *K TW'lZ%aZ)4k\ -=9g\u%&Y==V8ԓsKWOS5_*lfY!eS[_>I_wUebTH)O#ۥSXi&x$0̰-IbHkE j ZQMH*BZTq=2RR/ Y: (jrr :h8?]lj\T{r|"7Ҧ to-zr,Rd"2UMW(eZU৚*qvFۍ6RjVX⪤`H&݃̀dH$e&((KSM5$6f뎘Z|L\$|F[+~G|f.ajlm@_twyXS>6 5! S;6TYlܽX4UuF |o@0nU.*XJ1NU=rsw3}U`W@ETQV>`{kY$Zx4+_N]-[П0s.^^ mOknjx]GWE[?g SHgXEeNjk)v MVW!8zLmLwESGzziUi ,Yos.}v+K=ITM0>"EBth%I쩏>MtƼ1۰6ZIxt_om˂-ղgu*﷪nAwB!CACL(e8e0gzmvTnj6̭,l|F+x¨s B:"!NۍIe 4< Bj (G@9kDZxJq T:J5ww+ J]"]S 'd%D{Ie>:" D~iR ۛ;oc팿î쌝-^!ۉQAI銭,y|"9*=ؤ=xTwQEjuZ&enb7W!jںKjT}r5՝s힧@ty&[o'c J`SdL& sf;ii2򘌆RavkP {v#ᨆ9Tdx''8%IKRz+?@\ҵjd;à.ݴꪩbMxv ()^[/׮09: TeKW!ebgJJy@hi v$.vVqo;]_5&yܮ^9Tz]0x/+IH,<`xAe =>)ZWT*wB+;{:le-U] )ɗ[5ieD7DI848u IJӦTA$C*bHiN?zd͡;2EoYq>G̟+^hEs"DR~Mmٽ$[USٔ}muG&WnuK0ecULye@AZ.MOp4X&Mzs-,ewCpaf+Q E JjU te&X@(H)gd.6XXrCP]~׽ Tt0ͯpGj?>w?Usq]\ѽ AŇ?vP?O?Ǜ_ ?=%ͥ?')ӆ^Sȷn/rs_>7p>@mAooi ^? ~u|}Jq_?WϦ늻+X_?vx5?Mkۅ5pE97OqBٿ s{tPzLw_o\G7rGo?'<[+'U:/?޹(pZ]m?jZa YuQ;[Ǻs-yd{cЯzp+um\?N+m#[A% |?㣥" }mXz~qſؗpvtNۣePNh:$?$D0t`9#^#NM-W!pe,`芲b}'/_51qq_[]g&ۏhlô{kۻލ+ɭ d|>X4d'I}ݮK#콄PD1SWTT?45SE" TF.[Q@8:.^M.,ci]Ct\HM4'O׭6 U(lvG BꚚ9 Ktq4Gv}ЧUU|&&Z!9)vz5I"(%<.dhU$ $RɧOTNCZІn=ÂRy|_c+O}qL8-u~&l}< Y[Xcf$۱1i,2RwN4 )v,+JO%֢y&r:f15elbbjɓ4D)\U+<ε&shO:l='RXQI5Dږ,QGEB6.-aY 3hBx*EH8&y~UgpVn!S!STl'奨Wʰ5αr! !:,RdԬ¤Dr/+ 8юpq4B)Rͨ9#K t k~Z:<&FtVhgzJoEISq2(j(+*+CfOBs/uɓ' bO5AI9b]M^N|l)"tjSI F5BKr\ԧu\RgBK$:AJ-P^G-j4QVpkLңNl~VtU=Lۧ܏!M =vOGDGT:Z2)am1u%ԪYg-?<(##Kmz}$^YP+,N]<)d^I",iOz~/SP6df1]rͱCQ뱧_H),~ac`(f2 % OTlEDv}jbᵈlUU(@ ^`BYlAo@@m4+E?v/@)TEE]fshZ2b~*wEz7 J;X C3SNEhH*ՙT%7+)E 4$R2rC Ue0*0TսVr}|VCC6U!kPb%5PN$)b@/Q[0(*LKG!Zy6ev3,7|~+w/E\kLqPZtm1iJȯفҺzΩ#ՉjX&͍:OM (=Ajj+1eU#jirдU"ɢ%R !XJ:,.kfKqk TS֊p=/-RP`dӏ+[onQ=866I(#H#W%-M^WHܠ|CE_G |%gz$V< FMpH٬H\Ux+_"ڗ?`F:D*M_UH"p(J]V&,rajjh)2$gr8抚9TWH玱I\.}mZQiZj8S&60;ejTO'f1A5.T(P=*jFz2q8iZ~tAM;sSEAEOI[e!Nrujr9VY %~=Pra)&w {Osc1#(Β*VVyPAEŰnin 9 悂LI"jWx=2 ɧϹ4ǡz2RzjT#[ꩊXDȗJcDu+'*W?I'{޺^5'7uZھ*wmŏt2n>Tm<eD&>Aoa3Btߋ陊&q^ W>?OؕȊyi?OQx-3N~T y:Xx6ejz.A s=Xkݿ7sh)Cco"q7!7`_'iZu5At'P]Bs'@Q*].9nlFlIj+P:?pol9:}V'G*H:}Q$aH|=h@Xg#_t.Ĺ?qnix=z²&?^=BXHѲzݪ=WκɎ9M;aT=Sb%=j20 CyUfz9c2Hi_3Ӫ$Ȅ3ʒ׵fANd1o,Y*t/\<5ʂ?W6pX7*;kV:M%vxlGTQb*)))-=`wiHr j'YNr<})GN)mu-&8)y% }kS[Jhd۹iԕ}L,O^Gj_ti#t8jp^WkV=)M8~ތf**8g1OC(M ;3׸҉ZUJYXG[cהD{k L jb޽:wmĖ -N==Ay{H|LTg!WyUTS@YD9xa}>-M{"'e -4`x4Դ5.%R]أ)ʩ@ҝ'zf 4TW`|Q(@NLN(UcqMxHg\nz "ʲIhjâ,wH<~nAlFA~^Uqyh'b%HM^ۓz zfQ-u\>䣤䤮jdTVHd{kŚS " Qj)La{؛.ln#.DwXkV=<یP>rиԚgOZJUx梠d4uu8R*ERAw{ZDPQ'T`u~O>/rVe8~|3N{m,QǮ?gzsىF(*L,`NeKsb*?orCS:Qxkm%4$YM6v`SC_^2>bH-FM4_qC4s^'z H 4&U:sͬ.T4ALx~DT"_Kq_hFc"mu&)רK/V3)U2S1c1-0ZI#W_~nPZϿ}.b`IJ?Tۈ:XU?";H׸-oǴAO;2FYYlGmh*E~$_|5G^xtYw*io[8iny}Mj,MjRh'=dII _a~uwui$8fs~=QMncO!b?bQo<>ܫ6Q*I>6FJOM#"4F>ڹrxs=s7*r9mM]Wu@a+PAA8TC!ˆ7Vpu#4R)(gd7 mtnL\hheQXh mÑdf$eF)QTZԌ}`q]t{q! yQPȮ%YK?Vݻ_rⰵU=~F5G'&.cԳL_+<]04f1ix9ZZjcqYKgFbRH>,ܮ*N PXX-zfK{ʭ$c`'1.F>)Uh&2Esu{Y*r몶]E5̮96l`2YrˑL/Ǒ7RdPD`S,Ȧf9* 3yPKۧ: t987+Y%:}k4RCKSLxGD%Q7"VΪҕ `HoMeESQ@ Qѭė{! ,kCQHaPKvt7ˍs d7ߊ|,Z?g}EQOӭxia/ALTI,#Ag f2GdJ !nte-jc:[Q%$& cSP8d!E$# @ʩpk3S۴ZA?&y]w; Q%t mm5D4)JHrǡzI6:*L\};Z%(աHB4Gx#f%](( /t,:5P[wxbT,R0Ѫ EP>I1q_xNMjUVU}kwhf2epJ\յU1 tUҽ5dA%:̪,YUف Wӧs(8V^_EFzh'5Zd%PU |MA6\^Söl/Ye0M[3l3Y*TCDVE2bUFMѳFG} ]n XIH0d cP2W֧`tf7 t)0 %euIؔ&9t뎌䥥lN'?FʜdP4xdS값Zy-R"-,ō|VJ|YĭjrrI7eRҗ;wLuEZD \J(!cG\'meq$!h~9:@EaF4=;4*R?*M|HMk*1XMf's% CUn-䪕*㱒4xx)j) <3d#J,b:j2z hfX0@v j5=r;x$=!|W:h^@ k3ARw@ 8ݛ⎏gʕ Ŵ_olz̼}յRh*gZzP|ȭ!ੱU5Ѿ_!,TWxLy I!Q>(h֍Ӭz54atGo=/.7-&mHr$'B S=4skmmZMv̚<:-KC(vL*m}Hrb%E<"% |#\~#[Q0DbB*gcQv*+ f?W"ړK]p4 44&iUG&x9[Vg@(A0YCbդ;FUѵ TG7C.1n#J+'}ד nP&_RX8GVE',UbzZh%:V J(5ԺCXH3ZÑuClH;z3H֍PyӨQ cT $c (  '!ٓ۔xYu.Gxg7I+ln븩JչYK5zSUSC :GW\'HD[+SATV!4e%F7"Z0,.t!JB>cZRZ,?h\Ҁ)7_llXetX^#1;gbWgVE&͉|N$h>޲S" ӿo0UMz(Z Pj)*kyH]cJy@3Inf $QA\ u7oImxU I*A:kFS&؍6_+I;/'TQTGKwVژ=Q6f|i4忇5:h~ l?bLLrqUxEdj*BǛV=QS*設VFAҫEYg7t,bCpB~2EP`aT9Mye^͍70)Lt,NK=3cisDBPсũ'sՑ_ U+jSSЪ DjfG 4mԻ[Ȍ**JǴQtT\FQ2K(u P@N[;1gSJVoٜO-QrpmJCEQ[SU)$vQh{ mAS)[FsnuyH%ܘ laWSd1$Wmj>gDPLq؊13\J$w@GR,PĮ#\HeguwRK(@5jݣnf+8DQ$1"Jv,Kjm!=IV)k~YW,kړ0A6$6)iƵy|& o+ q%hTTi5rG Ly0R\SHRPUfZtEji~-A{X=tDF\њ`IrQAڠ 9僨4~l}`+&}vbnJɳR8M7cXQM"K;DU 1O x=w~Uy@T3[[Lsy W/=*ɻRơ?oXSEeZOj[x)jұFaﶱ!GY![]~7#oy&AzCrVn}drtIGK6>~=cf6 ~07i>_:gJ q` sk9DܒM?r;NO%P \z>o^M4/b9ٛopeG,v>j^0#<ฐ>{ptQٻg[V 4)$2@l%z=E4!@"nCdk*iV5ZT7qoU`F +? :9,\h^t 8W~}zɷ5U~I_2?Oӌ":*D0-;% gFZBo}.46:M0AӅC ƒF$7M]L oYid'$ 8#N:`XyWQG=5T鏗+umMLkrdsYկ#Y6D͗Ox "rmZxF𠟬7>+ܙ6 29$STƕP^>-m 4BLک/U4($# HQ0imLF{H [S:e,:rr{ g7l͡&0uTczlt\PEY,I$bVU~Ǧ'e'?n Muf$We*\2&dW! kͥ9g֬d 2$vG )!:/PՍyݮ1Pˏx+ݵU&5wJu_QaN{#-q]+DM<ФMRR4W{cs>3ݸM׹qTSymɷEOWi(SEX(‘qiJ]$"I*#=f%\cWpڝԿ*6_tvo'>Auܹzj.܆ǧ޻68ddƗ[K<# =+x2)!r}Sf`]]Ì |UU)B*Ġس6^X渿wsB~},5(XIAs˓I.ʂTZ@ua]ZA[nz•~K9S%Um-#N%Vh!eGI7z6t؅oSA[ZfH$G>> % 4Įyy&B'@(i8Trkkt z( `h!h5vևƱ}T[J=C۝u3 nKᚙ֮hHe%6M&I?SOȶ:sOM3ykia0SyE%=bVt:U#ZYKRT.+ZHJNH4dP# "Ve5jMͼ+fxlG%*ʚJ߻28T4 G]o: XMKYw\ePGuE I"\P[ϫFu&5ruex$#|9L(hب~%72ɣm CROjjXRcj21 Kz<4]כ^\6޸ Qm-Ŷ:%ki秆 Y:ebIOH+ד@* ` vDdX;P+1$IZV᫢~9apԘ=ݶU⫏iT};w~5##ks}tUm>tX1El^&s7.|f3xѶ[n*mK  >ª!ْ̰M_Qj >&Ɏ3 MR7?ɏ͏t`!c324cpO*yVu,Y&vYefΥbZ W˥):bUVV:uU'W|E?/irB=pTESYV|utԍI{?*:Y%+Dd# );?B%A;.d 6[= IMM*=}K$eLP.nq0FFZvԡj1\A-U1 RF@㡐wg \)=TwWM7Ǎ;-I]ӴN :ۧE2ifr1%<4A4ÂYM:.OYIeNv*L]&OH>RG(eUec 538r$"UzwIFQB6uic }ڝDz'ib{eGd{Sk;?Aisy٘**vkιZXэ8k"dcG׎ir(yLQTɸqTAMvYUP@4PҌIVVm ;r M7>ZУgN>A֔:;cߏPn ];yav?5޻-!d*fdSU UQHٲ՟!փvPPcqx,jM׷ەJNQ<; i%dmASP :iP C QYN(CQ+/dZz9:OpvtA֘§8gmiV11ZK(ԀV3LpF'3II ikQЏ}Uw_ v~rsM{]5f(Wi=KC+Ha4j?;S3KB͙n/rchc{z24PqyR8A$j`j>]˚L'MP3@AQSkM47mm:Ԯ )'i=VpԘ~٘vg1{b$x_,M5- P( ZE49@lt3ln 6fln Te5=TUԤJD钹3ۆw!UZ%=jrC {uE//9{{7H/t/_}?iPBMFO۟o@ҝnc7_y1eQ*#W'R'.է؁~@~7<ۏsT:9^\?_ Ǥ ؓ6Y8|Ӏtu B/a~x~?zhu:yFv\^}_SIĂ?j6ǷAZRbosa Zߛ_3W3ց שōǁȸ[)!]MiJtn8(1usn@I?԰"ߏ|.o:AXkZ`?{`/N9x=+OtJcqL"ON _oǻ͐HfhoWb]˼_˩ć[oԼe#\_餁q|wcuD!-%QUGϩu-:^m\x2؇~_<{ Jk'x\_=YF4sP[P񩅪 ŢHN)RifZJ:(a j:}G;R<@kG#A!BJ51\HmL8T7oˇT)7uf -r㰭EGK]y5%i5ZI^1f2i\M Rdʖ!׀30e`S[Eji ]$7+ ꡥ&u[!?cz xo&G j]\fAPnXG[J%r XҢFUYυTXYX3bcyS2Jf'Ue*%+}*@"ڟ*CBjcY}Nz<#߳ ٽ8cm̞Ҫq1dY ,Du1OHC-%PCwH`ex!棧VrX}mʂk]VaF22jv<8)YW 5RUTC"5j$uyՖ ,Z=H̯RҊyV9I<tɡ&0F b,=Th ^'(q¸9|Z sN W#KI7 5 qDZ{F11]D=L+!視W.txa7p-aU"Vzu.+ʥ<rVÒP$ZR)Ag8[ZLCP-K bK(Mm!`ȑ] FU֮5TAq tFHZd׏4Vz0y(L)HS'MI,F=&*%~ֽicuJhm mO4ra#gV lv.Y)q2h1%Y6.RtХ@҆JhƣnH!U+dT&JCN~;>ԕIݦBpdcUW}ryRX$J|B7)ON^q40qZ%Ӎ&5:;4(-!+kYŦ^ B'`EJŪ _@J~y+S4jh UmrOXY l]$%>{+{{r,C 㓎(hWTbYG1B2ʤ_eG5Ш8S:TփJ8.Gp ӗe\qx>dYbqF*)9V-ʍBV51X=gsb&7j*WIQS MlԨI&P}Lʄ][c\I5  #$Fe'@uN5+TO[sW!c|&.հ>w cXLG5T<퓨ʹ5]2c$jCP 4IԨK^$k(:{Lu*҄Yʡki%pdpϗ@ ?M.6,[V D8넢UDe&c\m IJwuV]")5+BrCNZq jP!4-B_Li #U0I,ɅP`GAנttJz?MO Iteږ'pJk)+JJWqY SRVIbqOIJDMFQ% ȺYޥ2U`tX3Mд [^ܩT hHsJgSv˦G1YPdQn݊<=,;We^lM!Kr&ݰ1V$e'^J)*LSs$) =ydv4F*n[9VZmX~ǘ<3):`zl/-Uh1Jv>)(14J&>YTYqpIG+0˥36SWMCUV~IxPk#˜e+Hɻ+Cڵ45j P XW!eJ c4^i*#I FK8S_ڵbI-U)Hnniݱ53&2)熮U9L)q,̳q$vX{bYII,P*iZfz|d Fe֠Za(0Oq4CٲPh隽RcEx|0ҙi XJ)"" 2/G&IO2dk[%=*ԬaFa7_+i{b:)sC"ͬ\V@ v-]frhqJ(N㩩QY\䚢( 4CejTc:C;[Pj+r4jJ@ E k8CÕ5y:ܼK8AO H }?O=t'x?^Gt{\>ҸiUЊFGQin?$?یLMN~{֖`**gU3=KA{[M$Gx!*ޜFkOϩOV E'qcrMy{XEEnE&\\$%43}iA6,x\Hu%ʦ) in7 RޢeWuː0U5U;8@ okِ1YR%)|U XMf! }?Faѧld8*5*w `^]Vk{x.cuLH+por5pTQba/4,+'ϮκjsEZl|u)W@m_l;ԫZ>$r҃yҋ_%h`a}i~Ǔ_r PI%{~NcҨ$htpҗ,UfhGe[5kmD2P5;bW6lw1*b?E~UgܵMbz}Vبkj)nX cu`# _؊LTbZꊅ9 h=a7<\b0h̡iDȜ y ӑVvp*&~}i%k]/ Z bJ$s5dqH# c͹C|(J5qO$4eduC=.*A/#g.VW ,S5G2P$SȠ@>3UyUQ=&"Q7wmI.E $?3#mi4Jړ&dr`c57:Ds967qϱmfbBIK5 TJCgrHh4b=\3$y&ztgJLªW?Vxt"aP,ci)%xALB@n?޾B=od}m=Xvo::?i݁$N'O7ѥ |CAn`1[6G<:6؍7Jm40-ۊ20s \P7O̡AUCo=3y`}}UJ\RX,K '/U2RFqsq52ۆ&ǸT? lNjXe4~:lށH'M6@3_=$aMW%)Y|b%AOy)EZoh.$6O?(೑]p"c?%;Tj-8 XkM>r˚q!??ˠoJ.id{kީC"r-o;?<Nv /?棿z,'{^{{u\~/}K2teږZ,u*ϒe%,Q;T:T* 3Am;|zsG6r$ot˷qyQb|^ln)@U(Ԑ$@$'ˇugÜ's~;.h!ژՂklT4 >clbJgJ0N}A$29̷GVuHƕʅ51|.c:nW&lSgpaXąm |MrÄQsݓ#9Gq1\G`m,eNbj'Zxb *-*FͰN @JYPj),LþmBj5xQPT1bHjz7 ѸШ ֒ƿWJ24enߎ1TQSezvO8=_pSElS5(`U^>=fGr##SQzxcDc̭4R{d#&iU f"FΏ0 vw[ u D*͠' Ez ;+hT(0?C,v#"wkk&XLJ$y:qQJ4WO$u Z*Y+h6-reDLu%k{ ĬVƆTc憣@PE箶fW[شnMݘlv&HB!VAU9VkVEvj:*(jxkdZPa]uE噤3_ki};H;TpƊ(UOLTc?< ',d))WȑˑtұF?%cNݏGwW^b6/]e9,u&?5-gxBjUcJ;dn^쪺.nmɓz&ߠUԔjƑH@'F"$ry7W9 BWQ @@ml9ϗ^ٮd-DdTJd1Ty[QEuu;u>xLkxɎE"NVX,mG= Nj7hnaKUdcT6&J}5B[W@H>ormKt]dU`jf?t8pp}fe}t9,@+6gdMH! <_$ lZع gZgpY1ɋzXa׹ZbkLnU1-;7Ok"Q:jy!,XI OL%UMjjۂ毥8=cϲ_M'I _HD $dq"t5:@Ac{Rhhs3t`2lLMvꤏ/ۘ LVRh K42LJ%yue*#7y""'مMT4u1! V`h*HOi ,J89\W[IX[ͨDYG1^CB8T'Jn}v5uia ۵Z;{$덍hLUB55T'u!=3HZixQlKT5҉rQTžqtU*KLj .h TC*h2>&5)43mӼw* GI#ԩi¤S&#}shJǡٹzZ,n kQifF*VƗiʈC"+G-ttY\LPUdcj8j_%I_\,v)g!#6QP~zhYFXr51*w6>(KF3>?0,˃@:M|e mgwn|>-fJCSr E]R -w #e"jds0`yӭE땯Hf)iY%B*Ć:;ɧhjZӍ{[sRm)5 Mt_Pcs{7V*==gun7e2.D\^ܓqTOZ55<|%DBU\@;Dԇ#YUҪh5$ TQUHU$Rae\EA!e`+/꤀Zd&۔ f')E1Xn)BY{?|ԣi>US jÐ+H{UT%@GLJFS6[H=d"VPU۬G@<71X-]=&رFح:DS*Et\VPt\ D)w%]_*xŶcpK45n4QEQO sR)xQ&jilUM.F()Z\ضW&VeQS)KHFVY<~"ц IT(4PWx=傃å"b 7஡.Pj(էmG˩9^YZz-͙n<>iwWxUm,#sF8)`n*&cAҪjyAIS^*,T9 ^(*#rmf^P)3y)*T0cS8 B+5ۛO&rn6Nen;Kش-6*^$D]Z 1ĒF$pnSJlj*CUtXd W4o ;Uu\iw)@kq7r=;ovn=ڟcpIUÌ1"BGਬEH |ubմuy H ֱ Rf2SH4q>Q^L(D hkypxҙ[|5O[HdA{dS/LJ$S)Mo7>,\1<Ҿ)ЮZUԕxkx@龫/6 QAџPܻ}?MԁE^}H׽H$zYQ.Wa}NWYJ)7`{ǟZ#z;2 ]yl/C} .?FP陔K/E-v<;Ȭ,.bmKsZvyYcCQ\]m``P`-OHîX;kJ<QҾ*CjU&D7˳:s`f=X=ïi;"'u&jC=$_%OB]֢'cCVP״Z>L2Sdu (Y k8P$ wYX) WiiSL0JncܨZJqx췟hVpϥF)'?eRf?AH25QES*5f(# w^bd};`8~u[:Vx5pA$T43JÂKv\jQѫ;M*+gl+}2 ~.C]@SPMr~Qu߬Gt0dl.Qٔc*7^-RL}vZLm2N8iz}?-cLl'onC&֩,E %Xucc1vWET#iZ%†5eXm5Ҁ4aUh*:&êXO߽p{ ]h6=Ho"1jX7ȿT*myPImdrv5M51KHeAt IJFSBFX+r/!ir4B`p̯vd$oYP s MmpOtT5)ƄW(18@栣]E_}OմId#x59}sɸfESK$jjd*jvT-Y;vueVnJd RF4yH+(8cȀTÐ}}Za-V2V\LֺX٠Wmv Ay׉Qdn ^טἶYd(qdfgyd3v^_zYSGS,R,%ݪs~ϵ<6v|n]}+Hh*U/)f٥nwR6'XW*iCO2Cڬ$ClNvW~Ru^Civw6m`VfvMWUnߎld:>"+$hѹݱ82f wMڽÍM5heMWKV1Ƒ-GFdvͷKn=^*v7JH%^m:9XSOFz s6;)7EfwVml&\cR쪊a|uF;TGT1:+EZGؓv ;xe-)JNJM)SNY.È#c+IU(m^zkA P2Z#VT@I%D[y$! ѿhQZ濆q´ici%f1e У{[ ޷|6C{155zZweh736n/Uo05IM3-5B(F3iqxlj%=mXbBZhP@E8kk3< #j%@a@t@pbMCW]]W'Hj<8\TL4Ui z}UyI$ȌuNսMϋyx4TAS(+-$SV \i%D1@r1\1Ө(\F(+᎑X%ٻ޲5nӟ[Ɖ4Uv))j䇌#MHv wf̃+۹lL*,dy%sXG. a!wE> 0@iOJ5+[L-R¥~P8 enK/Zâ{wmˏf w?1`g7Y Hc_,-f.yjxaCmb1؊y{mm|i)vZzҵ5!]@׬vc spT5+Mri=5"E,]%`+L50%HDa]FJibOB?!b/)MK|%Y<S;g^+ɢ`Ncnd ԙqB5N[,baD#5k\rui4:ETPAGHXE`\3$)E5i{FWm~;G훎w|nf2{n=ԻrH~ĸJAY=5Fp;ngmYvuJ$eE>6U: :g9_%6 riwf礭,=ED0#eog%QR3]% ($J WTV:aĖ[*{ڗi)Ag^`4xj|>ޘπǶN Ula j#bfk:"y f)ln-X<^*y8Ȥڛ{dosHSxܞj}K*\TňfUOQ’Vdj4INu }r+r?ۚ*RH4?*@T+cnMx$]TIXHI4uO_ݠY=ŊMKfnCo*TIO LPz"NuMWb䲔/.Q^glf]dPYKowm,^Ҩ&v$mC0,$ NZdU-۵W*o:a'U ı^$w5ue7:#_h~_1i+]4-$U4UƂ4r%wOYv6).؎nZ3Qatq-ct̥ٓ҅~?,q~5sKQY)Aڹq- gmZ+Hhs 7lm;jJ]/$^.1g6ס*  +BRGWzm7sKQwNl44 'N!⩝VC; )kK^lb L|C(`OӇE;NQ/hE @? S>z]M(*"o-eq+[,Ia Q=GM@{^]+' ]nx_Wqv?iP+_j/؃km }ݛOrC?R7.WzMksy_:$@3 =7$\qn'o_o?sz2ue,lX'rm4\#z,'}㔋yac:W]x_mnAk/6r?bSKK7-as X}/ފxW׋K7[m{?"I^Dۀ[][gGBSӨoçJW狼}s?/>O~_~}'10[;wϗحz"tRsmO(?gUM]n{ZzhT5r0o7PYܾFwc+SyyXc4//}®CWY̌ fs`y{ڟ_Ov+PD--fV(K_[ _UOIRxiLԮ%=>{V%>W, qCH,h@P-ZmTqT#0vv/U%uXj)FGR$9v/+tGک6KFTUTL化54'VSYɪAp (iJ=UdexꌻnOAurƕNfvE,Id|t9`&\e$c]a3 uTtpOfIRhkQHxDS%TGWɰgiJ_\/$`JKb3TA}}2MF,MO /&Y]x/AEXl`h {vokWWp b^L^]<ڭ=JWK$z5F: C#*VXjc *R % mq[@HZҔ!ExUۑJu ϧ-6ܥ#IIKi 3qnxEw*USEa$3mu䁗&zLm4kRhrSֲ8+Q2uwAtyKxaĵ4@eSx05UkA ] vETrуFXKZK(UhEU! &R41TS\e$Oz%V=U~dyIȲf\jzҠ3֭Y bӵEI57{K K]T6C4ud8ԏ5Ũnڪn2I|L}i*+]%(V1$0xb  ՋsX:+ ,ZTVy:r0z ~H횭M՘yrS؛(E¡)MN? MYޫ!0 Ц ܜmZVhY+j$Ð t t 2M륊I#4ʂENHREsE:%Xv->JJ[r)u)87>7!N%%꽥*Ĝ(QF[c\ztsQ]5,HEM?Lv+ jH@  @)M c]F|YfN!K! 8+&_PfPF#z!SZV*q(O:ENe fc}+xZʵ#IU&qsLj3Y9DQQW*0WfҖPqҫ֬TifRAVAΐi1+:CJgy֚7SdU`cGKDNyD]FrY4He`MDV<4.9JHѤƍb51Zm!*U`#XĊE s6l IJΝT Z yg 84xb$ku>jb6NJg}]Y<|ubZɑ^gR?5K;Uit5*#R{`|<:<=%-B0xصmMUcy+kMK A1e'Jޘ&/sIQ8:UGM&3< AUqx$OQ[Re{i $WPT)0@QO:tF\r8)z0c$%W5CؕRWVO&Gjl)z̥MOSEL5"P2i%hejh[E U+>&y%LPZd~ jjoKK-H#$lqxj\$xM8@EE}4k2y(#ek5S?`c f_,uGy# 5L@XaVTmeVWU:/c:U ƕjNB 0:/12>#K ]nV%9㑯*J}#ʐ UŎAg3GSePbCP11AK:M3MvY5Y$F. )+wFӣɚ*e)ubDSsmjΒK6b+OY`zja$Ljk]9oK[SP>y'Ji>Qϡo*[gi*eM4;j?bnvR$zF⊢("bvRML#G잯}ݳ C|v9Zm,ߛ_[)C Sb AﶒWZ0_ϮOY൬~_qXמ4`uEOR|y>iGXq`y$_{SG<?x{[沮 {X؂=sAҨ0)MJjp9oo=VAџHZDQbrZ_h|&6я۵=$*Oh?/j f8a_{T  5O<}BKtHŠӱ;vF$,I$o:}$lBM=%D|kւ$G~QTH%?Bnѥ$co[wuc}~F~=(u#U_V +˦Wͅm 6 $>=O['?ltkҿ[o7xk=zsQ?Q.?MM^FتI(wa¬bxJxh4hO* 0 /ZjFmZ ',& fYF?[ssRυYY"ibCboe%Hx00FV-]Vr%\Ln>$)Q$eV l{A>ݺH C{aFhA#HG1 4S_5{UI՘)xǼqa4]z Y֯)]C*+@]&"lZ) 'YvK4*=WѮC I 8T# !SIU+iXbQ@^8/`dcw>3b S1R2if@uHMyffM2S$|3 [^$7ćQ qcϮ~(P:Z 42@T$H,cXOjuvY:i1=rƱm':M__aaҝ$Kp>6s]hrͤI+UϙmNK67g!y+b1G1qs 걵 ܔͽ6imzy#_=U6F(*TE3,<5BHj4ПG[|V~lPqF3lvmO3.ҁEMS_}U<ʶ{Dh61#}ԏv]F㡫 J&viPې ^/ɽ~#8J JsPI?8ֽKQr[}JV2Rjxqz8{Jxf IܤnrI.6gqv~c0ʥ3>*K Q,r]d\F*u ȼvc8 ^=~N:E6_[=`w&ԝ*sQb Qidlڇ×.j1D#w:5#_0fzg }EW_szv^OyR%IqdZŁ C]0$yc'(e/ Pg&ޝ#L6]=}D!MA_h󭉷ly)$GtZ5|niZxͫZ7S˭u~c&޳;'f 6~)򹚩یiSej^9ڒy5rl Gkad[T2՜4!E3tRl>U6(mcK-@'<: 2]²H?.ZUz-:sPPw1z?\՝!J C&EVvS=q9zw^969r+ gyhA0k3mom ) -tO K]? |SdkKrwf+M>؛@ln?h?STt%+nݜ[2dq?[ǾmM?㣡 1>{,8No1_$ڿⴍra]~<52GJdh6_ǻt[C\7_}.,@B?^/LFT6ǵ$UQ#y )LiCtjP}qGX嬭k7rÕ,>AxU'ˢ۽ aio}Yޥ'>K u~]c7q9WZyCu8oڬ~>ظx_T|?TI\Â2E>xzl2[kO;I /a?־] i'OS55?~P$ZOqʿYdfEte?{{@$:Ga{{?+=Y:s3RTCsWS_=Lk҈Yl" FdNWr< 1fzq?a䩶VS x2ڸ:̴M;Ijɿņ1PɍșaDF3BeV2""4HY(+$)]*4ЬTcHի?_yhQe;d(e`${N֝a}2/YZ}wwtPnW S;{msyUZzhQ$)FC-h"mcɹ(7D(W(險dmCS),~&zx`,~C+4R;ՓOLڼTvbiH X5=8 Sԡi&r%Xn c[BZ[ʔ4**Y4kwξy.-u}(%w%6՟/-m%8Lk[! u x#ZUi Fg%= C,%^ĺ d8aΤSuX:cJfJ<׈B۴^תڦ{4A(RZ2HY\&X텏un j`nÌb6,tJɱZ*"kGlWyϲ,** ڷpݳycI_A lj53nl P݋RI?Γ>7=`)ț7S0 VH\T5s;+; _7[Z/y*?7zݕZj(hMGMKWRDŢ"z[z# QOɚ~߻12MT+C Pbd-gDxU즸QP/+SKߛwkk[ g}P[GgXCi\0Phڼvڏpnø`¥-4`X Iy$Ij_oz;w]EvSy>ڻgqN)۫x筪E g %`G@y}6,R#*q!z~=ve-Ŕ#*)3vTvjbKȎlM/~on7S޹jU.JB,8l%e+5=E9PO&&zPĔE-9Gz@6>›T(|3WA$]J dxݞZٹggoExQŷ:O+Y,5kՠlT UV̯dli^ɄmWFs'-<4N8Fgi%HхHWZ4gt8A$ . 0oHzAq:3]R& TZHŽGhap[`)m/~ӎۖ չv|P>*|5Oi- RQj*]]MLFdG"]H5iRhԙ4ক:Aj9+GުTl$Ծ)jH\@ip[!M& nnLF9aA[֝A"F9MsI>^)?Z&Z$4|&Dzyޮ䕣xc{YI!-"Sō+ tr&T5r5r3l%/&>$<^e,ljX~HڽZJ%jb5 Ri-j-eIFԠF"-LQ`uR$㩽G+(+Ut[v'+/6yUMdurT骣ztP"Oj(jSS%*&kYJz2VܘbG^6fT84%X=L,*U]*NA,W5iUGܳDUI?ܕmV^=M 4Voa.Rf+񎦢V-0/xy娩K҇fQ*IU('_ qʈQF$ 2-^$(Om#HkSxxD%FT&C k*S%WE'I; >po_y :]'i& lc g INPǛPdt* \!8j`:9চYf)/Q䨚PF41*ZF'#V P ]Ń*UTFfꎵud"nX0^4VQ/j !VoQl5FϹv" 9j̄RSô*ay*g'X& Tn'8cцRES'd8\e nbDf-%QЃEXZfՆmMѿ˵7TYܱa4:sm)qRRm*Eԣ'.>Q u-Eg(KSR2OPi0Cif F5iEHjQ5jX,AV3]Jή+LS<[s Tټ'ser{yi2Xʝ8;#nfX"lV19z?eSQ |>K ̵pOґS9iaWr@+OUmWb4HPEH Fui WI-RTHB$BH*WU*xfm>ꂏ7bb69vѦWudЍ=>^ZzA]SCᯧO=,C%'of}^M;D5RLtxq$ߓbl9_!7 4~ʞV~^wCᅻKˊSS=l]C|WA]O1os\A>Wٟa\vySZ ,S5,^!&XDo L4 _Z3Ux# zT Gͬt?PYI  }\W}Ò|4PiT(QԮBM'$[<^Xe~=SsύVlj&6'jM |fF j'Y4pTS!K{ iU+LԚ HArOF!i 2|0AoIR5zfug97ߩ1v&hd Ys!\*7g"bqTfWfcF jZ-L1)*⽂{(rkkbV WH"E@fWmZf_֚ZI? ˢ8ny{sk!"0ڪ|s\I%4)i!ps;ѹ\ΛwVӓmM4s8vaV:1.3 (b YY"kBI+23dm:F`hvaB6a+iR5le,['?dh;pWx䨖6co4Cwb?ǁ;(%_>H:$3,%)XcӼ~ꛮ+[\`7vՐ0`FA }uEi%f,SJ>]'K7ccmu=/=[OsCw Mpx ^j\PT+jp xSdٓ;>;ec0һ%2Bw||Y&<,pESNg 9gϜ.[!otrh*AcIZɤF<z6DyH@l(IZ ydvlv3p7(7&>bvf<ح[궦V!hQ26uK;^cf䢧WʻC]='IꋊQaRVTٍbm/*3 FttZ;Ar Qj)ROPd8[+~58NTu?ۇd{caњ<ng`(~A*T%]F1U9zZE17$" OUeTscn*n.rH"T'A(l."-.db 9^MWVlw'wr0YTg,8y6tcb| Wvf6f hQςo..w.)oSGifjgu[VJulvC W A)h ,NFG.T}MlLJju #}6۞طPFT +d(W OF6חVR S?a|zϾw'kb3sSw\~Oާ|mOToO3AOSG O=G ygByt̙ crfC] m׸74T,dOYxx-~r6!6Fbh4+ʝJݣ R5mF8TjwSI3S^믘l lݣ;fY:CwM6s>KnԬll:x\pz>?JJH l>-ll "q@*ʉ* E {#xABaL bI[whDܡSdHWQ#"ؿ,R-;b>3D?pdmr`82aw~>Ꮾ|EVb2[v1smR N>G RgՌ!bA' (%{"s7.cdVP$w= ¶?v4{EK"D"bymT? M[OU4_$w"U0U_eeZ9$ct GSWpc59 F] CkVz]pMO.ɕYw1vvR 44HVi|SU&HΎ ~Vҽڵx̮;񛧬~CAoGhާ% !4ـ If (TAJM@)@Mzed>7H\9u 1~eB[]Jrɾ*rid#. 5lc#FLW=XS ̖@?t:%wo$;m?Vo-Tbp_j'FK QGRY# ._iSQ 8C }_. Q,ɤw>&`2GmK,c'l1yn"h2x&۰dc8`Rc3<*<Xu?Lew-11OIEWz2Baoq VKY뒥 51KɠC7fB"eS\[&Ajhz-m {YY念t#~2 PiAOCQLtWzʽu{?gmxq`cir8VzJ&eYUKzL^?MG976mrl՚E8JL5}BZZTK"mdh…jJ;JNp\b13s7 K˷giK9fjL`ZvTCݙѼ^ ;w3~}v9MO׽G,bln0ԝRJbX7MjT9Yڛ-hn"r.JXYҶС ʩFe;%̗ u(g)*5:$aHXP@K 1p_׽]o*N{=YYK.dKܢDxIwFɌ٫r݀REݽSvJ$/(:ښJhT<f@Abי4`%ұatxcJi袩04}Nƈt-JS.SnX?-IS:b'twv;Kbd$z|{ zx|)2 n.}5? 5WOqh1}-eq 1%(8N/2UK,qK>CH饌i W e#S>6[sb{#޽}^[Zq[77FQOEdX㥯g32j0{Uc8G{8wEE-2Yy"bfra魭bG{:#4*5**::b uRDܝK뼻+{Ήٕ}e7mM.;'7כdeYi&($νdMGVa.j:L]cBAFGtcEg}:/QDІbRyN{I0[4v 5 Ze]{je"娰8~Azto5v[#Sv@G}خ\n+:>կ*^> m I)~_Luwm׸6fF8Rc(:`0:TX_v;vYc-cSL5iU=Hw~c˗ۇ0;#Cn]P=EeAë;+.ظJ، %ZP7FLtx,KEL RIL^XqCN׺4uz5=k?>QrϢm? wO1zvP.{Y=[#~/*>_m~=&*T}-2*i$1Z[?6/GbP/k[,jC],>mG"Pzp1ӥVjoKEUn uH#uZ矯ʉ@RߋGxFUQYN~Tkݵ \#SE /RA{^%Ll~ SYau箊X}/)"xvٱO]<˄]B-1k@Y>i_&* ~րOSB}rNh3d ??Jg C. dvՖYhn#*xi@T3.y颃Z k8: kFz~\gg""}{lmd%^쩅:&"6L ]ZZ::yaX1䎢*&< gKM I#ʦ& _QH VRzKqW wlj'$RSQ1⿂aPGZ+jǙ)JW1:k!Ioc7㉋I *L"2,̦P P^9bh4SU]尥za5u?a=D0CRtc *iQ%I ʪ Xc 1X0vHcB$Uj4TTԺW! pTRTPG O`'d$#IJfGp&gcPpO†$V"@9?~^myv l"zފk`lEy2:|ej(%.+i2 Jt$G|bRIlOFLnHkaM+5t)PYbYP7PHRJh]!4.m !hI, JUY"`J䑂@*(*Ȗ"'= ]U.ֆoT)\5 bQZ:J<#nR˃%,UkYTC<:j( YGcK=i0Rc$ᤔ%$jIB=U hOǦ5bh~.I ho 隳T\>ܔP%TU:I砂)iPWa ΏرFb*z,hԕQ1٣I; ϕd%[ݍOؤ2*Z"# NE8bfSMQ$3۴ J/*%8YX/r*S,IQ* -u):^bϐ#6G;򆶊*R!#宒zYhbyd+vUc*3,)ı5{VmBİ ZʡSG,4HdAO YVG!UU>%+VurUXdE0O`ӥ@h:bYck??O@ރF^f3bry<O})4ԃ+3^ij,mK>>I5Du?4nhd|ˢa RDr=i-tiSV5t(kI9PyEG=+jj}ÐHpY*Lgfל,<$4յYJv!xIjzcrVYD85DL$rII$:tx7 Nw3TQQRHuRC17`)'I֕#)Z-ӕ⥯L>>**[ed2SGA<^fJ--J`VB1!4)dc&#]egLpT$&b(UCaEp@¢$ZQya>%*mMvq$IDMjiM92X4Ւ2Xim}JNVC^@ ZJ62_ 2UEDsVuNG'E^V !5״ dVV^=8|ɯ=OF)ipbx%dtqX3ONTzS@Ѻ$~,M4}O[Y_}E]e6ܥvEV壉Jy徧nE^ɮ–OJZ3 vL25RD QѲdaCS 1ԊYd_˨jC4G,kk6?ӭl-8ۣ9[/t3$JjG>͞?޺+D9kFy}ɑq-ԔHvB2rx~Tboppz7O76[ЧҠ}?U6]<ԟt~/?4TaMEfnY~~cm O+qoӑǿ-Zyu& @6'kkiYi[YbGM ?'jXt?׿z+ǧ: }>KgpmF />2ꏡ cͯ?A{G2n?Υ=T*!^ s/CBsq{TN# E}:1㟩ڪ5Qɷ='y+A{~ma{CHӧ^گ￯Pj[_QWկ-.g- te(挐2Oz-GVD??o]Bf-I3玷wUSR35E&X~nMr5k^V%.F֥.K -4BIUY~$fM0l$ JT8H>\ghm rWAQ3GS_V&$͊3HpmpBF ƒ=-5AQPE rGEsp xFhk+)I Lt"Y5'_#}e N`(<kGj2I#R]Vo|p[K^8L$񿆪R hOq7ؙǬb1ABHԀJx'$q7;᲎y b=DHks\JdĪݫ^:cV>N>ޠ[5\`2T$pcx(xٹv(4"|Ȥ 8ᔒOK _!*# i}=.wS2ڦ5F(Aq @C̈qm_oUwOl]n,;ڨҍo#K}I#M^_':e.Y@~, Ǩ܋ s v6'ZҞy=.6i? gAMh2Xi䨏VHZABj؁߫cmX=‡"GComx CWyn(7t?V:zШ]_?u:^O?(j9]G~_b"GHhCLl9?^E{(2q*LC܂y]=_ӡ],:]\k"~AZ(aV5̀ѝpV$ZbkK O,MȋeI97oZ^?|яmWKKi K@* _kdBH3U$p~I?WkwwVb^oE`x}m'(O8tP~a"D] ~~΃HIƝ'ÓGީE-8yX~_vNv / ?/׺?tgknMm]}ɝ PUe2JفPc啍!HӺs@8zKe˹nS$)y$*bNM EO(<$P O$9 $ap?RmuncqY3?{YR< D J}͒K-Iֆ@ta!楸օhN?tV{ֳ^H cO\w].~G_zߍݩ<*[\;9+|_ rA_I# l;&) }e5&25]=6н44p,i05$ΥLQ]gHX uhG#sew 7Աftv,NT1BuMgO4I[njmoNtr嘆ɸ*:j ^"M%}] VKKX!WbqE 5KICIES&Zy+aYw7@RVZI9|vSV7orVT,цHp|wPj03u̶;#f2Q|m}guᡦm87ojU`(lOıUTG(.QG4LNc>zq-P")5LK J$s#;xDk ♧ЈuF _J(6`"jM4G% h9:_.n'bl-&0ek9ݯSԘpWRSKx⧧H2MWQ'H_4*GQWChZ8dd_fNppм5K!4ZֵMe% Yk_ BR)y`@S\-bce\McA*wfU]]6_7;luUu:`Sh*0SӴt6bux^\mV+) >QQ)UXiq&/S؍Mfѭ`{x8ъ GXqYI }+m3;55ò~2I%wMzv+/agcd;5OC_Y_K]"3u5&KO.'ze:KDs:fRehk+ꩧOW=]dt4+*_dRYtd2Urx-ӂX(M [hdp:EMLdcB(|(ice)(14gmem=Xۂ7U\Se7dRb畦HG?EM]= )^I֜Sbh)&x^iHR#̀{R Vr5 )B C$kfQTQ)#+3gh1 >"'S{gyf0xa7w%Avا2>-Dh'wzk*ZR9 *2YeZY+(rUO *SAEj/J xZЩ( AU>~_ {f"Y*i*YtARK!/I{qW{'m)yM]E ԙ0uꖥi{JP i^9J'wRVJHM.M!L*5R x 5_P@TղV#K8xA 2}]UM՘w.SfQdbVT_l &3 s{vH&+EV-uYQ3; .a妎YhqSYS]5Z J:!Uͭ;Jt"@rqӷ ,b!FEY *H8 Ͳ ]mo%6;0W`v!R&6uVŠcT?{QK,uAtbKQ/eT1 sJLnFc[iN! 2 YQSۅ/e+HNPZuPVLy}9`3sSr0.?vmӍ[Sriz+[9nڅ LV,_MhՏFm]v6<~[#q0f+ 72v>sQCX2~:⦖vb}Ņ/#WdU  LI9I*$,мʨΫ^Y2`PRD I4AfBNPHTT1Zu&/evbmݜF2h<צrT#KR"(20-Lbd0퍩KS-UWSct8u|#MU<)e)*եĵpYveThIPMDw̷[w{孕$><@PB"TQΐ)v=&:oaS14olmo<_lTS`:x()N:'<$jOM}+UD*!zx*NƲ?hf7=׳E}+m80ĀU 5P!Ob@9` Z* cPtPn!&\GQMVܙm9g*|Q tLQFwk:D(Z"LfzS;4r馝OD&t[bե.n. U{Rۖ<Ǹʖ,1\F$Q5iO,8UrY>Cje>=O,N~tm׈lg)ȥcT=4U1y*J$G23hy)^RT,1ب`+ϐ%S@۸L3˹筧RЙh]䥉iY->Q1"5!5]v\1}^?UDeMAA b\ c_ iH&K8@ᶂ).m1UTǬ(]+ij-qJ__/C7Ozo- Aptb5~K,uqOJSUœQcz*)+%ULũ$h¢*3rH7by  :ڄָ|ĸ[n6*+V+'Ĥ.eovFKtffmL,^6Sz0{eOm)58W34@!oRgxc%H-nk2uq4VQ䦦lI_ar#Ƭ%(4 :5*+h Lщє8$^5'e鳘joe)h_ )2{_CY7P%0a7ΐ$B^|eN>u/ |}D,Zf)r3ަX+Hu)A=>8IQ4C kqѭm$[)/*; AjC ]A FڵgmarVݑ^,=uTxZfɝƢAŒM%4uU:|N\{{J 4uc$D&J|VKMۙ>ɔUUyDit5SF Vhժ kd}Ne5U$0+ݏ*Bz=-][jHo)+[p f <['ITt&xaYaev]gYiilV%zu")jk*qTQEVDi#^"a#pYŤ݃-5T&X]%mdLjuS^VZ+W{!@;h(dXR}~7Ae}uCQI\FPN$' -p]PJZ,Wd'E*duOS9eu6It#MT*#  (VAm!A5IK#Mn8 1*5I]M̶d]fKq4S/cNoO[m>jy.8LT41oq6b֫ZM K"Q▢"4a,b_RhiG RA:VMTJ>\r@TFϝEWL^/q; +Lp=Ɠ)Rm!3QǬn! L8*]g>WmEA!ys_ʤΔEI:[۲ E2,N#rXQ,R)EkFyCNJ6) !F6ԍTWu6;ig_j&M}$B;3i&M+Ŭ-}/A%ĴW}fH*Qc$bmbo+ͭeWYbi2OJ2!1>SaR&ǩ ?Ԕq'?t6${i:ޟzA,(Wz?[=" h Jyo#yngȵO\#RlPH7 Hʴ꾐xl}PY[\\l@{FE|)c` nei??9f*A?Q;ꋋvVOϰzs8hZIO.4W+^AYsPIC'.7~]+&q @Qr@Zfm+IjP(Kv]*ms7we1vS۞[uòGpKԾau8HVv}F퍵olLx|N'5LVBtY܎ z83QE&_];({%C; !jT+Yes2 r)f.( N潽;{u峑msswc* :\]^1Ic?JLeeL_&~ZrSx|wI3wlÆ&׮عj\+dA\ipTPQOsKKmz< Q&T0tQ&5zL`H x7馭k F+jѩIc3se%62MLRR2y!tR![;T|I&Ѣ=vd{'ZZF3JM4l Pڸ* @ҀӉHU8gYZ7{p4d cM!WںSaGJffmV??b*eIrK[ p d"$`C3+ޛ~Z\ܽGfLO\n{I$8) H0-bC!m:Ԩ<^ F$c BK>hJfB0~hʜ`7ivzzI[kp;) cp檢o݋"lfCC')ɤr&:gu;?i>pjITI*~~L`q@Z-V-9jj;F 44 (t]LգdH­:[Xꖻa|grlβ>Qظi!1sc2[xnkǁc Gʋm'iOgOw-o_*ҥ^i(eњ)4 eCX;UWDҵ%jԮ,YE4H!`џ94F`x6E|O^=_Ul3wgfIֱSnEnPn3)KY1Yjd-<,hJ0tۚ!COMBgz䚚O `4Fr \qoԒFjA!\R3$@%p[v䍃|<+{t/hVSPkZp:߭z˶r5״~:gatNݕ{b |EO5x%R#TճE\i!rOe'ݷ 9ivbi)q OIh$+G!yE߭mmw P14"7Zq)jfZɋmyr*<6 i_$$瞎~}߼ߠ/9wv߰n GTgvjٻ/nEO}O3sc8楤 ZJ{8cI/#/xpN. ~Csaj[V#'cJidh<Y)I3ꝶNkaK]ʮ]Rh(R{`)\[+G'X~Üc?>K{u~NJ-W[yTT1=eq͜o]ǹaRfj!]VtI^I6&:fGO[㩷>O FzIIUN|)o2{zIa'`T#APX=vzID"?[U=+,:IpxWɶkCK=7\a{EUrfٔʩ;g;õ;m}6[t=fmLiGoTmv5)u'YlP(͝g}R h1֭e>6 ,&?;f X~WvmrRcUck0Am~lx*|rTi4̱7W'&ĒؽwIQa7& 6욙*"$4^yV' i7DG1b vD(Q5"Ye:ؐj4HF4](/ҝԽ=wFڛsaw쾜=nT`t؃%:I5J"$))0[kpSM=ՉMٸϋe*yەUfcL A H[ Kŵ$&2K xU#$+RtӣkMv>-UO:Ge{w:0wY]EM1}vXo Cn=VyX8^:)^djveZgz}0=Ǎ)=rԕlySU(P¥dR~*l&1M?*M+AZ synmḨ@B&(hMJ">>M!{ g\7U橢6ۢ }_E^MWwf()><+sm3ߛflm[/g3YZsOwjy$mQّM\,smҡ*T ]#Pxc#Gr.c@4Cjjn)f(3hQR ݝUTym6)15P$,0^%c++ /2UT1W.ɕc"9zQ~P7:$o0rY#L8d$aZOC/l60Frڕu2( >s8vcCW7NgvcvGRulN흁F|oneFBRfq#7Ӌq{{x$NsےWbӨ.#p?Ȱ"Sq"ēo6YW_ Z7``n~K>"/L2;lm"Z9kҿN9>j>2+yf5vOR$p jy7qP۩IT=&& wudB8%X߂-ϻP{;mj_=/8w];=G|?F},-rAozFKOZHeyAEHL.H#%P_M$P{=&S-M4?5{z2MaokcPcVkP{|OvȨ'E9QJb妎iIe#Al}~gޣD%:$u_u"%dc),-"aJ+NjϏZ643Zl.OW5Q!0i`]'!Tu7{<(YHCX⅑n%i*XR@;Qڌnu&?" tj)T,K %[3嚫$#MAGSP~*zj+ZG e\lxfA@HU,OJ :g*%زuXj4{6SR5X)|EES%<+S5FSmn$I*d&h몧:e2ynRHʀZ+t*5*&АuiV $*tsqe ࠩǧzMד1وqZJ4m[.Z-P+r~H!c iY&-=9 4έ⎢&0j ҇)XZ҆??ˡoWe1"ZD,&V,L~;Z E3?Iٙ,Ti!qciVޞD%ZSJZ1 >'2*T #:RaETF;4n Ok9ĚӈŒdvQWK)l%N)b6ޣSH-[Y5mVJaRʉ6F[]1MMS_ÅB LhRbJ=K "T5rK$BJ c@w8zӉ%1%l1%i1UesW>S0sqښqcHj4aSTC=$9|2c'D/$C")$ ݎ!&y9!gU1ұӰ74[=\ BC,ۥ#ʬiw Qfacd[kM=rakQ9X`3k)#Hʠ]bWh/P* ? kg'EnعpSAB Ñ]߈g|e++0蕴5KziRe$C9$Ab 0D4Sz DjFQ]:W  5I*+APARǏW2|<ރ\c;w2[9T pS[f#iQz?izύ[1*IUTAL*Q!KyIuDe 5e - $вbi!jjS(NI"<1P:OTY%->?pgco\h1{yJdJQY{KKLLjj`|>CVSU!@",4AJ ԅ:YhZT,1+A^O„ + A'5jX-lW$ 4%|_USa`a:\"nc)S+WǓz6C!TZOƇa0E4T!> o+* ")TFG;CWS-[`ŌzJT9Jp=V2d`h@CP(@SF`n54,]cLlPdsreeRH(9 .al?-Fg<,d걱 T:jRc&SZ5%e/d=[t0[ 0̺#0=ќn*e*| {nk8}TIJPe&I_O#H;;4͏1OJdHhr`E{E7ԟiOur$,A[,%V"/kЃ_@8?6ﵒԛZL8О9?ۀЂBblufMXanGmm{9ߘ+6zh"rZqԑ=Q,Aa{0;*wuTxn NTǀ9<uV fQ̀mT+pA{pn=7$#t=bn miQP ̀aǽG>eZ>ۧŲ ؏55}:QzΕ@ons-5),V$=J0~QI7=ϒ( sp 'GѾ5懺G~./SVG] ~Fi'{݉ޒ('~,-}6ӇN),8W^Knmn?>ݮ~^=M+tQ9֣>n<ZX8*zW(ꉧ}@!+%()F_]C24K~cxj5F@?^(B4A-~ jV~uH,-Wq>Yb~Uud*Jߋ/qb+(qHtM kn$~= LEkyWʾE۞ѳ6Aao+ ][|94! ~^Dn3M CST1RƔ_׽_ğ7]VEJJѫ8cfXH*n?s`.>>`,h$ML(G ΣS'o}` |]U#F[5 U؞7VU2΅QV_{Dc2gCa;F3*|6FFR9; ^ woK<|>4T8:yO5ΕG4jVϧ zcHVM2[ck3Oy 楤fJk!8Ɵp ~.LO9KOVMAe+񐤲jb|V{bh•8"?gR5g`cX**pȁXwKrS5TUXɤJLjrO`gڊAߟk39-e4H(&EuO\}-*]ưM'smTdSi)35x4i :z}#mgRYn4f?({gb vz\vҨlqR2tӭT$$mZF;N}+n0ReE+s٣Ӵַ&w~n IKCǸ%S&dx$P$Qc$T];']Y9c plRp{hxhsTIK^Z0oz M&EE^*JCYQ'&O8֑ۺ[ymv9Owi}?{)atuƙH aDWN8Ghiook0IrE_7? LKvXG?t2y#d+VC?QǟaT/B9jgbE.o|i{gjЬo>N_H#_X{E#Xݡ}&3)1@eIϵ rm)yӑEȅ5Y*~ncu`G(*z,`<{gDJ`8m쵭$@юWϧ`h^.UVZ9ۻRfh[k:q[kvH;Gu:=~ K;c+u_}Vbspۏ|xۗZRuɲn'7NI 6]hv|uoꯎy6V1km8L-b4P&L㒺$rL6eE; I,U㯪z܇iTn/TUX)Ǒ>RxfXBGUJ aڢ%,|m/IEjZ^i!Yug\FV ($*T ITV-U*M%ٔG$j$6d%\"z36d53}v^Bwnnގy\䤥Gt5m3jofr))(Y**qT25tj:0Wf2u5THM1Rw,ȟPIUQD$*r@%\V!k/Zi@CNQʕZP)f-;3+_G6bwf!}( d=$6D>i)AU#ɢ76&5h4RO+ mEPs񪲫; 4QD\> :Ȩ@]IFWpX)%L(`5!eWkؒxEYi&v,[cUe=e0Hz`񒧞"2%hMUt Yzn9ecfS!QHwhXhuU:[.@iXE^J d?QfunO[Q=d ӒJ&_!:/`c*/l3J:@i%RԖ/GƖ$šz sNvp]‘O%TI kZGM(\oCđ(TNTCJ`ͻScArTb,U-kY]UW_xn IO*b\+ʴS,usjdS$RE=HWN8^0cI2*h-AQmbdWv.~C ;k`m41w⤇$\smI+fo.z7&"rqCUU ⫨y)*)҆ kJU#4IQWRdr"ؐSG` $驦=0&̼$NC (` B\M =*\n|ns&}zǮ66}x\)[|-,PӎE:J5P$to4LC$PO! 6;H4@w#Pj Ș>o$@ 9]^Bڑ)bji6 vmvqJZͻW;Z{;?>.L;PcdI$*SBE" EO3Jj!6Vx*21xhJ4r{q**TkPXՁj `Σ}f)Hh~"8<l&ۅi3]W\.tܸX.NxKWnH: t̳&9QebJU%ڢlv +ߝ$BZD&FPTT0iKHm8 l6V/Zadޛ~TPedݛoMEW>C$ɍBH6mѶߥkk/bhrI-M$1YZ%L{vz&]cZjJ hMeL0UhJw1DʬA$(b@ŃֹUZR>zk({cvorr^j.`4[ Im+#KVÍ45:Ά`l{'G1&R-|˵248ш"Ge$& Fnv*(JH,uydgq(Q^Ib|Qc\RZMI0!Z^QBc&;;v[$ԑ3B+@Ynl|+%c7g|67C'.޻RCA^,4 MJ*hزkY 5^IQ90EAH VE7FZNY :5V5-)Z$<@9qPVF\ju)\' 7{Ewn4!*s{{#wv #i'yi*|F$UJb"ړE@Y#|7 Jn!Њi2*˪I: ":1A5f€RN @E~g'6ܴl2X~#=h(1JZ*]4}VzffXSPѠif@`^,bAB@G@n. j-$xxO jT3Cj(MFHw'hb+m;sp& q}窶i%|./3I(̚t GQj!Xaub,G^_4:piʁχ]oaWB`$o K?-_f;vϷ3e+*\5 T#S1-=hJIIM$, = u} ]]$H]suBJS_oF9 0*Z{,,$ {KGSCp-?A/_K.,s`x:U{l?ji=fШ~`..Equk F~F>mlyZR=pymz?=ŚdX6zj@&OErhқN9U;Fo[`} 2 W')tYq0tAz#<.'ꠕb-F&sC[qZXX},-'}-bul~fÀ.9o{$S!oe[Ms]?$ekW}?ۀoB-??b_R?o(n-g:^SIvRZq95*)6Bht$XEMLv0rx B$FRxtU /@ẂR5.A*()i+RJMĴI"J320m6`TlslU}u6;Y{IJ[ԙQII T`ҹ5MFJ9-&!H@+kˋoַF)U%qO UAbj/T<gzg1;BmÍ ~O##-<3cFzz\f;`%Z,5V$-.'p-EE%du$llW:%hEփU@4i^~kXϐ}f*ԛ=~=${)w55]HO,(}eut}Ӳw\M>*%bگ\&[=$5[g |MG;y":2Y}ƳXP좄2$¹ HYarxZZ+M)_>\gy9ǭTܶWsr,}4{ T+HR K4Hex7=˸hI^Mlt;{\H>▪ZZhc8Q3"HJ  [!M\ꩯ;MܤbGFOO֬OxVhMͻVvJ}ҿ%T?×!AUES%qWD(gU`el>i1{K8r v7OjG&7qQQȱ2[Ze;߹I5UPa괥OBI%m!2[f<=2qLuPݿ|q7 ݷ2RF3tumZlh Sx3X -vۢս^s_ĺo'ask0dTj-xi՛O#*H֔Ei|R +M4L.:r=yՀ5ja6]sjρdVA.;%7žOs&/jZhXn۶:B?x}[tY 1ĸ)9w PE ]Cpgx1Ӏ8)z1M~(I?mD|ՀuWWnl}>^/,[cv3vV[}^kϖ1[֟7JxfMJfČnv]6ڨnLUDOSmZLT,]hAHimc#mcW4+MTԧ $N˝;x+ RPZ'W$ d34;1؜?;NlvAzmfVQE3N4r(h-;{~d$q:ɊɌicDU|ȓG+9ϗ.H8~~5ZaIJ0@ۺٖG^SNA%9<:p++g.9ѐgw[IWzݹLdzS+OL)&TFA!p8}]))q8덩6HBz'3>^r 6{b Z]ߧ,w0Df:=*D] :)MWGڟ$6 )"i;;nLAϴ(7-&Q%EHC諙3Đ$ /cvT'1(yb6vYnW'$%+2=-^f VriaBE7@Cp4P @Õ9ʤH,* ej1JA=Q :o;񋷡|.3l՚}50nLNkN[]bG 'q)hrmOMGruNVCSWNvt9W,TdM m6})0hCP;OP)yhƓ5 Y9V#C6csbb{9G.ٙx+k &Lcf7wyy#RxF##;`UUWrSQSh|:KIycaBO!nK" + !&c#RV!yDzX'HEY* ;z?6*va^ߢd٬`nH!Ypb2sJN]^yNd5{JIRj1Δ] lQB=ij8cZ3 #:ZgL<e}q$Zʸ=`|{8~{/e|~ĜnONƋmg; `*1ٲK<<<2: bzo 5LŽ)2u]uE.S+҅BPͦ*?݅Ų~, `RFDGk5d:hœ yo;w><.>0%2x~ܹhZ1Y1_w&ȽDXjceGt>jh 8iP}|$Xvﭙ#Tw,I(Y }r ZBqbW5s`ewf.XFŚݩ%rj}I6bpjf杧\|wOif-u.ɊMO;EO,,#2iii$J\FpW:‰D \З i PҘRț!"$= 3yizp$.Po>oN;oIo7Vy-T^/ffZ鋧C+#ಙenK/Gۘ~BeݾMTe* cs\GC+d ty(*xGJWƆTT5 ZVp65pfF]T5AFh2}}7WBrM$)һ{Swk҃rZ w^{#T=å{nTdV;vc&B^4Sb#Hf_Hb*#[5TUa )>;iyes6Fyf3SΕ8h(1#Vi Z]DhTA" J[3MG6 UCNhcRo7Oۯ%KnO 5[>|{өdb.%5OVb,f0 I+R.ʕ;5AnVD~xEܟ-mӵԻS/"ǹԘ7Qcjbskɿv1#G紥NrZ!ƾ>جUU᪛o?IF[#OINWcR0K*#zQH=ԤBWʤ-i@@5:1yIP(Y0꺪>١T)gob=)$=,pG$e0+AO,#Dդ^1/쥝ݑ|H*O^ *PPP%vR/2-Ul"AJ,DT:" NFRCSbBQҡc|]1Wu"梓jl.iɹ &l~ҤƜ2:$D|֧_JK>uqTMDаXڱ12%xي_ARɉLM>FQA (r#[b5Oezr*PE\ePčNpԢ яHr{(iTA/m!Oc|]lm;C1>F ~0eA &RK=!vQKkQe$ +jyLX{H=]*k9a.I,(GJ̼; ih4Vt=]0qP팕^LH7W|3x*Z9ǵaR_!1@ŗWNm%%2F$xt%$J8Ć 6UمJ\A +(4:X ӕ8š!V_θ{e1xi<= 4_OY8̄S|[Ic1Ĕ#!-GGM& EZX )UYI9J%WN4ƴ!jRK_i&VEM*rBq4!ImTz2.'_̼nIٻÛ ZT0^`FFDuiR4Uqk"CTfDN %- f.Ӥ )ԍ=([/퀩e PZ(:5̒dVL6Ȣk()&5/_86ӡd"NTbqY'EbK>Sְ9 uR䳵GKZHեPxURŮ XxlĀU\U#a hi<@ē(z148kT 6:$b͎ ֵ5%dx|UG$Y#!5ZL6@T՘FJFXzg_9:GO)v`4JS%TbQ3@Tp> A T˜cWo)ƲɑWE4QQclcŋG"^j0ssR⭞I`cuR%,Jˠ'!IwOk-Ǥ*5S@8N(k@zn[4OT*6N3sPcU4+s?7f` Z3H 2jzf5u$S,VZjR'w(e J~ _jm|6ΌiƖ5Od49@h$p:HtfZ|v*͈-rXhhe:]QOTW/5kd{Rw<ӒK[QJS#V>O#-mF=g }ȓRԥ$ M4/lK%bE Cfꮢ*~!ЦՒh1 y 8c to޽cgWм5'C_멓k˖Lf J+F CE9I\ff2īO,5*fI $s4RU FO6a#>ď U @Bih(=[ j+JuG IiW>)bV&*Da41κ%4hY Y#TDYHu1"Q SH:$>COyHU=\?N麪$ZTg ^Q%,xQ%d(bXdq4ZO jj):-EkCMCtmɭ|F81&Gi#%JY'cmφNz|[emm<ٌdTrsTDc>ZpVqux <2@VB W(h TTnGI<1AEG WQ栖n#pa)2U۹,xMrG |+|V#ky1i٩ӘmD5fX# iX]륙:A"ݥFmtpV:'OW"-O*Y#Ěl2KQ=6DC1c1@E%RG9YV'CPxs*aO")`ΈUHWPҢ  M ,(B\֠Ƙ d67ە;K37Sd3{UM6O؍|Pd"lnB!QJ;S33x`SMA <TRe!uO,1-$Azt%3FԒ(R4rJhz3FPV&%5>9V,<4[zFqF\+)rjQTj62$R7˹F*fƚ&s*G'$T|3 pm]<iiYߐoyM_=6%o)?&6ĀJq ןMDXom>w32p~k\pm H@4Nm,`뵸"ֹ i*$Y'?W}H*zXrb^~%y\[>ڊi$>::|'eMG#cr1$?s>Oռ7OAW<{{6\.ӎoȜƵ PuWzU7lO?-i$msڇ_^8+z?Zޯr8H+XH\}Fh;uyTGXĆo/ }lכB#YR>#Y? arb m7YfqsiҿO/zuO{ׯ45RKΑLTSF*h +`$&[/s7)?Ղaj-GƃHϐzؑ*PәaaXkƢ.?ױM>7hqN,q>6BINsyOܙR;5 \>Tgh+*<\So&B8jG t`0iŐ؊y4nPKՁ1n'smj }4eΑ@x]C,apu 7/AHcG*UVxZgNdCroj$bʿ,k.&xZur=9EG2 Zig Z]~@43,KLdCı1gW5cw 3TK9ҲX}EgpV=HpLb*4x̴vӤa7yVEZBcJX$ zc!:›r7 y)4#(?اDW+v?K OaIc^'H$/sm{le^yW6{h麺?A=??,"Q?#*enEu6QoB{/ odnߐ0Y;?d%|[lKqaR^V23C$$zJ(v-CƝAiwq9l-SV]jF PӡFYHPB>GQQ>4HGSS`,>(Q$gfYn2G8y`$'f7߹%6'R* Kj1 CԨ9>N=WY?a9]˒+^)ʿH1h11Pcj(j۔yxi)٠Ʃ P{_@Up\x\~-tQWQ4whav*1 CC0#RI4֣gOFuf9/υ'yl~͂:Z` /-NgG[[Geh類Z&6j7x^)?x<Xb̗,XYʶ,1UJ5 É3GRQ"Pi ZjX$,KyZb.KBXP]YԌjF(Y#>crеlKm ٻv_be-n)aCKޝ&0<+D,%^|&^h36I bqeHg'|e#JZgxI$"R\T,KnZJjŸzp=UDB5I!!I8@ITQVKS>:M?<[ uUQ7IGWUTcKF덋)D4Q- 8*Jvc⥞7zʒB]*an\rZ:X hEM@Ԁin'tB4cY*).)\P< OH;1`FnKW؝Y϶VVfQ D(KZBR2UuRLPE?Fj&FĀKYT$h4Hu b[HH*đJq2f-#ƦU'^x8e42F jGMmCv =E&a2 {w |U8\f%PBoE)(**#qRP_"*"y"gX ع.5bH4Z5VIEt!cR-hTO͞\ơͶ7mv6 CCݽ*+w^+snpTX\C?3GE,(;Gq,+RNQӉ4*ӏzEL1e#+G?,dDPYEvu'[ )jԨ`E ֌tEB[F:U !`)TPh=zVt0[/E:!J %tٕ ųr3Yc,,!Zɘ?&Gj5gdy BUy N7;;$&Lm{~FgnZēUWz|e<_y R(ɋ%WH΋4 ( vVf@F<-ICRu$l9=TׅOܙ=4Yhy z(Nةu3ar]Uv񂕗vusZDtEOLVW< ")Iv 7^8TҙOӶOmp 2k1@X|5 Rruk?78 w#hgfev h2DGPGlq ':Fe!5CEJ`c,iӖ˰ ú5f+ "0N#G&!qR~͍?cOGu:iVT[vW}^}v\djqaA^M砡iTv6+PՁ$tHF>ޅI-3-RC9e{wT'cqR>l28D8S?oqU]Qc{eqhj#D &n}J}jctJ/vWظuLxꊄy< lelL6`Hs}(e r<@$VM:3jIN/9{-3aJөj3 ӇZ 񻪋euW/γQG~cgԋbkq_56״ jh+_^P mNfP,5"*vٯE%TokQ2fm%=LH-)m(&@+* QT'2HZh; |9{k7Z}ӟ vm8tk ~[{fVqiGqfͶ+q||ZCXH <5>m`fh.{{ [}I*:e)3㪚BRS1i(B_XII* , . @SE)#\]+ߛ+c~oτjrQ˻~SUx vPgڹ^j>)K$v=2kryl>1lMÊEND !xhțYyڍc`UpI?PB`ߛgoXSHf1*@aHW~͓}VĮ֊THJ],hvD'6o;4=J` nRS)6ͷ76wO[]絨ؽ=AUKc{"gd T5ˇj*úps3 ǰ꟦zlKYn#/o/tY]<26jd7dS<$kaå5)sgWF,wUE) PrM^-yVbKEEhCFɯF# qqCllߒ2PP7s}8>lUDX=F:7*CȽO(Xc*%Z]Wm7\UK|gKQPԷ, {w ݮ*2Jdqel}Jەxԍ_}u2[kv]ػ&+C2KQ&6tk t JTK%4/ZyI2cbh"g XlCSaUpI#AW@}AP3 I%C(?L.i7ǯwU9.Z &b4E_A53u?wplmM${#jdj[ؒ18IT 3!M "Esi6_1^''[g ;sG헇;1^xR:( 6ܬ*yhe"?#e%QYݝiSk9-OIۛu@S Iz/*@ BZ荔2(K:i)h:%JH0a4 W f)i}_:UMEKX ۧ)}+x(eҞO%T|]e}V|ode\bmш饅kiI@d "U|fe ԓE *K$w""H~, h- ci7WgLl0K尓mI-LTYm, ը&7%<aq:Y/5u2ϗoMJe\L^[ Y $/,ոy"M"P :ʦD'RAm$ҀvX֝ h녕ht,zQNȭ:pvQa3山EI{_sw.7p4{ꖿ/-6vYRD%;䷴c^e7Iom#pQTd256ő4E5Q(%(0)55 HVԧH8t [!EUw$B)jK~G~V_믔=i{St.{kRQbvt5Ufzt1Ҿej*Zc8c` 0:~>WV*{*g缫Q6*DxF^ mnlu4Zhic'Oojj-tMoGrYJ?<4oṲ؈@#+>_'zunhו5T5n:p㨡!%Y8C;UkZh@_io]M>IRnIb ^ryg + "}{o?õH%$xGRTo@m)@ۿo2'#\$P $IV"N 1H6C"&;+xܛo))C$SG/u`/AFruԴϐAI}}FebB4p$s6{zCG$(e9ZUsI㚘P‡P2jSTuS6uOn]OZ>ڬb]=3btG 5UJ*ƩYatmH))pPu&sImFf綾N)SvEW&BTZC ,; 4q~3*aa= X:_q**?.qM8'rߖ_{Z'}z[W6HH-c$Z+:գ=J:2g[bzXw_GVm}wW\橡|r |lXM<$:őa EnlUJ뾰bk3mna34TNqD XcV+v{I Z*֬FOWUp$v=n&Xd/3F PډA=GRy=ڙu}ǔ+wlKp윢nUP k$3ϞSycQVwG޾mŗ[{ j|xv"5 ٢hyK<PP*Ƅ"&fQ_)EUEM2 Xf:ڢ0RHui*xta8\3i.w#!v\VFJL]K6e>xMM>̰$$\-OUEן3G9{3_#3Uc7[qJa]^(RReOo#D7W:SNjtb|pHI7>kUd|M'4da' A нdg]eqfM{3<2%M_qGhTtY jTU~7ghx)6S6$Gm5밁̟p,ʷ* [nmBF ҅E5 (\)J.]f *!,iE5fJfx7aOe6 ?zZ^G}ǖ}F}j}gӚ%|r$qd>s񑢢ryfQ:Go=,T&J*{µ2c%ROj9f5`0J8GI sӲX0 lJuYB?ŒV."[mו!T;;K=]$ ruG1H7b]Ұew[ 59=Ulf9cڕd " 2TeMgH Tf6SMh&7>MPA1~%ZC2S.銚T@퍨C!ir4Wi2x25pԆj)BIcɹ۩bW<}v&f|A.G+%^f _t" 5{$#vr:U4a@{kȱ*a*ՙbiC! 8Zj9p)2xlǖ()U2@8l,y*VTDSa#G-],|}*0x!zO i;I^#n+t&gNz?4vj_}?iPm/ͻkMŇrǼ.`P?y~d?t6m_@`&BxSs x#G%u݀#r-6qk ${(ʎNpŔGVzc?SeRɰn~#0.Jp=0X?_*"H'ުHe=TuQsq6]O.<\$G_i"Nnx>'H=o';m"Yx&,>W5犋->ch{}taI,yOo**;/< JdwvK!="Ft[Ѫҏ8h#cX0^!M"=GKjZN%z_il>];HWB3tQfjJ}6UWA|L5i7(^hji<3NY*os\١H ں ǎIаHcx"ȡ]|x3J##*h iS4$ /ORqEUU6ЩTFѡ0\>νVUTQ M}wRTȭ/M+"Rf K/ 4t9*ԆAV|TQy9%̂ҹS`U~=0ij0zp-Ny-w!K#GZ%ofulRRяtqQ?:=$} Hib) D+M,E.NASZ8I 8!{oMfYO 1( @j8huִ&ZE(Tq̎)S=uu%DIߒ`!$X)4|- Wc|EmAZ[=%])[3WUKj2Z'#-Q-U@PcfsH+Ⱦf&$դU 3lU(4 sCג0X sW9>]/6ϒE|j(xeơьvjZZy oI+r;b+#R],ƲOPdZi:*rN.:aHu5종RHO[T<A|ͱ gd:=U4txgVR xYYQ4naWgn u}&&l8^ mE9j,t3R p/k{їm}41 *,r׀+^-eۂO55<(П>]jقޟ9hۆ%_a[>:00 ^vC`d7n @fCmJ\fݵWcf 1 `n/,nˤ1:v(RYRIZC-HԵ<ROo#zTԴKnG}]_<]vnNy͗#(Zi#ۣZ}I-5Djb|TV`Z UbHb1U'tIڛ",L@ZknmAZä$RJ ]AS|4xxc=7>ݯӿfum]&{ ̹ 56n*ZVHkr1N/)*KO3h#Ӯ?#^i)C_+G3y.ޱ1$YcT6j&B 5If )z~G/ ! \0 u1)Яr*{pqSA5 ^;k)qRJcA PA&bx`Q(0X)bsP֚*Ll^દ0IBRHGƏWPy$g@5HBj4hHc[OJ]#r|4HJ9i0)Y1ƶfq1U]뒫4X#j]ƹ<UҠi2TQ+RT-$Uq*K3ro1ml)KxPxual5RdT4TJץlTWSQ|K5>rQn@fP D5 i6J?!ԙk%jz$xˬ*Z_.ͼ5!9zTbAiACЊ2DIKPd] 5Lt:hhDuEx("u<ƘUc$]+" Ƕg(jT`* 5{1- 0ȆXSAEvV!7tekhsN3O*bR^ٌE-,9@ժO@f$HPb 76$uCW,Յ"1Y!@UyPg?$3#67J*0~xi .qj+,/X#X皥Լ\#!*Π8w-EA v +`q:0j lm]8iUdih0m<ыj3WXِ*\KJڣZl[X.XEܿ`A$'ipJiLM=6+S+hA\(r; vu:F{ K@Rk"G6Bp=jpU5 ঋ#NECUBqUVre`iZ WT$2pϟQ2=,8y'xF.oGM:]֑PI`c%m,eP$x&y2*yTS"¸$h&b/u3[USOOÐ)B4CF}s_knX >3ob#pU9hSO,rQ_"u5t-ee%`d^Ih#$MDnvV6)4#Ve{ՀNM QWP4wUBN=L*D dpE|BzE$ia 8G$sTqkb$;  ,#[U4ZI3OuF,),ufJIGUFHv>f b:lj'骱T)˷)t4հG֒Jjj5"񢰗=.T2xkڵY^ĐVW1Fƣ,)ƿ#cfp[~ٜUEfo6z> \CVM[M+z39>SȪiM:fS9JHb&>|LЧrTUC "I"y5e *ːjRJ8@<+q= g9<)KjdJzL5~ eU.>L%TT@#3WJ%Xd(49)`%,6x""h#$KDf"dҏSh+X{GquF H{ ri Ց %A H醯nM$~Z-M 5v-EF;p8܄ ٫LP$t_CS1 u;8]Z*Lԓx悒$&UWQ5;K<<;@%HrH׬%bңVjVj@]u)!j+\9#V.{j3͕b;Nf1\<*hiWSJ'#jzt>[%"cu=,`2NC|uh̄#9 ĵC,! .0 f%QB越6bN kU(V2xǔ~/n`d&ݖ}l ;o!6FJYa cƪ|SMDQc⢧+s\t5)3d8|OǮ2\Tdxx1jH 0"J |5(V'3Ӱ㡮&y杘O[X ,cC<)Ro#*9ESڀWHWEZX %e]M4P M0`SގIYr3,jTX֓Di>D<#Z)`G5_[].DVzJZP6Үs2K F/eiCwEmq=`O?1|vÂ^x)iI Ko6A E oڏoeӏ}zlq}̃$pzv7xF8Ǻ ]'\Qg\_s _O\ْAi+ӑª;z깽@==:H?_Wz `$Sn~>j{ECdt"{['}s 6q{u[c&뢟K 9ct q#M܄tZKgEH6< 8ܑ&r~njYڂ˥W'_kUe Non4N~^-?xJ2r[ۅ;Ԩ?][^s~}(]?M#.-j'aFҠrmǽ!ooN~>}?ߏZy-M^]k??ooDuɖD4ScDJ\ZaǼ0VU6BOV8zNli6$0SYV(5DOF8˳z0OOS[)+R``3XWmQN ) t67"?RVM~_nS-sJ zVH~%ctr? [_2[s du~&06z(%bHR#K 9h&0a0VZׇr.l--Ȏ)R{bMG3*)F{2guU֟@)ٔ]OsC*8yMI}?2:RRąBHҟ!=vP^!uOM$Y*/?jӒو+J\|LϺ%z Z_W*#Kt ~,B}׸W&/kV QMT4ѾbHS%msdz}/85ZC򯧧miu-ߥ}|5P^׸Hb.x_^=a0u:hgig(M$6PJqWvqbAO_1ۦqč t?.ҭuU6HKiWZFƘQeQg۲_)EN$ZܖPvݐZF#Fv8O|2lnjRn:nٹ^ Y Y$P,4iMA4iN$4};7'cË- SS4)OHaOt-/r@m(N?mkcMS> I~)j*R9 [e!2ʮ/?S\.7cG=yir3% Rhu ^RhiP Ԯ2WDy3^%WMۉܙWS(sx"J=rGZza 0mLu`yefhkmCW"XG\֖˺χ&n[!=ioU.WǹsU0UJvڑzh*#i'Qn~uHsVL4no>:ǩ!tkT#O~mpH-l)'rǼ˻{3>) ݵq6}A mϜq4Fnz(Q5 $W^{ҙ<`crT%zIb}pҟt,8ndSISnKO_AS!atbSϲ(HuqH(ui*A%g齀 }8hgf{j/K.V,K]"׽RjiC@]k5X#Ftr,]e]Dj0,?waߨ%,zTu-Ntu¤zӥU%ʯu{h|$iz ;HuO^V}`[nzOXB{'ړ 龸@6brH޼?E%8yY|ot (#pv>AmSe|mܮܕmt퉰jqоP;T%]$JxU}Bnzy`t#m5p j"\̻M!]LTu+45=Oo7\ݍ\CrJ{)b0U 4u2imh2<51iV!Βa`X;XVVPʁ1$bTwowoM"a5n)*i?PiR2URH?ev&[l8Oܳ]RZCK[SZjwZލR3B&1U=D(Ҿ;1R9[.I 9t``'2H>rZ㴱}JN#VQb* k d:tZԵ|m1&k'Kq9pUIcUێVSa6咵Ux2Ţ3FKQ$ ?zJIPOLaRO!2IR J TN{?$HuA]F|%$E,֌R(Q @%C( c ;>WSqRVEx7^wR6m,ҤqM Ryb@JT4 $"WL$bs<0NQpPttqVI)iJ$B JJTL݇9 4o!:~aGnPa"$*E83ZiPn*˻+7Woj!1zԵ1~T/t jdKSeq\dII$:E5Ri)ʛ5{z}@et: Pdքf*Kqo,qKVWs]Oe$ 8;̞Zfp{]ӔDD2[xiTd:<6Y'&)` iE.-4rT4 zUU*D'fG3wm+m=Ē<QƷw(()N=E+Һ\Z9%r 1[MŸ7lFwVJaPb)I%H\HOE&n ƛ%EU xShuPʓ:ǏXFKǣH)@T5hWQH۫-V2KNHTє0*xPҽ4&xJm[wbHMù԰Wo 6nc^t)XT-Lr40A%GX|!55M7*̯(ݤRP*`V@@j‚uK$"Vb( &'[FI5cEE/Ygx^`l-Mokc>zH|QC79jYoPh>lF*y*D P-0Fh#I Y\.L!JUIJ`'a]3#G@IvU|7s-V3?ǚtG5rvfZq7%cR2L5>6/(Jv I# X[%Ng/k}RFbhj7(QmK;*.VdԚ`: QCGVmS2\ F`jngV5|Y[dz^؊㯃zqw.ϥZ2; jܮ12ƲռDh)Nh)Z_zZ׊'~7Tif RB Zt5U$jRH9IZP2g֋j(-(>DH4r[rx~x9&Mޛ=O|eVsXLNV)4>T)xJx̝HB2*B"{31kdnlسw G]TS1@ ?QV!HM`)JjZA AŨ:${nO ܘ~n&VѶ;E-tq⫩$WSɖHbZZy7w{$A(kHc#)y-!-D+4;Wv^s=ꙩp۫Sif%AvòT%~2'')dqcN[TRߔ*ݸ\t3:ӴRK{śMĶF-d18kň_@$a r>[Ϙ9 Mkr.V^8ˆXG]H]]ioV~{zjYkewU;{3y1ntȴ41@] ]rPAC_Q5gf9`Zz]JPWIb٣)CP3-4 c0лes"hI,1P¤VM.8mUIpLf|Wg$z'I̳**gQLLlܕ2IX~ФTENk]C#XΖR8N;}&4f֓]k#Uhj\ ~uPn 08,ZNSP˵ aZ:,ϺxQJEĎ~vXMUM+URbqHhK4 Ve Ry"~K±z~#U1P5^%+zo]"S'*Hi\~l&mu.w}Usm)hj2RWQZBq5܍2_$T'JV8NG#K!T;RK4B-23jpǎV=MA:Yu*281.Ί}fA!у{ދzZ/8zxaW_zԋxl Ҭésy &5W/(!G]+"xj,%*8Iդ8+usÈ٤1I*C:cRՏ@ffRjPtFY4WQBīxPPƻ]ٓպ~[mW+robUoDupe)մҚ﫞 F4K*JB߸'rfiTUtZ#8L"Hx5y[ZSkjh؀ =Z5PjSPOi˷%(Fj5pj O z1{?6U6\UM2|V3+̬f5SU[5,U]bM-T)gԉ~:QQgTjlD )&J iSlJF$<4Pi4"?j^9'ncXNjVµ٫^^d[Is|&7;C~UY$ܵRbAIIpJhe=!j%qs/AH,&ZtFZ{-+x~XP87$w7 }"O%Ge,|]LIj@)ҳ7ݛ Oɷ%x*ժvN :A+_fbvdR,u q3hԁees}M"XuWR,EEG$Ҫ e(ȫ B?R$ %:vVkKx:FfiQ1ՙQ#i0 i5owu*nF*05}WI><1Eh2[2*ȤL /jH()Zuj+!cx2kJH&cC ^U1+c8E >gfwjҨINrŒXJjT01\CS5s1g0S?sg>c1\G5[)b^IcKY"Q栨D Yo6/~#}dfqX <~Uw;N.H)Džm+:{ 2x= ilx̎YEIyjH+ܳQ4HHt|EE0AapP}?dgc(}.C* 50jW^]_fӫɩҥjI#>HV}cw_tPUcb*4xa7?5L>jwtdrӞ &Nܟ) k.G>9yn?Q%{G& zn]'CQK?ϸCwVBI'#2 \:0Vs=v[q{NdrcdbP~>PVtܵL7R q7a$O,*>Wi'pwV[՗sJEn/摯ˎޚ=b,5@{"^[ ^,O=`$0}HB^P=rqG{ʗW/q7 z|dbRT3YQkB<2]dFtek#glrۿ^5=%~^L<͵p_ dqZY~5*b*PYbe%qWXee 28NmKY<cܛ? ]xɥ"zhc4O!Kɮc-ud̖.0|ZOu4qYj.$@#?pkP<d|xܻ#rYT-=%\lQ*0 dW%uxK'nciḶz*\{+vPKK}{3lѮ$uY&U++{Ju1$>u=DQ̑$yPӤdaE!XZPq2т@Yk_ 9 =oaoOʯJ=\FQScax/Ž"t,r*DVG3^dݷyN˜OI8*%e" W3G)囕y6[:I?$uW{ۛVj| %E5A fN^kcs w^pصܻsUZY윤(x1w^\¦'hbhtmv5vZnU _UR24ƍ=3Cs'FޛyCsXVfJ8/ڍ2[{7=9Xv KPڔa ԘWg{9E5!j2*j)595ێg;qlmQ]Lشoxq;)\3ѦżU$UI(ii4+z<3լU4xfsT!#Q]NazRNЎ B^2fdӓQ*R>: [7s7ݘ,gd|peW"ݴq7pw2-EA_4m;}eWb+6*ZdP۫oj<6_#՘kqq#+=3+Pa'sw%nqKDxc$`@VR $97P]6 5t?|e;m훽w?HɷvP_ުAWS4qda`D2U9[1O[GzUr2cto|.J7AN 2I?JT`cYdS-4`WߙNR*CE4 {Z|Uv7lglٴۻ{3o^ez1O]Rء>G3KZ IGm!7kf;Kv'|l֥aE4o;[&B5 NdTՀY m٘*"XF nrb^5-.WnﭝwꆖuJH4q IaVhG_hpMX1pMP0%,+WAh"H$ /Ȁ'qzv맍ZW5$q)S$]ͳQ4UP jM+mw6[7g].FWkj O9E4u>z eh|jpSfwX2-Vjmъ >/r7,ڝm1FSOX2~ ]?1ڱȌt)R iƤ½Eqw"fd)1bh oè\];^'Ȉ^^y0:nA$f*:bV.ߡTkQy .εXɨ\CXm Ѵ0%0s'H .f|>t^;!CUj€SNATq Wm Uuo\ș1{*1Ա&/JM2CO@eb6?kG`|.WpMp zJk()jY!Y:TkVUJZ L6zm dk;T&U.5$eGOcq;[w|hUy:c̓wwdU~=xY|=6nSr: םR!l.m:hZ$VPl"F)Uz2A5W4ז3 *]jjSI>u,vk;w|6=һ" 3TJښy;?bv)+jfiGv> ]՘&:,J]ӸeJ}"/.2[ʒ"lf$]o=ÂM4;s9hh̫iGzo !HJ^ܶUլ X#P#S]xKʼndE:jp]DEcb>-#Q"GƼU9KgVj󍵰SnCOq\AJ*Vd^s&vmLLZJ곦32 HZ>C藌B"v忈 $օ}on%Ҟx5\DEA>tI :A^5#=,ɔEEPaf=IL_G45u ULO!X՚LJMWEVar|^O+M[xvca5tti)19~1v3DOjSjޤXyx'/iZqZ =DW<ߴCyy KV{^2MKUf+Kqf$kZO%e.B|}kS"UɭfW*xX1{v{^NRz:jڹj2v)#9tA32w{0eq,U4QQҵIyە#mȣKi8#X#ȫLuv VHf%Xv;lN1,WZ)E$Q B;x0^nGvI+w^꩚6j] I\_d"XA4Qfm>M]YB߸h*Il$ ^r{ow7%q͡S;^nxJ-,Y\~)q_6N+O:!u=6go}KpPѱL,"o@?֏9k;6uxOPAˬ'+n;FE>Y֪t騂)CLx`9 tK{Gi9o`Ϋ/ݷͯpGj?>?U"^>m>[=n vwk.Gԍ @ǏI*ۙK_f2O,o8p 2:ns+w7ߴ:??tQѫϨkgk7P,o7qؓ03uA@l0 _o4lSzqrmn*!>m{=4I˫\Hon7>X-յW\3ߦ>=H֙`8' }m~$E:%eeN[.m:Yq!+Q*GQ_SuLtRbteMhG:ipD# jFJV>3JDyJkj*>ycN V%䎄RH"+Jguvc%]ؠb|+RIr5>n:iET49%L/rҽHw5df;CSy*㪋=+9A{~ҶhMA5&$RET+_PTSO\ffcj~$z*lXi'SH:ꐏbkMbYCPt;}Q1HIK% U C<E Ɖ%t%TV:ǵK"̗NKcP$gln69z{u n\TRWȲWs"*-DQH2J'm*Y_|a2pMSH]F%v\3 qjtl]|1l/oŕSaYXJг22 V0+e,x5STVUͶުj1Qhiގbą:J]̠!!V`h1E@ C@rԠlԂr=>} 2;n\Lx͝N )ٵ}y<^E^Gpғ*J=jIN\ !WoTcj7E F**,y1<3PCl!WV%͵Y\«@V 2wY?#1 K`րHOϮ𠿜M<~݋og8:œ"E()ic[2x۝ekgnj9 UfmhV(?ܥf"ts$%ET?ͥ@_Y2b5e-Va!ՑEh 5"k oTx4ll|ٲvzu̽]M.>eǐT䠕bS=y$ ǡPhkX*M;W泵%6;''u5=yH*nxZ|YI֑ۨj@;/<k.:%UTK[]].+#H(1cXܥTuyv0x͗S[b栝"!<*T+֤QU}]!4cO<:I/psn`cHϞ5PƧ<]YAG5aQƞ}&f]l&KpmPP|8uf>j%y1յ9 I1X{q%G!4=j\-ۼ2GJ'PT,cRNHc*h8 >8՚|@b񘭩]=_G4IM,IJO[t5Se)gkWmʙ9̖Zi۫c#夭UFv0d+G\ĂOM/q(*?54UKh35J%Ң ֆ&u,R̔aA#EXǑT å(- Opm62x}HiPD%jyES;,I׼=YH\l7Rny"-I6ſƭg<:t_u70SdzGIj 4jd+"~(mŸ?Fnܶ G~$1*O\#4=He㟢s#Ou{_=_ʽVu6.lxߟnqliDs~[ Gu_$|]`&MC~9_aCxӥ/]?UzlÓo=d-r1%<m[Eg}AsoMbal sì7?~؝` I TuU@u7:@ "{PS0k~\{Aґi=yP{O[<[ArEԒ9Rt4qܐǓk=(AIďϷ8+?7ڭŮ.nyej>}&`H}Mg8ˮ)hi**⒓ E_ L`w XGm2AK)J?,CQ<)sy,~H`_Jgh@,0r8 eޠ3]R!iHrZA{>"9GK@NOz0yDԋF(r e5 DbP?+;f|_,Bj+en@ J5V87}z8hPMhMiu*Y8oJxqj j OK~ѕ3MeȽ#EU5+ f`cb~KcT7&GjьX-jYb㧏q=T2Q$yH'H1Or!ܳ2k+#hV9,6U$_c=uwM܎P`>}vkm$-|Y=S:q®$.TN ~M'oS-hnVd626Jj# Sr g/n+KNWᦤk W<_l!nw $zfuQj64xll9Td#@gаvj .g׹`+o'TVQ3XO>f;6%0]`F, kx-L YI`|t,| SatG,LSaPH?'AugQ5VG) ٻ)f tSeI,kKyKZ E=N$Bnm\Wܤ9S * <G1N'oe7>0y&槤/ɢjZ\JQ͜/ƾۻz:*%fS3>7t=4PEX[q_vT4 )y!i%V%Tֱ;:uUnڄpVYwFpIU66fb:&odtxˍAgQTS,u%P<96/ygMMdHM)+Í:V}h?Vz^LF#[;qbyT6-IGah=2i?^C dKݕ#_[>]8xQQÏ7O[8\A]ZN/FoKjC3p Oh>]C:{vHJmt+y\/?e QCU=d@zt1kIT56zI$hUyq<+)t+5j3hgEຕjK!'co0|.!9 v:}56ڬJGc,7ڹj1$uBeYTiӺUUMhEibٸJWȀsQBGƬZF|Bh;5a)p"+ZOʾ1Sa*?C(x: w "vvJ*ښ _ģ1S2TG’*Zc[N d*▝iUV9An",S*YYw#ˢ^b>趭6X+j)1Ԏ$28$iV6y$?Fk"i+hM@v *'jjC)HP$jjp4  l_s>UbS;5_ ׺j^˚QchHdK8'Vhp1YYEhLR30pZ X$|;0ï^\Oq c@#X 5-RI5=2ɗQeqU[# C5nO;}Ә 5nG]gNةifCQGB^#+{(3Vˊv}t9j9Xͭdi@6-\cxҕ XE+CJ@(!J8,V v8t۷f- v fS7ݝڲl8%W PWa p,Tӷ:i%eg SS%FID;o& $tz}ZXjYn:NPBRl> 0*:ɞj*ԊvԖ{M<. 6[ۺShmڈansl]c5W-+ FLS C=tRA_KH԰J&y(!S̊yD1kL4IƘM%@fa@r'F!0![Q-Bh,Y?*JXgɀC6sfzbOX쌓L Uij%&Y];glooMӴ73#!_ꂢS 3Mwܹv.td OGJ^{Ks, @Xn#v/ݱ.4d8YdN]5T(vUiV)vn-ݷږ9rjVd1UV9ZfN۸Z^9LD5bw9&J㌚$9oc}+0mV.[ON*4e2}wmc[>NE*&}=ve$ wEgan:ٕ3zzhEoͩvuFDCS.)an.̩NRjRLe%B8bCO A;HRAk+4ԠL_OJGԊȘCT1 jBr H _"AQ OxUn +{VvpFm8ۯvmjRjy )ZJ \i4?2d@ mRA5(ȱ(K6C0T',ӒJ#%b@4D,)U:$V 9띷C{76;:`ai3xür J#N*]RTIR ,mMtCSnX CDu 9CPP:`@b'^We  >~cv6W35@1[(<N3cx*ZfsQCo|tmS=R\!$-є+E(>BlK-o}fGƺO]bh_=cN61M(D[=!^=C\KԋgV1,C9F(7z~CO)P:<!GPg(N&NH V߁ Ȕ~moU3QG$2MM<oS.4MӏI)ir?g\UPO6?x͢4Ԅ _9{A$$-!ry/~\Oǵ,!te]6OC7Cl*N:$1{7˺ՑI6>uLmpwiX>4G_ whǏ\cPXaka(}wǧ7<7Ws?&'%?=OGd!BKOVnl=<6QGRfJ:!T/AMf)OZ]Mm?nJTր7\"|8ĮX-f[slLVm!ltUL3p8ԫLS\{;ԙ}m]48JƩsxx~K14PI*N{e\r\̋2!a" Y1H'ߗ=YȳĪ)i^5ER@w8oa͓nd{æs3ty<۷has50%jKGBM9w#q>hY3n˶ؗhr;O [>.XV82+GmfeZ VM$@+u;mǼml%"XM;p<{pzߴ6at?̊n+&mYX)62#*/QPKPDyu?mud{3E,1DGI!b^0cZ3CQNP"x=6HM )gt;Lbor4SvY*_ PqM IZ6QU]XOw)ɂ쮱fi椖 v`~cR)ּ̕PWT$S.Q;֏N1'Q.ȏ* OUvP*"^\E#߬VWǾ`׆xJ˔}qK[SO,Hb(X1_S1ױq8v3n[]dWn27'VG$*[ʌ4jwY/l\3 R W5H ޔea:'j#B!VWϬ7mfOqv<a\~C{0xܶ^=]xY\5MK4ARE6aWS]MQ:?;Ύ Y;F({f$7۳O@hUFǰPIy;n?RViZMA\ kk݌G-A 1CZ|k#>"q -wXdr=F[1 esz;Z:ܼH%jjRHã6*͎5}e ~6Xq]Cq- Jv$iHlXգ(XU`~22{]<+TM;V)E1& |:j‚Vufs%}oeh]1[el\Vz Fsfsf/4MUH)㥔]u9ڟ,^ 17549#e͝UP^|nQ!vbrndFJo!@- Wˤ/]n%!@eҡ[R|F#lit4c{o#[W-ՕT*\dְGG$qF %wɝպ/fZI02}ke8Zpx D!6 ($bVOr-!SPhpӏK6+[w3j| J e7l5z>j%ܹ-61sO&k2ch$K4UWqarn~L']TҦ*3_(R*"@K+ uvPP:zMSi%Lf+DlƼAۑhڃaNɶUAYQM[Ӊ⥕Ȩ-h.RHǏ}LyJ)p[gsE^^D}R vʑJQlvA:@oJ!7o?z܄1Ri$:HҚX[WH.݅}Se؝[RbSnICqRVTxj%\-7dF`c):&]߻7[nq4Ajj{glSGZ*mT54F`yv^$62 2,I$_Ōݽo@ PxSj)h]l 6n\n/pl<UeOE@6F(ǮxTT:?%LnnI&|DY+Zz.&3Y˒Lޛ&|b~Y6֢;Q@(u 7/y Bm˘t>2 uU>IUTn?=d7/ǝj"an UvK nj-)E ULgUَ}4r:lMؼ7oGmbto)ޣ)4x9eT0{s M~$p/$eDF'Q;4bJ"nϖWyf2p}MjᄚwWcqg#J_nJ'IJ*md۷kړ]_?W'é`$ǀƲ+RBH,FV Pi@(X0HgV] F@”TuSQ^~$jjhDž#jgj{bvfjMkq㷅m*fH ݓ5Eh(2eni1ccUy-&ƭJʯ$g1q/)9^zC{Gi?4^v{57/g6u?}='n lqjmy5g'`P?CYEmHր&o~7}YI~8}΋P5WG#ssT@U:I#=+JERorxE._4f:iRʠ7?{vkrjP*08Bf%z.HA'(mJ b$>,o>U1P.(fY<5ZiR1kz h&"u3M} Dٚ^hGx+"Sn 'fzDZT~EIjP\5TP5k@(j)CZb@UVST&zjvU66*2;kR+j_-2 z&x<ԑin 329T4%4 qr6iI2ZUS*`A (r"M-f%t98}cQbw2d&x¯bƘƥoZ2/ PGcJjL&_)9hiia"jt8'8O֨@m@EHJx fCQSAƤr?gA&Y*3; ,N/?_'0.N˔yEuBϙ}˜O;6WAV%|Xʙ<$-@CJV VĹv*bu)F2 SR|J U\ dpxiOpՈ|S6=gptuib V2tAT-[ lM$f}O=LJLSA}ib(.~.I5Tu(RpreW=`TyPz8=tb!OԹ:|f|E= u2E >N\T5~:mn>V2:i|hUSqE$fLu-9P(.I館]_H Uq!:@4jjF \/E77$(Nx^=}:K|vV:u䎚%M*F'!,AVic/NUj\WdSU42- $yRbiRK#h<Y1 ֱH-T2Z(gtcaKRNUT `H:TSBWV㫹u+Z|R4*Df抚9IkZJGpabSQ2KM=4^ U31%ŔPTQӺHiS<2A6? Pciq%4п/Bp4#9*BM*M0j٠S,ΕZB5 P5n)6)(7<.߫UCESI9Z"iRJq w zJFh>kpU}XDcX)&+%zP iI5^ߤMA>yԞh<]>ߥjL[EE%-a>cF*taNEWR#VE۰82GGSLHHdႂ_%h EQj 2CR_ d,O|PcοӶb2u>*Zʪ+)k?iVM0P5h $W2(\QRl}LL5 (s(\+xՙ25F:U!cuPδPT)8՚h9R}B+TUQ.">|pīLv+1t댫X*Z!bD^Y@TzҊ/5i- 9X#11`&J!f k,lPek=Ϩ+BA 0 Զy+Q^N*<8iGTdrX|F9J-qT-YVӄDT&2HeTJ5k-OpTKNdr5_ðCA+SSSB儡#ؼr!BkK#0]&I! u/vTOq$bbOU!AzJrVLTgsLE5}f6>=tѲluE0KVɌB򶉲yD $#>gD TdRh6HjRuӌVH֤PBNƸ:~.#Ǚ'ty|fY)r/lnFT` 5E$*t23Ҿ=TQae㞎0H Q }oJa:jEM0{MK7k.8QؽL`tƴ&]z8E6{mSV,E.>11 KQۛBX)pM&>Ȭ;K25u]~8G# K(pJKAIT\cfA vѻx^3AR5'vTn 86Ԇ]fL[5ʔV #Jy$dUVtʥWJ+>%2"!*)1%v5K+ZH,}F`1f"e[Kv Zi,2vH*p)p<< )PH=*L/3xq(h*nOqk鮏3RVASIByQ/ҖY"OQ%` <#M4)+)N# 2kvAM^x[tﬖ-%m zs|PS:D5nIKW3hڔjTPQIf zyUI,2K(6@DРe 3B%6$*C4ОJ(!*$~( RĦOA\j8CГO{UE]-*T@ DI:oxZM+9XjNu*% *K (]nIPFZTf$dZ+B@&䱴4ӴSU ~`ACe#lC`gf 5 :f:(aTquT4BJUS5XFMK9:H>D;қfb9&V( @4qt.i\@R8>U:7RF[!aW0j 㰹e(y:O2`O4~LvByQE%5t@5xʸ֙rᥚ5e lwFQcPαPQ:|]@+%}lZg y KeVe:*x1Gm\L,3rjMTB^[5-Yߖ1op)0^QTGDPB4#t5qhM :Hz1+_ō r㔋#٢/՞'_\U,-R7Û=AYO~ތCa7@97I_$Oz Tů4זBnqq?ME@#8Bn9q GKp@Zh,iN?^ۑ ؏W׀1RՐvX}%}oJʕ3+,|kr/_׾nrn.H \ׇN:}?]A`nG7f->ֿբuV596 GQݸ A\ꀳ5\~mq_UOzS˥wn+GSnCb|vGPX*RS"A ;,jP^n;gYw=v%XS{/eeh֯D*#icbaz%5UA'Sjl]V&h+YxP7ݖ{/>[Zm\88p+厃8g%G.@o-Sx?(4HΊm7U=![Prk71sx lI9(D WXC|)ַ=$ R':Y|y:TRnxI`|NFUG'QM}\tzz{Z6Z65r8(ɘD4'[Aýud mŸ:c=k | !GjGͿ׭d`T}⻑fܙ3SgQ;2h_Բ5[x}Cf`Z9*EW5A.Ws~٪}F{lvDFSe0]UR-梚aY3 Oc썛Y;! ݊*-ڍ-k&OUvEЭǕQ4B{Dm/C,jI E_تO}{ڡ*"Bմ0'4xڊ'\zf+ao{ه abX mbI'Q?*.yp2m xRtZkIN wtXג5<u8}}_,"Q#uGV?'Am‹(dc/׻PCV[jh舊:H&1UJScyLST4W*ڞCp# ߷NQ0tMht~QXV@5)2S)՘UEtニ! 3GXC˖uѵ2β2g(XZCϊsXn;3Q$IkԼT:匨*JI( ЊO⪏.42hj54l6^pLph0[y˖LuNl趬rƴA,0XJiBZdiMEYjk{6&}*^xtYVkMFQj-V*E81_[YNy)5!( Y4PYiQVVwIvkⰹlhv*^tWSCLN?rXjI^f1S,f3OCsKiTq\Ϸae /$^J:CSeJݝ9~v-l7?%~٪ˍ-'ni3,VRSN>"xg4*Tk,ht76%CݹoH:H CM q(qJˬ[Tvx#:`~ttWO]jM|mͳ{Y\n=6&'Oj,kej;/9v(ZF){(i)fFuʬ"3ɨ*PGIԭA4cX i5E|" :KiV O~58OKuK *Nmf UAGS̑>1Kҽ.9!+P*ٌ3So*a3ʢ;= Z&mc]#jTj^uV#I¡8pq:Sf]͖`;) 2OH'=]K#CA4l)5m Y*kaQ9E3HC L :1ʫVWT3*moq ~ `~tdGrc2km$ᴁH\g=3V2m2zʺ%迈[X_):jlrRdż8 3mc\RfX25<O>BN:1QDjHg=ED@ ]Q ,#biPuPIdEtW1PK* 55FןZFN1Cvgh7](ie{ ~ *Z*fȬ,TLx)劦z$1ֳ4l¦H.Bs}f(6U$^f` P1Bs*jO=i}IhLY?]>C#_ !ZbJ-5GM3CGV@QYg&.PP):PEh jsy!C xk]#b *W 7Ut* QO3E?>\HU}6IKOSI#4p›"PѾ"#TyeKux!J Oŀi~"JHc3QdbLl;ڿ)Vb9:;/aMJz>C}ec& !<ʨKMzƴS+:҂_D8YJK {C~k i@Wt`#X՚R'Puu-C:€JlIY[cqؾVK~t4|Z))V1fWж/5 B'熺 !KBҨvpfjjxa,h1F1-$RY\Uf v*TwѐZ"0vM3P p #mq|zvtWW=i(_oV2My*YE=dn53S5t{*#S4o$W1ODcJ nM8~cyC:2mh$G 4'K QTTq4*⶜YkT9+*L@@+Чhk*/[Aim>;em%H`Qc _QP1_~K0a!6zyrC B/%JI")W:jbx!nt+U<8$#ZwUM$VQƖG"pb+JrݛVcpdo&ʈóVcܹj4dyjrI.Ak硊H!4G#mQ&Yi0 AOj'#VLF:N%\1DG j$m`Hc6ԗo㷱?>|j* SZ9硠JJI"*eە-BIL23ؚ+2tJյ')#yhTh|5j)ŵeWQRO#wqDT(NV*k Si5;.GE{avbcc"3PCq98UMPTAqZX$LMV&- qDrLԦKI6 \195>HVy5qcM}!QYXJ$8ψ6|7]vD- Soߜ̳id%U>Hj j1Kk*((#R䎳B32SFvWgMVqG]6th٥UbP HI B)V_*,+ۛhb`7K-.|w%NFzxښnvj̢Q4&&"$+9(Q" -4‚{4e:-w쬐 'Szӡ.SmùFTcdu!F%Qn i: >OS 0JxZ0D PLy*)q YN>i"rBxlDx ʭm9t9qvo6nq8vUUD)RʀÒj/ 5-NN!*kVtb*xV_2 [wW1 ckX dc":[": :KD$"f9MU8ٛtfk[!uQ2=]ZZ{+; (j2OfI 3JS#'rA|M 'sFW?g$U-QHIdV?9gc>"@p`CPR8/4]b_#jGARd.*-(pZZSZnۆqQcUmN}ܴes5Sqa]WK Ut?Wz4l22ips0u(Quچi]57gXe7AS:t8GccU6 % f kGcexГ|KZ{OqWD := m%33X dٛLcIdDWο-;CR61,SG\\6dee(d(uV-M3 /эm_4Te%zJ>UÍ%Yީw6f *$iD 4p$uW]X-sdn 4dT/^6ݿ47=tK܄=t"WSUCQZ# *m< !([P7_#kDU.䬥T[AUmhreR&2irRK%-~G6a (ԕsۺmi#KVB0 Wyt>Q;:3ϵ*2}QZˈ?鼢(ޒBc Ӏ~|lUEIK9Hb smMx b1#;$e"9i[KDV @+]%URUϐ= LB[v ʬVX/|; ||F=Fջ۲72]р'jXw818ڪ Wg+A\ 1Xʊv)khzÌOl]@v5T4*a2FA{\Q']ˆd0 v,Hp@ 8w9iq6Yb H+ >`Z浭Ev?ߋ7^Fn|;f&!#pv^=(seXavd1^jJ~R6jZ,ü4IS"H*s+!$M*! +BxT"0S?o=$i3x]ɳ2ٽ&ڽ{u1wDr4&|8Z%0 y6&q7)ҡڹ\r<O/&w%}ٳ_ܓXE& 5455#SWi=.!8Z\S8>G n~~w{#Ըj_Bev>naA[W3vObZi_=2ӹʙ*wUfu4=IivƚT$"Qu/jMH°k҈-CI7 PO=&Cs&*-!uc/o~0}5O`|;{|];+)YR͎UWm- $= E/ 4.Sz5JlW qT[5]cvfőg& xw Qs̎ͤ;5I+)ڥ%m=OvvFc5K$0 CZ⡉Md8=I2&~vnhcj&%{QDxp 溷dPGMvgmzoGvn 6Ś돕磂Ib>Y7Vs!(u8%H4"=^P=eTT SUACjnEOkF'hV-.̞?QR!JYyUjƂPA}Uj>[ (&j:zmv>ާн[qyh"8:]vnt>%OiǙܽKldyM< =xOjjV@Elh홖V"hIݠT`t뫈_TsH#C4ځ֍R2hI^X IQURp`3㨶Vf82[M[+aE ^9 v?| w'Rn׍ _zw,DŽPɜÑWxD̳ͦ"Z 9cC,K**i5OY +d F:פD=ebhXK'q53MԛDjR0𯅄*4WM~,LC'-qW'H/ D@XSFnZ=-]-$WTCz7oxͱ0X>66uoSdw;*!:3+*pX6ژ,M*HG:"&鎸X}KyGY7ToаsU+1X`+} kCy#HdP]2ݴЎz>G{UcRh8=۬g29mm_̕v {L^S%ArPTC'y2ur2"W ݝEmum sShOjrtԸl~C!%1.MkKm* P<$AiJy>{w"Ԏ-P[VZ z gK3Vmޥ:okv^W-32wŞ+O7тz|r||Xf/X}J-g *ƶ㨆6@g"H, PM#V6t,RF EQJRH4_0EkVM_s|S={K1?nໟl-e.݁ۗ"%HW4be=TA(-uyԵnqv=6]TםFn%S!E49SrėZ*4Nu][%)_Bq ~#q ֹkB=qƽ)Pa7.-o݊G?oNͨOs[N5qc*+2a1idO,# dzv ؽz4o^Eq_~}k>QrϢm?wO>~n>Zw?_my9bG?yz9tZ_j?Lz.F({#=-:}?lװ4%n(nu"g%~}v&)1ҴH@ѕHoeEEBzRa#{1 YE\{"㳲{VyHrMG>ޕAzWT( 8p=Eo]3Zt\w o{udPX>}63)?'W[&>5X O^$1̘i%zU3AlrUT,lHJ4dDeZ~_i#[#A-pbµX`׸inH&m*_ ko\BA$Ӫߴt|P&xvv 7}E㦫Jgjtc=@RV7Lf{#1+Wx xdIO7.u]XAX<VA AᒬoEH™RA?gJTyzCʸRS(&Uc-Wtj|}U,$0UF'y5*)dv&sE錔,TQeuIY [#4œjN+֌E~d~b+NZ L?P0MIގ5ti i]P7؊rE8h橘rk<6JZv㬢(0@u1#OISr HAGrxW}*5#/.'IQ]U`Eaj.~m5T^TTe7@U0iAPIxkƵh۬owĬ5wg jXz0SE *ʔ4CMU)Y(WjOG04fƦC"Sd0մDb؍Z%;ӴX\nߊ&wW1d"J#CGG-TS#P(cM%I ʃ(e9U84?,q:Z&:|.#USnX_㨍'fdUVdINhbڒ YńE)2N`c̕27"bʤW!ۂW^!x5b(1iJ<QSƆqS 8ϸRͮ=2&?PV"8Ja&>TxP񩦩Y}4-RS%\y FB5 R,ȥLnUV.࿉G Fb<&|ہ!C<8pm뮍bL*ࠥYѫ,hkt+ U;iT9)i*xå u:VfմzjdԄhB*57 H POFhWWG RT$VWA]V\ Y)M34,<wHEP®0pO=fr7ujdcI#YDi4D1nZWCE-@TjXU5Y R-%PI4~*u/%^,8Y1riBr409H 90ҴEk 5M[KMTFq6VjGcp°Bʥ*`j}8SOBEy.~d7Id~🋁)QG]_a[3KMGej3+R)~$8'GQo]Ml!˷@/:'6 a2y)Jja]>ι !,C)( VZUlj Baxէ%A yw4O,J<k#oവFV1SJ[ƒzu yJ;dDݥXjɭ"JdgN6'S 8]jl塰[ TQB`ZW6M%;IMg'J5ކQ#acodcP2uQxi=!2u:`+h-x&mV頭剪VҌtTK9v1P xOI"qF|@$tU#Y[B'tR۵ devq535 ^uSGiLLUTJ?V#5>EWQ[iWh+:+FǥCQGs[[_LQbaic8ڊJIe:=$cm%'kx) [PPLFl{5/qSEYXdc#0AuGaVTVh *Q\`ADZxRAk˸8s9j8*X.rYK^BPI8%\fQ`m5$u5M,qWQȒdi(v]%N 2I"ᦒ7V48XD+"VR*Vp Z&/RR6VHBҼxtWҎ_YSSGO(i(iA[;^:dCfuV ?[WJ=ѶpRb(^sR,T+2-T&IbI3*`x$)@u`i^$"5-[$TMpTБʂwabu}NFtӨimCIQ瞚) "  +WQǷt WA%rI"5+2:=2+T6Xaԗ R7צ$t) czӃ{j q=Cܻ#W>#W;pyq\Xދ1QŽ5u1Pe)΃XzNN4u4H*HaI ,k IiR"1CDɞ6}V%e$:hkAŊ *נZmrf>(kZ ` 5d9ːT<8-E`۴w1YI|a6X)a0”U#TG}Ϸ 4SVr!+beظe(?bnf]!$oBiUC\H7m)ªA7"qh(< OB38uǎ> 7>lyrb)1fUTGdlkQ))lz4'8,/=4uiUTKMtBꚤ&-E~#a2fn< 0hF@;782#bÅH7OY$ASetГIEE$M N Zzq0Ei 2 dT曮YX* Y⩌PK"j9)դzfq۠q3nC%D#PHZ2seб_"HO Rd5jKX";HUAܨ>4|'sP٪LҕSH/y{uX5*uZ(g|UGǫo EGv UbqRh)pP= q62hmRSIÚK2U"jʼKI 7c118T5+ CJ;ơPFEi~U6OUIzɀcK!ƥ9U>S92dZMF)5ER ?6qX~37-t#Ir0?USi[Z`50HrtPgj) %Zm辩ӆ<x!INz1rRl8}q+0(DΔlsif6?!VZŦF =jLe='p$.H|jX1_ R`RR@=<,B5\T 6l?bU|=e*2X)L19eIrzz:ړf.FF~Hm*⣆ {JQLRVUUB*|~TcU bmh [l/¼+E^k+pn#<qNzۧtmߑ_vd팶ǾlhFV IhQ1*qKbeo9ۉGP6WOKWW.QI8#}m`o^}ƒhRЋ\#{PwRZֽ{G?4~}SU?,W0[띍[~=ɸѧX^ſ[_j-SMjwKYc!E1</ˠcTN%;TcU!xg4,?BW2Ƞ⺛m'M:ЀQQS,׊X ]+ Xc(E*-QJ:zDk#AuÏ-r+H >פ6@fL~ޖ1n i@HHB~o_.K UCU+ЊkbB؝V1DZ{|`xKޕu} )OOt~AKQLpub[Y %GJ܏ٻhIQgs5RTU$D<̞E}n[ # Pr>~% jݪŃPW zlq8LZn:*$7@GТ*mƓay{[-:ǃjq^VD|8o_gQfI"S"$RUŀߋ5%u}C}GM"Ts[?\ͼ$|RHn*2ӯUQVS5%E<4zzX\)+"~#ܛ3=Uh\eԭ ORaȱx;[@cL ~M skV鲈n:ƱĨ,+2>};&ZB _C,yGOau*oeP# Cj&?Sr݅rtY4W i5q]K{HнTN~K}OOL4*)cɥBAvsPGTՔxQ)GW,}4xvUf!U$dBh?>ӪR)?No]śQ$eoUc<zъ@d;" 5ԛ1CQ;ZJ HjdsM1g onmo5 x 8Sk/t.b2I㪬>Q[{%F3E<,ϑ|RVY ;1"oOqvi\Glk4c&O3 Q@}v^5?~Z"I/pS:*k׽wϯW{X}>{r7f%WU*^zID;FR>#5 '[ϯ{F "dY鯡\B^-T4FtݶI F޽hU5\1Hi`UbA%bO_ AXa/P_Em#WMu^11>n/_i?#*e‹(Qv# QQW' _5DBIpdIZ0J,yA R8TH(`Wο*u~#''"tčm,JV "}oB61㤎\璺)6L}KgE3+%L%r b+7Ppajr*d1J2uO67%|tn^Ѳe\vR?Gj`驭 |-pyY}1HκMEB,T:` 1*VBdj,ͯƶYRWq{;ChU,.rDƼK[ $ҽ^v]9੤hZVYK\XUUTwQPĂH _OzAy1S|A TIРcp=OW_S(p{tm;] ԬK<*G Vsm͹WmPKAcUmW\ ˩cJK2;+p}R}BjI 2h=}-;M=bӇiC,#Jn>7xYL2H ը PdHQ/s7aɪ6z@F4hj=l7f6~A s+d3fDQUQddkFѸ=^ucrP&5q9M1q3T-{y,@~&d-jV exPlv)qf)^a2{?=>g<~ ]1Ȁ]o&%`,M-nJeIN~) M$QC+_M`fMjTNB`xVI ЩZ L)v9w._ɴz'MNsr,UrC%&^41P 5IGyH]+&]ȳIܡ3S@HHتB?K{SJ.ht8<*SBV[PEXIjh@*:usoGY̖a)h2Ι:|PchI1$vt}1iSTQǏ8j5(P$([Daq-ʮEUB%H!̬ bڪP$W pϘO7.'1 RD ՝_S"dh!>6vitF5p (@Q65wgb܄(0 %vs#ܻ, .[)Pj",y|~F-@ V+M,?L3 Cf&z,ˇK;NIiդ++4Ε@ @ N:nFguD;f,%>[feuDe2pn6м qSEA|mDS"3TK>g9)ipazc"PIP {+43cRG FKT`rzOj`/$^2qGsKQSV5r@|h2cj)3Ivfm >dek^,BIs2Й_Y-ND0eTTO 9|NRA-vRW8hbJ֔=•*.hT ѫO]exL.>#nacvݻ;CjjCx<|اx'I$i )TljY ژ`eId\Dd,Q*]ш`{Y$d<4UBsjn[E1 O ATVIE4M4梡ҽ2$mSONT.\mc8R ECTܝbC3_[\)B t Սbulbڿkx}y\jTĆm]ed'QhSORȴИ) 1 GL6*Hk+jqG*$fQTKJ33*9/ 92"*n%Nj6kFS3obW&휶jpќG7nK[K$5kjbVx3$R!kIFg>Lt yjhVSK$U%κt%>ޜL9T)ΣFQRo>}d/1T^c,PbQz6nZnͱqIk ~:ik[MO^AIƿ!P*'%1=eUOIACV˟qiS;8`֯`P,rVA0 hj2Ʋ"B``$Uм-$W2αTM-tч]?u8#HfG*(KA WJ0R@:#b$*h0iVPjWMj:-\~W7HceA[cU,n9l~ te(WNr GM4nhWjeS^ٚ{Rb 0'S.ڢEQJ8=5=r,cKTPB BA\0|5uTXWL>1賴<m5UNbAЙiZeaZ 41 jʕI,FpĨ:E&e\*hC@Za}nX֙%pIb7kϏ݃ŇLV'hWSVM㮫H$D#QSS<ت$Ϣ!FI25V]l(JVhbXqTu,qR̭)KGd*V<0P@%tt)o !T$ŸIP"עeqm;lgik"hf2y,n|~>j*J(&TeqRxvL|U}dUp咉(S%,2rQN+cGHyeVyT+"Lڝ!Y! QUj5XZz &]].X.vŤm<9`PKR$0%tƄyJ>vN;ko וݒpYܓG)^ j#s.Qgv.?R_ڞBTٹeٿ!9=w,Pu1T$ooj=կ1XMIrMտ43i|x+ _?p-N ;qOKW׫)IBJ A:}To8>7K K;U?k˦H&t{=QN=)D}u9w7$؟W1]?j}iWMAҲoX?^yO{UEsxΥР4= -WXN pϠ<[|D)~ބv{_7d1s7k1!Jy'[@ A:sn1J]!k:+$t$}ߘVe8kXْݑ5 zT7@|>sᑖۆ$߂mDZCP1`u:K^[_ k#)7b}%knFU2mkEs&'$QeH^)m䊦KR.@!iKVN8W= 6aW+C>UsӸhXG,R߷%4?؂T Ff6S1ut2&>? ɄQ Ҫ*MT@eMH 92}sV<@2)MT6qlJ 6VX` ăj@N[O}Tc++kw;/LsFP@7Zj:kV(p%a]n4krɷ7}C&.:LO(= qs3¢jIC+%;PX4R*kU&KQW -m(u[J1)ʡ 8WʝԥvOv%C6/cu~K{lm}CoQ&jꈲv.($~!1G(28uӒ=6" %0M V.2V̠RK5BӞ3#ʚI¨eژ8E$ZPG(+_D6e+צr%_mb)k25]QRwB橩C;cLrcܛf:^ŷptV:dW0M^'Y(#{kBYsfk+$N֩1H nJaV4jUi# lݥs;7v?v'{t;/ft|l Ix־!RS#Zjy"8jj7kQKGvez;jiv)95XV p}'$sw7ݘƞli\ȴ5VaGf 5ݽ,{OxlEXZb+3׻ent{0û6}J"n.Ufunz((ir07 TQ1y ;6竱θ]όnUdnzʿ*OM&S6k]Kdջ u(DʱG(F]*VPж \Aui k(t¦T8uiT<wgtMݝowd+ؽEv}ώo>[zx'eE,mdbFM lѮe$lMӏ?élmV;kooLOz:4ZIuesf ?WB>(4ivdЇI@<*]kG1[v8򇣷i;65Wrv(hvOE֠ݔ< kPF#Ӻh+6.bGܻ^|VܫĦRUj oޮ)Jhcbr)W,R9n+wu)*QWOgf!PU!Bt/Z%UH*M}3QFH .F6:HKN1!J<憕@ZC)vfWv`u|=xYvgz;~ea͈3}uW!.&!Xhi~hvJqIOL,\"*"6bpt:O\<3mH$q+7 ՖB)NhjEۇ7MIB ÅGuvd7322Gw%Edi6l_a'qʚQ8ATVIo>i1U/WaBZ*ʚ;O/al*굒gKJNLbDYT,pjO%4if4U~E.YRG vHOE񅂫>Ǹjv nn 4{ \;W7MW@L-~5w᫫쌾`T[{Xv㊮6UgT`Q)#HD!{vEo-#Ӧd LnLBx/{_윦ߝ݅}CvWMn8$.E .:,El%[V;5_ / vf_jUCj B{zOkߧEWPBR~cg7ݧ۝>7|i+vF3-.~K"'|l[#G5lxitI%A2-d"Z,>C=6J|[m&EtY`>CeYjHii 1B-s7jqq6d0.b KՉ Z.zXrG1_ jI9 T5|+#O[o*LwMBgiDKInw2gi(Hƴ FHeRCXV+A D8,u1>`.bjc5Q'\`$}w&{8w'bm폅1?֧xds{*Ħ99jr a'2KS<.\e~L8ܞVNfi**3̄$jlcUUBdshF4ЖbVמ&dCՒ TT]Ny]FGxzlT<SqݵvU]%;nbtϬ$z*ɲXe@*p它+ Bk3T+K?DUe1NbtYIV`KiJVC M jwpR +"_$ֺ@YN[55ݽsY(ɗ˳|ܔЍɶ~vE寠4OS[W?IEqt*6jVmkcSoԉ+ٙ !jrާ751Q$/"6 ^Qʅ+-u PP3e*IZ祙T:~moz<bgsmꚛ44;wV3IX*G/\-x?ɸU8$yU>;WxlpbQc41GYT?'"(B,rNBWP!OMM \yMi\u{dyj@$h 8VĊWWWcm&VɚܸL+wλn6}?b(stSUUI'i$s+©$$XkÔp2ϒC~>:(eRm={2|ţS)G^~^ lv}r`ȴ[ޘ\OUy\?'yZ:8:|]TJ>{$]V44 GX+V#>CMtJCetͮd)&bK{ssē: M4>o}]N#f:}M.y_RI8`Oljqar<0mê‚$q<W)ZOO^/'={j~s}Ǒ?׃o%=rcvmNkVV8<{>*G$Yf*6ʺ,-jf"Bt@a9%cc l!#K-#H"JvsUl_~Ӑ)ilA+݈ҠP֟??Jzm㗥+KE~f3?Q /UaF_]J%Ym$,dx)INפ"Z1GUTfdzEM0֦XSCm!+0w#U8 iZU f+h8j PH h(?HuxkW⢦SSp!cO]*,+/:S^;#oI%eY44UZ4@VOO!qɻz1Ơ ]!pK$E! $ P q 8% j*eY©)fNjq8OTx:i5bt'dVp+Z i R΀+QE$ ؤ SZGhŽ"PuT`4p4ǡӿ^,|f3٢t 14pM@ OP i ~ ICyTD * ݀ ?JƗ+L8"*p8j1=D`tnZ2 Et> Y%B PQSԬ:kj!y##BtžJieܣ]̈S**1Y+PRT/ncBrHZ)%6Jl8# 94a48lFTAIF*UvE|SUG T$S9I \$2S,Ң$\jWꀕ NĂ&n2(j"hiL ={Zn"o 8嫭N$c{KcĵK*I<@VIP~?,SL4ՙ(]QJҳet^6pWP㑵7z RĒCdάazYP}k񷒔Vq2H#C7U22i JHIIfig0+7'7fJHuM)X2jg6v{FT]z+M"Ԗ ,Ҡ?SB?iסn:CH#jY\b俉Ϊbɐ8jf!,MUlIQx#|y$ 㭊jFĘ(1N_"]㵴-4T՗'UI5nj03Izjz5d.ˆZD|MFC>c8 X1riaY5K:fچyਭ4k -&S3 rtʦ7/$NXY:)(`#i$PX)'y/1pCOϤVRiQq웒|bٿV`)mP9"jr[ ts*k*ȒI29Pi玎9ݵ^U2i *"Q,[5 ҽ4]vګK/rchT#j$6yC\ 1R1gsm =Q&ʴSQ=C@HUgs`&6;;`"]IO>Q6*ep|Rk)YuҸX;;O ),Xk&J- lHe"z+Gs3`p(HEY?>{[i ĩNtȺ z}=MdDo}>Ok;zHY8Q?P8k6QV^IѱN֛fOR=$4=!'zGݏ0Ui"ʴБA*^>+`$:Et'Ԁ GqETWꁾcwo>˽dt1Wgcd㨙dEሎwbbM=S̑U4$0AQѱIK]Ӣ('DQB E Ƭ:6[zB>e1bQG[$qE<穦4uC Jҩ5y*%>ntΏQL# T) 2c :b- ekPeOB 7q sNEkY-?~ނwx`RѤ끮F XFyHtc 6[,tU5:yaDIiTVUtef *&MKkBKӤ+`qՎX\Cmp`ll2+U2FtFoSESIKhq# j멭#ݻQ m”c[Lccҽa>7ʢONR5W)mHMYGE}O0H/"n ?ZѺִ'Ivֽ{{>Ir PZֳi+TWr詯Rɤsbmg~OH EC 6 q۟l֥-^i0 7?=vuH-@FVafPE *ϧsI?WϬ`#q`jy%׹6zDqtjT9|[N$sscZ?tiƋ_hףZR?]7x7OkP*RK^Ί"fudr> 1 I+ĊG맅s |۞|&3QE =TzؤNonA y\4EkY"vl^I$pwS4WOM\S/Q=4rN#dbJ,_a+`gx(epx:T,A֒4ţz4ѫ^1./VMb4do$*VT}~pB}oM:XjvEEɫLH#IV9MBXʃϙ 1Կ_=C_'SLdg Ny[@4\[Q)0Q!jMU HYz~ΤdjKjXaӍHe=tZ#ס9YϖG|W]:Y3HEo6f3eoE@ {Oq@6Inz8] &B=)wemn96JI_gS*hSTh غutu2fB- 2Mq6;>.)HA$՟LgE QƣO z~gu/]usXǖY&r 9&P$#E ߝ'oZB:H1hz;Ǐ[a[^e[jCoh9iO=rEm@e!%N^R?/eǏѵQ%?颵^EI\u}}vV*j:*)׽̢GXh#~ڨ Xi jVzxg*3v݊~C,qb)z?.^x?;r҆ӧo ڳK=8AOej*W*iK3n?_SsO?r'A=(|_iB>_Z3/Ȏ孋2q4]i:a&BSOYUk+$zh䄥2̺" ܗӈlbjK51'# gu~6FX+C(>PįƬi:.)k>]ň >*XIE#2Uk(eq¢lfLmT[gxȼ5QC$URpuAS0LJ,:H ƺ!Ҥ(ǮJ4C'=*UXK4 }T9-~x޲ٔü1]6jnRw䪊1Sez9+ҲÈ ZE-EvEkG?,[G]1v,hC WNįq]i5$5 ZNvfw8sw9AnW\oOm^~l*XɄ*ȑW4Y:eٍNxVeQA a#c3[=`C7NbhxV Eh+X慞B&A JVE%OK 이l}L5Vʪ={'56'xnq9j+wEED-;`=7=TBF=>C'ScUSӟJ2ƥM,+eFS "AS܇yKN%ʩ s@P:BCUHݎLѴB(wRQDKuO*mx&J]o>zU~ݥ~T,5Tq dzV(6d%tep\}/`~/=اPU#)O$e7r+Q{JL`^D𛄑Qr ?jmV_sNޕTiqn,nc0랦$RHKI$ȁucg4UwJsUUEIQRῇwxbiV.yeckjrq8wfҎjCVaKPaV워>-i)*I')3}ϓVvْn6vx{|%974mly X1<K+:tPE|4}u-\-6NEIY *xZYbZc3xB%ռrH)?%j B*c(NNn"E1~T6 $g)тͅڛG)6#K9-7rjvJܥ]fO?ݔÓ;CzUrU'kczVwPQMIvwrpcrwlSƙtwOZ\}ϙєzXQ(ME%E<ՐHƾʯ6CJVXI+f(J TU\T+ABz,ڪJ jV^t۲y6nyrw\x \n>6-9N!+jjٞTCT۲z$hiꞶ6W;[5Tj$1\IZv/6 V4"E q$֫>0ƥ!JC M5 m*K) K 85=K2:6v٦>z-(c36:fv+ KWQUU4̮7 l>;~gg(y,?Pca>Z!Y 0PMMWIpC4Ե5씔^9iJ,ԀQu,%qw;w+JPi>QG!r-ÕY,gIR`5d*nz1Fce?)'%rZnC3UUWAM{uj٪ExRh6OTXqC-*JNRw)WFzۜ2ԩX,iuI<*Js1 H#N H =к'ՀGEiQ\dk{{_cdz->'klէJdCQY%]oƪzHh6c-S7}jtV=DbH@ (ݘO:P=+JQ@!@M&+v$bWWzqɕNІ\XX&^V"Jjy&i"]D UDb[TΝ$TwTPrZH1 m$ BwqBv_1غ(jm {#O݋Vf\ss2SIS4GT'1)oru EOK .qҒ!@U,HVp݌JX(+|.MV'ˢVI&(xi#V_QQ\-qUؚ4[896n"kl,Ft<[*,_'*y+M) !,-Pc /y!v:6[]H ڒfۦԈ@)h\P5 "A>}I{=xJ%2nS:Bd^|YK.`㨃eE.31ڻMxllK$8MI^&"gDPWArzk,e-f:((6*.?' M&*k,ogLJĪĥFىdO"K€r :I ` ՉH|S u[k#PW-_3ɹ3T,4`ەFI &XVbGEe K_ 4TIT$)L!Io-)Comg({v1!QuqH.:/em$Pt9BCt8x:2Y|\uUby=TݓYzv-PË9WdDuBWRpTͷ=fF:4)'U-pVIdr$YiQ|$?_X +@SKiAB3mvߑ:"& t"(*=%@W۞vd( 6Ctgq{;sY* ͻ\|f28MMrΚ7LhxG=r7y X+rTGUISWe"X#ԐHw|PMH &U|O5ˢ=M)xjwj]ZCQC tJ꬞k@s)5Qٽq!dDM+VG.*2Ik4H'KASC<ϊAMY]Zih%VD"[y]b Rz:kOi!ӼUUԀj,:P`k^&-WITWGX\UgL.u~omj::|2@1A'{NQ%u3\QTr9>*^:sO,/m8&F#*l{)_+hP:#So]K"|odBt\S=i=ޕy@kH0'|U*e6z>տX$9a$G1c=Gʟ?/\(O?(OzVbtNxNL$osO ҸoaOjc i^ ēP-V\_P^2k _k4UȺlY n<_~dF^᎕E^QEo#h!t/nG"AϴY)Ź+p=5U`JU^A_dz5IbV%K$ Op,EXνz2VQrؖ=ɽIy2t=25K9jyfGF>:<0y`wnX0MIeZU_n;]w;thW(1 "uiൾʎUDjT/mhk\Tck #vVdnqXLk5>[ BiT^fjv-gS9[K-{' \1tI,2)R̵+Pt>YC>[Q%kCAkP=Źqb;6(ٝTq&Jf1LRT #]0nNے>̯%6+-O( cBKg7۬{as"l0HYJ´ZA7{wӡdbWH<@M{qf^j{SoQb+7F[r(veNLU rj" 65Rd1m]z&ꪬ\٠:.' AL5ۂ"+DQ7rnD Ue%bU-*xg= Mvej>H=5O7Nޙ'|ozfx͖vD N <ۍM yQ)1 =UNԱe E l{%;=N:IX4HYI9>W+siTԲH< 䆏SUZUi{b7whK5B,M[K1`8VWB^ۏ2Փ`ӫwv ҭZ/cX};_-ItPI4Qe2Zf/%騢Ol%Pv7lT9%3y1):рާ+B!"%U]HP A (fVq@1S&k_|NKi+q@~ M<1n[pIv~JX=3ѬFS$r;!ꚚkDʻUT&(1/l&' v犧/7M73iQRRI,{6l'pl|/!zȢ jQiW9sXRnO]K$IF鞢h&LbV#N\Ł[x!x EB 0dvmU:2%SUh @W$t2j(ˁɌ9~n6q`6U^ɷ C'Cu~ᥘKc*N)6X-=[>ojbQMS=dKOeQé:yOik44XAU|*9 f+PGS3_?5G~~e[4%RJ*6kekE:IS]IRcIu>o9^};/S2mퟀj&wMW*a7i%jzeyK.Aj+RXCA4qhD۽ɚR[S7s}2FEHhUE8~T4Z䟥ſ>A,@':4u-{z|y#O:]s;f=_AIԝYt T#Vb}"'grݛ?zmYB']TZrZw_?s,M,Im=??KU]QY g,7bzoɱ<=JP/8kHŘYxaeMeeRRԸ#N.:Xh?UUAB|LaTUx~]{ۤUPFZk`Uj`x.r#(m\=6[k*?oIe?˯{78Lȣw6] O=r8.u)^ SST"#4>qjQTuXo:S͏lxIHe)#?"Uȑ-ZO*cJ%:B:^I"nUR%VV344>uꑳ ˷Zϼhb 6?'+qՍg{Wwr?o PM<5t̙ )j/,-O^*i`o$0(V8I4,B@͔j& Ph;S"1JpnϣVJn SVTBd\ysT)dh >3(B=bh#Q.斢DҚ**c_-̲BVAN=,U]U;tJ u ҥ\PPTU5PI5ϤvfEMeLRerPa**rԪfi*v,|ʺh>Hiiku Y|u:IKG IC%}R-& 1(Ag2 N5 9C ξt6AO;tG^soq-T%.險*;xI<:f`JΤCTT@55+O^Hq>Jޗ^*L,,VO 5jL-(EVO ƇI s8XjF_ G`.Ң?gerhXi#Q*uƚO<~Ӗ9zY}/ٺb!F}*!U%@F@QSESNm橂h֪z*jgXԕR_SŁ )k&u3QI E\| ?S=8Tb`qݩYpफ़'bKM>#oU 9ZS Rt 4NT̤sd#gTSĔlV5#(&*#ɤkE0XQMI\55:t ,q&g#2hof1H!&bS*gTIәxKӼt5SQ'3I$ir$k"$p^0]-x™07RTF e Z`A+PR:as_qϯϤ$ukjq*5q@^ T䞱qr&8\kFtiᝣ̯-n2DJHBĨfHY-"h1ĚFp #*pNTӅ+<ۥgȦ?1Ƹgq[q+ɋJ&HEL TH@JA\D'*Z`&,6>䢏0D# ($=F ԒcNǻ ӍMnq"l qR UcTIpUUNJے Sxoy `kqV+Qm53NR PzRcDh{}EG E$C5X) 5,T8`HqD3hΝ"9[S[z-JMƵɑ ڍٕL+U yx2i^DG\g (RUl ,/_C=*QPhUUt.E]VN*5IR B MR4 Vp94O-NL=x_&Q)1r"v̎Sڒjk:y4D =|)TӽE6Z\eZSlL/[#;C d]7pSTfUM*Pք,J!ᓟSً>z P5uyϣUD5Jv6 },~?{GՍ6b=`$QqH6{@ˌ?1wK[/l?{WW(+kVe_yxŐe3SN[C gMn0h Y{p+7G'[n,| RĐW(d& -qWKxv 5Hx89ebz1mJTGɮyl3A4r`CRCMSKUQqE5\ĈOMM$T *\5XG dЮ5^Y̎\6e4 sh(/_g)=:~ɍMwS Oܛ<"E|E _iZ]ҥ;~S#WUPGƼH"ƃ`K/%?+Fc~,n>?^=Il7:mfAS.Bn+ـrMo߷QpMFʝUh:pE*?"U?jc 㟭7i*{:e _WW6}mϿ1}4n3/G o\n/.x"ßщ:kC: }OПZ _I_g-O=Uҙ/.qP:l|Hby?JgA""Ex>]))2s jvbQ/ȸbI_a@j_A6h]]Hx栐rAqH#ժ.'l{]/Ƥ^Deӫs?m}՟Z}~ WXEB?]_[{Eex',V#xGHZZ"G$-%_xClȾ+bZˇPmb)Op:UiN(zL8}LEbR`Xdv49ZjCJ4•E4rŸDT omPa3C Uzc|?g7?+2HM>I~m]?$rt!t$ѨcOX~}mne *|簸fG `OiFcLsxd$UK$)$>`H3W3us`?ٌ[%PkJ@|9TW2nƈ4q\i]>^4E?6855X5\,Um^:u x=M]Naцz^P2)4o>eJ2dr?[5x2qd`E;]qAi%b# ^4c!O ӵ$J^*hPYָ#ÎB+3#Խ4ecdZ)f_{y2ۈa#:UV//yÊ~}LVxVcfz0K/B8mwM("DaF8 IquqRPTzg׳ZEt.&Mt _ý%%\PNcYF&[~>tl s?lᖮZ(άtR*&/͇رM@`upkƼIC׾9yw*M}CW@]]]SQqJZYKnt0Ș3Qc*!b VY)$IUp=>C1~'?VcoJ/?_ٿӿxnB*>QA1*[uR( M\6o'2lLJB@ s<$ UWh$궑wqc mZRӇ~β.eV -={6h)*0Xoغgzk~q[C{SHaW#{~M>t^{G[sO[\_@}o}7yz]^ܿA{דȾYEG:?<N[QԸG_g{狞wnL(+&NA2 pD32?m$aXܳ!MlDhuiQL 1\Z[T7rk #Plҹ^% ̆\M.f#GWn o`RJy.qu4j&;4/{Զz|յG³R*w 0dh|>!E!j:9(:C1_5(v ) =M*+O`vɇ6ۜlDT+nzN%`ƴЏf.߃pV3iVe:ɽwnK"2tgIJ4tεJ Vi+D؜P@֛sgPA֠c93䉊dU 4Z)׉R2ÎfpKN.K3V45|Bя Vs*vF 3[ ]Af/[n:~`qԤ۲Xzh)P:%uIE%6 5]u%T4{g=-2)I4")PE]%DNJ4ݤМbFw(1zՉK$-* -Uknf۰;p̛;)=ѹqL5͒Jie@[Rw rIk{v-i%ˮV%MR[9qCĝ4 }g8 )6_nVĒ oL@E?'W̜{O%BE2xjIL%^S$'yi1]bct66VM}VF چE#I;,wvS9z'Q z|n>3{ $)XGX] *jEGggj.w%hH2⬠ϧUN OmsN^͹/(cbԑ0xӴ2I9׬XA(cQmLce0=ݘXwkPERb7n>w\dTs8y*~IQ)+{V{ȎG"9 ;sGyngvCD[BPǦhJdf9cs,䳖H$1h$P$Z͵?,nW8dBSn5RI_vpQ,]la|6-ϵ^i;TO܁"#}1٩a mTDuI%[Ki@Fʉ0lIӯ^#\WT΅FUcZF:Y d;(y44Sb 4M%%eHoHg@ي3~ 1yxο穷NJMߎӦ24Քu YVgMgA9+ֶT͑aJ%CIv BZ۲MXI45'855STKW-B:vѪh>.+TA{0 an9Ntb&ϸ3SRfb@)MA.{3A=44i!2:/Z/E0 yHy+#*y+[ެ,٢q}-dj V".rnNe/ʯ4954ZF YCkIiGl&Um7n)55f#2zdMWQ-;|W+]4aեzӻ;X.#%-PrJ*EtP k4M wWWjM.b+fD9`!SQ =] }zS 6:-4_q2q5k!! d@A]{>Y= &xLMii&au'WU'|E?/uŕ]J?cPn}f! bnUu0 9BRV@RǏX% < {,u5sێe}7XΆWbf"EqщEK#hsMWK{7?>:jm!uXx{vn: ީA:'pڛ{ &c?ATa?Qa*n?@Tт߃{~u?:~S}ETI*.] +:nH}9:̇jd0PAa6!#[7o^rn. Ni[ZzwV*5YZ/{z/Zus ϐ.$*M9'bK$N?^2T[I8>WPr+:/oVD1VJ7ƽz["5"8lMTc!>XA`٦돗`?>1Wup:TcQofmG T2E-ըXA콬fSP@.Ӊ:zEVy.Fk'صݘJ:.MRC!!{KP e>dѭ>iJ5S#n6}ڕ0p@6}pDʨ3DUDt%PAn[ئa[u+}99вߞ $qPi"ö7vz_JuVZ[G3b 1A3fUk]QD#vtIagcX'].:1l^t)IEGW5D *낒OQ ɊIeK$"D֠1P),Gp3Wm&6(I/]Aν[/VUy]v9pgs,枮-FCo8^ڰ*)(b]Am|vAM÷2L\-=f#/*%# zܬK $}tLKU)nbF$*4 B3N-}J:+ =}z:0Y{yi鳻~hvmyXvj!tSi块TuH*X?yՕPKilma_$kHG(\}\r 1˥+汮(qn廝"Ra@pA6wV=^қeY\קؚڽe)(rSׇM>:j0z;:vVSSS[-)jsy#a ն}[M ZMU*Gi4FNm r+j`@ :q:[Ir\^ݛٍ_xi7LYhk[BۍI4Pɐ|>H)){((+%o]1H(jiWp*EuuT;)k&eieem9i%P:ؽ*kP[RPCHq DIVa M5?5n-ػ Prty[u51&Vd25pc$uZHeTaK 0Y. y?d,M-Jn饉=NjL-],J;J[#ktrRGmzL&5KU* S\=*@ PXIQJAF. 8ZW{pw=>FC;OogsWST6VXl^H27v>*Jq-0Dz\I%T0#WuJF$ȰVE'˷_P(p>A 8T_Y*L5*cQH:)>?o?Xіv%l/=nFCZ*Ey,MwlL_]hfv2Jl^U;s1rn-O{*WF ,Zy1y [riT(:2KǗjH0]L%ZU9Ztx~Rt]VnznO`t_`e,-[{ˋm[M DDK )4Y} X"a+2>@4PAØ!Ԓ ~USAS4PE3 T5T`F[=5|@A kP%>_?Z⺕Op]5q>ȯ` О~.kNplj?y!['{@>@R#;D~~E{؋PA>iv WgbG?R.}.}gTZ#p~t"ҵ S++IG@}јi]mZؒK=fӿFOӏ{HOuhM]eݿp9Kj?nӢ]?OoJ>w|Ho*uVbA 1s{As"~-W$-u#S3JK\RQ3T,i2,^Ɋɜ}4[Pj+N2zZJꚨ"YGCuGU{TiC ̱x+W+ԕ C)cWw!